Multiple sequence alignment - TraesCS7B01G395500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G395500 chr7B 100.000 2201 0 0 1 2201 662732240 662730040 0.000000e+00 4065.0
1 TraesCS7B01G395500 chr7B 98.546 2201 32 0 1 2201 663094099 663096299 0.000000e+00 3888.0
2 TraesCS7B01G395500 chr2A 99.092 2202 19 1 1 2201 726901128 726903329 0.000000e+00 3954.0
3 TraesCS7B01G395500 chr3B 98.774 2202 26 1 1 2201 201569460 201571661 0.000000e+00 3916.0
4 TraesCS7B01G395500 chr3B 98.455 2201 32 2 1 2201 201544844 201542646 0.000000e+00 3875.0
5 TraesCS7B01G395500 chr3B 97.718 1665 35 2 1 1663 757831130 757832793 0.000000e+00 2861.0
6 TraesCS7B01G395500 chr3B 99.093 772 7 0 1 772 201548627 201547856 0.000000e+00 1387.0
7 TraesCS7B01G395500 chr3B 99.275 552 3 1 898 1448 201547317 201547868 0.000000e+00 996.0
8 TraesCS7B01G395500 chr3B 97.303 482 13 0 1720 2201 757833037 757833518 0.000000e+00 819.0
9 TraesCS7B01G395500 chr3B 98.802 334 4 0 1512 1845 733064810 733064477 1.450000e-166 595.0
10 TraesCS7B01G395500 chr3B 87.726 277 16 4 1633 1907 169829422 169829162 7.630000e-80 307.0
11 TraesCS7B01G395500 chr3B 92.718 206 7 4 726 931 32745154 32745351 7.690000e-75 291.0
12 TraesCS7B01G395500 chr3B 94.776 134 7 0 2033 2166 720536101 720535968 2.210000e-50 209.0
13 TraesCS7B01G395500 chr3B 90.769 65 6 0 1968 2032 133197456 133197392 1.080000e-13 87.9
14 TraesCS7B01G395500 chr3D 98.638 2202 28 2 1 2201 589258201 589260401 0.000000e+00 3899.0
15 TraesCS7B01G395500 chr5D 98.592 2202 29 2 1 2201 503250597 503248397 0.000000e+00 3893.0
16 TraesCS7B01G395500 chr2D 98.501 2201 30 3 1 2201 272806923 272809120 0.000000e+00 3879.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G395500 chr7B 662730040 662732240 2200 True 4065 4065 100.0000 1 2201 1 chr7B.!!$R1 2200
1 TraesCS7B01G395500 chr7B 663094099 663096299 2200 False 3888 3888 98.5460 1 2201 1 chr7B.!!$F1 2200
2 TraesCS7B01G395500 chr2A 726901128 726903329 2201 False 3954 3954 99.0920 1 2201 1 chr2A.!!$F1 2200
3 TraesCS7B01G395500 chr3B 201569460 201571661 2201 False 3916 3916 98.7740 1 2201 1 chr3B.!!$F3 2200
4 TraesCS7B01G395500 chr3B 201542646 201548627 5981 True 2631 3875 98.7740 1 2201 2 chr3B.!!$R5 2200
5 TraesCS7B01G395500 chr3B 757831130 757833518 2388 False 1840 2861 97.5105 1 2201 2 chr3B.!!$F4 2200
6 TraesCS7B01G395500 chr3B 201547317 201547868 551 False 996 996 99.2750 898 1448 1 chr3B.!!$F2 550
7 TraesCS7B01G395500 chr3D 589258201 589260401 2200 False 3899 3899 98.6380 1 2201 1 chr3D.!!$F1 2200
8 TraesCS7B01G395500 chr5D 503248397 503250597 2200 True 3893 3893 98.5920 1 2201 1 chr5D.!!$R1 2200
9 TraesCS7B01G395500 chr2D 272806923 272809120 2197 False 3879 3879 98.5010 1 2201 1 chr2D.!!$F1 2200

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
776 4561 1.893919 AAGAGACGGAAGGGCAGAGC 61.894 60.0 0.0 0.0 0.0 4.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2057 6030 0.041312 CAAAAACACAGGTCTCCGCG 60.041 55.0 0.0 0.0 0.0 6.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 113 5.462530 TTCTGTTCTACGATTCCACTTCA 57.537 39.130 0.00 0.0 0.00 3.02
647 648 2.628178 CGCCTAGGACACCAGAATATCA 59.372 50.000 14.75 0.0 0.00 2.15
756 4540 3.269381 CTGCCCTCCCTCTCTATCTATCT 59.731 52.174 0.00 0.0 0.00 1.98
763 4547 7.365652 CCCTCCCTCTCTATCTATCTAAGAGAC 60.366 48.148 0.00 0.0 40.56 3.36
776 4561 1.893919 AAGAGACGGAAGGGCAGAGC 61.894 60.000 0.00 0.0 0.00 4.09
1025 4811 1.289380 GAGAACCCGTCGCTGTCTT 59.711 57.895 0.00 0.0 0.00 3.01
1137 4923 2.347490 CGCACTTGGCTACCCAGT 59.653 61.111 0.00 0.0 43.37 4.00
1663 5449 4.020128 GGGTCTGACACAAGGTTAGAATCT 60.020 45.833 10.38 0.0 42.97 2.40
2057 6030 4.369182 CCCATACATGGTCTTACGACTTC 58.631 47.826 7.46 0.0 46.65 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
112 113 7.004691 ACTTAGGTATGCTCTTTCCTTTTGTT 58.995 34.615 0.0 0.0 0.0 2.83
502 503 8.951243 AGAATGATAAAAAGCTTAACACCTCTC 58.049 33.333 0.0 0.0 0.0 3.20
647 648 1.886542 GCCTTTCCTCGTTCATGGTTT 59.113 47.619 0.0 0.0 0.0 3.27
756 4540 1.475403 CTCTGCCCTTCCGTCTCTTA 58.525 55.000 0.0 0.0 0.0 2.10
763 4547 2.646121 AAAAAGCTCTGCCCTTCCG 58.354 52.632 0.0 0.0 0.0 4.30
1025 4811 2.731571 GCCTCCGGTATCACAGCCA 61.732 63.158 0.0 0.0 0.0 4.75
2057 6030 0.041312 CAAAAACACAGGTCTCCGCG 60.041 55.000 0.0 0.0 0.0 6.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.