Multiple sequence alignment - TraesCS7B01G395400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G395400 chr7B 100.000 2240 0 0 1 2240 662729407 662731646 0 4137
1 TraesCS7B01G395400 chr7B 98.259 2240 39 0 1 2240 663096932 663094693 0 3921
2 TraesCS7B01G395400 chr2A 98.884 2241 24 1 1 2240 726903962 726901722 0 3999
3 TraesCS7B01G395400 chr5D 98.483 2241 31 3 1 2240 503247765 503250003 0 3947
4 TraesCS7B01G395400 chr5D 98.261 2243 33 4 1 2240 503262283 503260044 0 3921
5 TraesCS7B01G395400 chr3D 98.438 2241 33 2 1 2240 589261034 589258795 0 3943
6 TraesCS7B01G395400 chr3B 98.394 2241 35 1 1 2240 201572294 201570054 0 3938
7 TraesCS7B01G395400 chr2D 98.304 2240 35 3 1 2240 272809753 272807517 0 3923
8 TraesCS7B01G395400 chr4A 98.124 2239 40 2 1 2239 583866413 583864177 0 3901
9 TraesCS7B01G395400 chr3A 97.991 2240 44 1 1 2240 695642878 695645116 0 3886


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G395400 chr7B 662729407 662731646 2239 False 4137 4137 100.000 1 2240 1 chr7B.!!$F1 2239
1 TraesCS7B01G395400 chr7B 663094693 663096932 2239 True 3921 3921 98.259 1 2240 1 chr7B.!!$R1 2239
2 TraesCS7B01G395400 chr2A 726901722 726903962 2240 True 3999 3999 98.884 1 2240 1 chr2A.!!$R1 2239
3 TraesCS7B01G395400 chr5D 503247765 503250003 2238 False 3947 3947 98.483 1 2240 1 chr5D.!!$F1 2239
4 TraesCS7B01G395400 chr5D 503260044 503262283 2239 True 3921 3921 98.261 1 2240 1 chr5D.!!$R1 2239
5 TraesCS7B01G395400 chr3D 589258795 589261034 2239 True 3943 3943 98.438 1 2240 1 chr3D.!!$R1 2239
6 TraesCS7B01G395400 chr3B 201570054 201572294 2240 True 3938 3938 98.394 1 2240 1 chr3B.!!$R1 2239
7 TraesCS7B01G395400 chr2D 272807517 272809753 2236 True 3923 3923 98.304 1 2240 1 chr2D.!!$R1 2239
8 TraesCS7B01G395400 chr4A 583864177 583866413 2236 True 3901 3901 98.124 1 2239 1 chr4A.!!$R1 2238
9 TraesCS7B01G395400 chr3A 695642878 695645116 2238 False 3886 3886 97.991 1 2240 1 chr3A.!!$F1 2239

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
776 778 0.041312 CAAAAACACAGGTCTCCGCG 60.041 55.0 0.0 0.0 0.0 6.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2186 2192 2.628178 CGCCTAGGACACCAGAATATCA 59.372 50.0 14.75 0.0 0.0 2.15 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
325 326 5.602978 CAGGTCAATATTCCTGTACTACCCT 59.397 44.000 12.91 0.0 44.19 4.34
360 361 1.480869 GGACGGAGGAGGCTAGGTTAT 60.481 57.143 0.00 0.0 0.00 1.89
362 363 1.499870 ACGGAGGAGGCTAGGTTATCT 59.500 52.381 0.00 0.0 0.00 1.98
516 517 0.392193 ATTGCTTCTCCACGAGGCTG 60.392 55.000 0.00 0.0 44.42 4.85
525 526 1.330655 CCACGAGGCTGATACCAGGT 61.331 60.000 0.00 0.0 40.72 4.00
776 778 0.041312 CAAAAACACAGGTCTCCGCG 60.041 55.000 0.00 0.0 0.00 6.46
2070 2076 2.646121 AAAAAGCTCTGCCCTTCCG 58.354 52.632 0.00 0.0 0.00 4.30
2077 2083 1.475403 CTCTGCCCTTCCGTCTCTTA 58.525 55.000 0.00 0.0 0.00 2.10
2186 2192 1.886542 GCCTTTCCTCGTTCATGGTTT 59.113 47.619 0.00 0.0 0.00 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
21 22 2.775856 GGGCGCTCGATCAGTGAGA 61.776 63.158 7.64 0.0 35.43 3.27
153 154 0.037326 ACATTCTCGCTTCCGCTTCA 60.037 50.000 0.00 0.0 0.00 3.02
325 326 0.033781 CGTCCCTCCGTACCAACAAA 59.966 55.000 0.00 0.0 0.00 2.83
360 361 9.053472 TCCTTAAACCTATAACCATCTTTCAGA 57.947 33.333 0.00 0.0 0.00 3.27
362 363 8.607713 TGTCCTTAAACCTATAACCATCTTTCA 58.392 33.333 0.00 0.0 0.00 2.69
516 517 1.299926 CGCCGTAGCACCTGGTATC 60.300 63.158 0.00 0.0 39.83 2.24
525 526 0.527600 CATACTTCAGCGCCGTAGCA 60.528 55.000 2.29 0.0 39.83 3.49
776 778 4.369182 CCCATACATGGTCTTACGACTTC 58.631 47.826 7.46 0.0 46.65 3.01
1170 1173 4.020128 GGGTCTGACACAAGGTTAGAATCT 60.020 45.833 10.38 0.0 42.97 2.40
2070 2076 7.365652 CCCTCCCTCTCTATCTATCTAAGAGAC 60.366 48.148 0.00 0.0 40.56 3.36
2077 2083 3.269381 CTGCCCTCCCTCTCTATCTATCT 59.731 52.174 0.00 0.0 0.00 1.98
2186 2192 2.628178 CGCCTAGGACACCAGAATATCA 59.372 50.000 14.75 0.0 0.00 2.15


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.