Multiple sequence alignment - TraesCS7B01G387400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G387400 chr7B 100.000 3377 0 0 1 3377 653281518 653278142 0.000000e+00 6237.0
1 TraesCS7B01G387400 chr7B 99.319 3379 21 1 1 3377 653221742 653218364 0.000000e+00 6111.0
2 TraesCS7B01G387400 chr7B 98.490 3378 24 5 1 3377 653170576 653167225 0.000000e+00 5930.0
3 TraesCS7B01G387400 chr7B 94.140 785 33 6 1 773 713959064 713959847 0.000000e+00 1182.0
4 TraesCS7B01G387400 chr7B 85.849 318 42 3 2516 2832 683681800 683681485 5.400000e-88 335.0
5 TraesCS7B01G387400 chr7B 88.235 255 29 1 3122 3376 189711068 189711321 1.520000e-78 303.0
6 TraesCS7B01G387400 chr7B 87.843 255 30 1 3122 3376 481268553 481268300 7.080000e-77 298.0
7 TraesCS7B01G387400 chr7B 71.094 1152 284 34 1245 2367 663499034 663497903 1.570000e-58 237.0
8 TraesCS7B01G387400 chr7B 100.000 35 0 0 2343 2377 653371675 653371641 7.820000e-07 65.8
9 TraesCS7B01G387400 chr7D 93.240 1790 78 12 906 2673 585151056 585149288 0.000000e+00 2595.0
10 TraesCS7B01G387400 chr7D 91.120 259 20 3 2873 3129 585149284 585149027 6.940000e-92 348.0
11 TraesCS7B01G387400 chr7D 85.106 329 44 5 2513 2838 164849869 164850195 6.980000e-87 331.0
12 TraesCS7B01G387400 chr7D 94.444 72 2 2 762 831 585151124 585151053 3.560000e-20 110.0
13 TraesCS7B01G387400 chr7A 81.010 1485 246 17 906 2374 675323787 675322323 0.000000e+00 1147.0
14 TraesCS7B01G387400 chr7A 75.839 596 113 18 1751 2317 675332749 675332156 1.190000e-69 274.0
15 TraesCS7B01G387400 chr5B 93.582 779 34 5 1 764 596887969 596887192 0.000000e+00 1147.0
16 TraesCS7B01G387400 chr5B 92.477 771 34 3 1 760 693977002 693976245 0.000000e+00 1081.0
17 TraesCS7B01G387400 chr5B 90.597 787 44 10 1 760 293464476 293463693 0.000000e+00 1016.0
18 TraesCS7B01G387400 chr5B 89.299 785 44 19 1 760 268854234 268855003 0.000000e+00 948.0
19 TraesCS7B01G387400 chr5B 85.893 319 40 5 2516 2832 476574964 476574649 5.400000e-88 335.0
20 TraesCS7B01G387400 chr5B 85.220 318 45 2 2516 2832 461300910 461301226 3.250000e-85 326.0
21 TraesCS7B01G387400 chr5B 86.842 266 32 3 3113 3376 148876524 148876788 9.160000e-76 294.0
22 TraesCS7B01G387400 chr5B 87.649 251 31 0 3126 3376 322326908 322327158 3.300000e-75 292.0
23 TraesCS7B01G387400 chr5B 86.466 266 33 3 3113 3376 148882706 148882970 4.260000e-74 289.0
24 TraesCS7B01G387400 chr1B 93.266 787 27 4 1 764 629667619 629666836 0.000000e+00 1136.0
25 TraesCS7B01G387400 chr1B 87.938 257 29 2 3122 3377 633860127 633860382 5.480000e-78 302.0
26 TraesCS7B01G387400 chr1B 87.645 259 29 3 3119 3376 576599841 576600097 7.080000e-77 298.0
27 TraesCS7B01G387400 chr2B 92.913 762 43 8 1 760 480913452 480912700 0.000000e+00 1098.0
28 TraesCS7B01G387400 chr2B 92.112 786 37 4 1 764 794739843 794739061 0.000000e+00 1085.0
29 TraesCS7B01G387400 chr2B 86.164 318 41 3 2516 2832 125974736 125975051 1.160000e-89 340.0
30 TraesCS7B01G387400 chr2B 85.849 318 43 2 2516 2832 754706324 754706008 1.500000e-88 337.0
31 TraesCS7B01G387400 chr2B 88.845 251 28 0 3126 3376 188264404 188264154 3.270000e-80 309.0
32 TraesCS7B01G387400 chr2B 84.839 310 26 10 470 764 152193285 152192982 3.300000e-75 292.0
33 TraesCS7B01G387400 chr6B 91.266 790 46 5 1 767 405005464 405004675 0.000000e+00 1055.0
34 TraesCS7B01G387400 chr6B 85.893 319 40 5 2516 2832 303056347 303056032 5.400000e-88 335.0
35 TraesCS7B01G387400 chr6B 88.636 88 5 3 820 906 285470813 285470730 5.960000e-18 102.0
36 TraesCS7B01G387400 chr3B 91.421 781 39 11 1 760 787502658 787503431 0.000000e+00 1046.0
37 TraesCS7B01G387400 chr3B 87.452 263 33 0 3114 3376 197773669 197773407 1.520000e-78 303.0
38 TraesCS7B01G387400 chr6A 86.439 789 66 22 4 768 613086241 613085470 0.000000e+00 826.0
39 TraesCS7B01G387400 chr6A 85.390 308 43 2 2526 2832 184741235 184740929 5.440000e-83 318.0
40 TraesCS7B01G387400 chr2A 86.207 319 39 4 2516 2832 507890346 507890031 1.160000e-89 340.0
41 TraesCS7B01G387400 chr2A 85.231 325 43 5 2512 2833 673515231 673515553 2.510000e-86 329.0
42 TraesCS7B01G387400 chr3A 85.358 321 42 4 2516 2835 114189293 114189609 9.030000e-86 327.0
43 TraesCS7B01G387400 chrUn 85.139 323 43 5 2516 2836 321263708 321264027 3.250000e-85 326.0
44 TraesCS7B01G387400 chrUn 87.645 259 25 7 3123 3376 2374574 2374318 9.160000e-76 294.0
45 TraesCS7B01G387400 chrUn 82.440 336 55 4 2516 2849 358202257 358202590 1.190000e-74 291.0
46 TraesCS7B01G387400 chrUn 86.328 256 34 1 3122 3376 52969800 52970055 9.230000e-71 278.0
47 TraesCS7B01G387400 chrUn 86.275 255 35 0 3122 3376 359528277 359528531 9.230000e-71 278.0
48 TraesCS7B01G387400 chrUn 86.275 255 35 0 3122 3376 420460590 420460844 9.230000e-71 278.0
49 TraesCS7B01G387400 chrUn 86.166 253 34 1 3125 3376 282654854 282654602 4.290000e-69 272.0
50 TraesCS7B01G387400 chrUn 86.166 253 32 3 3125 3376 31236169 31235919 1.540000e-68 270.0
51 TraesCS7B01G387400 chrUn 85.657 251 35 1 3126 3376 35883030 35882781 2.580000e-66 263.0
52 TraesCS7B01G387400 chrUn 100.000 28 0 0 2514 2541 30909615 30909588 6.000000e-03 52.8
53 TraesCS7B01G387400 chr2D 85.220 318 45 2 2516 2832 102568711 102569027 3.250000e-85 326.0
54 TraesCS7B01G387400 chr2D 88.845 251 28 0 3126 3376 537516221 537516471 3.270000e-80 309.0
55 TraesCS7B01G387400 chr2D 87.795 254 27 3 3124 3376 390728551 390728801 9.160000e-76 294.0
56 TraesCS7B01G387400 chr2D 87.649 251 30 1 3126 3376 611216767 611216518 1.190000e-74 291.0
57 TraesCS7B01G387400 chr3D 84.830 323 44 5 2516 2836 585617030 585617349 1.510000e-83 320.0
58 TraesCS7B01G387400 chr3D 84.790 309 43 4 2516 2822 189286713 189286407 1.180000e-79 307.0
59 TraesCS7B01G387400 chr5D 84.308 325 47 3 2511 2832 41244510 41244833 7.030000e-82 315.0
60 TraesCS7B01G387400 chr5D 83.951 324 45 5 2512 2832 7981060 7981379 1.520000e-78 303.0
61 TraesCS7B01G387400 chr5D 88.095 252 29 1 3126 3376 315627606 315627355 7.080000e-77 298.0
62 TraesCS7B01G387400 chr5D 87.795 254 29 2 3125 3377 495141261 495141513 2.550000e-76 296.0
63 TraesCS7B01G387400 chr5D 87.008 254 31 2 3125 3377 495198628 495198880 5.520000e-73 285.0
64 TraesCS7B01G387400 chr5D 84.727 275 41 1 2522 2796 407975844 407976117 1.190000e-69 274.0
65 TraesCS7B01G387400 chr4D 84.277 318 47 3 2516 2832 302342933 302343248 1.180000e-79 307.0
66 TraesCS7B01G387400 chr4D 85.547 256 33 4 3122 3376 472217852 472218104 7.180000e-67 265.0
67 TraesCS7B01G387400 chr4D 87.097 62 6 1 2511 2572 437135599 437135658 6.050000e-08 69.4
68 TraesCS7B01G387400 chr1D 87.251 251 31 1 3126 3376 430113572 430113323 5.520000e-73 285.0
69 TraesCS7B01G387400 chr1D 86.166 253 35 0 3124 3376 357157907 357157655 1.190000e-69 274.0
70 TraesCS7B01G387400 chr1D 82.178 303 42 11 2543 2839 457182787 457182491 2.010000e-62 250.0
71 TraesCS7B01G387400 chr1D 88.636 88 2 3 820 906 137782120 137782200 2.140000e-17 100.0
72 TraesCS7B01G387400 chr4B 86.381 257 35 0 3120 3376 37346502 37346246 7.130000e-72 281.0
73 TraesCS7B01G387400 chr4B 86.667 255 33 1 3122 3376 646813375 646813628 7.130000e-72 281.0
74 TraesCS7B01G387400 chr4B 89.655 87 5 3 820 906 24755312 24755230 1.280000e-19 108.0
75 TraesCS7B01G387400 chr4B 89.773 88 4 3 820 906 576706132 576706215 1.280000e-19 108.0
76 TraesCS7B01G387400 chr4B 88.636 88 2 3 820 906 252325232 252325152 2.140000e-17 100.0
77 TraesCS7B01G387400 chr4B 88.636 88 2 3 820 906 331137591 331137511 2.140000e-17 100.0
78 TraesCS7B01G387400 chr6D 86.800 250 33 0 3127 3376 431068635 431068386 2.570000e-71 279.0
79 TraesCS7B01G387400 chr6D 80.496 282 52 3 2553 2832 124938631 124938351 2.640000e-51 213.0
80 TraesCS7B01G387400 chr6D 88.636 88 2 3 820 906 103322427 103322347 2.140000e-17 100.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G387400 chr7B 653278142 653281518 3376 True 6237.000000 6237 100.000000 1 3377 1 chr7B.!!$R4 3376
1 TraesCS7B01G387400 chr7B 653218364 653221742 3378 True 6111.000000 6111 99.319000 1 3377 1 chr7B.!!$R3 3376
2 TraesCS7B01G387400 chr7B 653167225 653170576 3351 True 5930.000000 5930 98.490000 1 3377 1 chr7B.!!$R2 3376
3 TraesCS7B01G387400 chr7B 713959064 713959847 783 False 1182.000000 1182 94.140000 1 773 1 chr7B.!!$F2 772
4 TraesCS7B01G387400 chr7B 663497903 663499034 1131 True 237.000000 237 71.094000 1245 2367 1 chr7B.!!$R6 1122
5 TraesCS7B01G387400 chr7D 585149027 585151124 2097 True 1017.666667 2595 92.934667 762 3129 3 chr7D.!!$R1 2367
6 TraesCS7B01G387400 chr7A 675322323 675323787 1464 True 1147.000000 1147 81.010000 906 2374 1 chr7A.!!$R1 1468
7 TraesCS7B01G387400 chr7A 675332156 675332749 593 True 274.000000 274 75.839000 1751 2317 1 chr7A.!!$R2 566
8 TraesCS7B01G387400 chr5B 596887192 596887969 777 True 1147.000000 1147 93.582000 1 764 1 chr5B.!!$R3 763
9 TraesCS7B01G387400 chr5B 693976245 693977002 757 True 1081.000000 1081 92.477000 1 760 1 chr5B.!!$R4 759
10 TraesCS7B01G387400 chr5B 293463693 293464476 783 True 1016.000000 1016 90.597000 1 760 1 chr5B.!!$R1 759
11 TraesCS7B01G387400 chr5B 268854234 268855003 769 False 948.000000 948 89.299000 1 760 1 chr5B.!!$F3 759
12 TraesCS7B01G387400 chr1B 629666836 629667619 783 True 1136.000000 1136 93.266000 1 764 1 chr1B.!!$R1 763
13 TraesCS7B01G387400 chr2B 480912700 480913452 752 True 1098.000000 1098 92.913000 1 760 1 chr2B.!!$R3 759
14 TraesCS7B01G387400 chr2B 794739061 794739843 782 True 1085.000000 1085 92.112000 1 764 1 chr2B.!!$R5 763
15 TraesCS7B01G387400 chr6B 405004675 405005464 789 True 1055.000000 1055 91.266000 1 767 1 chr6B.!!$R3 766
16 TraesCS7B01G387400 chr3B 787502658 787503431 773 False 1046.000000 1046 91.421000 1 760 1 chr3B.!!$F1 759
17 TraesCS7B01G387400 chr6A 613085470 613086241 771 True 826.000000 826 86.439000 4 768 1 chr6A.!!$R2 764

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
655 765 2.110901 TTTTTAATACGCGCCTGGGA 57.889 45.0 5.73 0.0 0.0 4.37 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2641 2824 6.519679 ACATTACATGCATTGATGTGTTCT 57.48 33.333 15.01 0.0 37.16 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
597 687 4.739195 TGCCATGTTTAGCCGAAATTTAC 58.261 39.130 0.00 0.0 0.00 2.01
655 765 2.110901 TTTTTAATACGCGCCTGGGA 57.889 45.000 5.73 0.0 0.00 4.37
851 976 8.854614 AAACAGTTTTGCTAGAACTCATCTAT 57.145 30.769 0.00 0.0 39.88 1.98
894 1019 5.116180 TGGTCTCATTCACCTTTTATAGCG 58.884 41.667 0.00 0.0 34.66 4.26
2780 2963 9.793252 GATACATTTCTTCACATACAAAATGCT 57.207 29.630 6.14 0.0 39.68 3.79
3093 3277 3.838271 GATCGAGCAGCGTGGGGA 61.838 66.667 0.00 0.0 41.80 4.81
3141 3325 8.653338 CGAGAATTTCCGAAATTACTAGTTCAA 58.347 33.333 17.21 0.0 40.97 2.69
3172 3356 5.246656 TCATTGCAAAGATCATTCCAACCTT 59.753 36.000 1.71 0.0 0.00 3.50
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
597 687 6.477688 TCGGCGAAGTTATGATAAAAAGTAGG 59.522 38.462 7.35 0.00 0.00 3.18
655 765 4.280019 GGTCCCCAGCCGTTGGTT 62.280 66.667 0.09 0.00 46.25 3.67
894 1019 7.756395 AATCCATCAGTGTTCATATCCAATC 57.244 36.000 0.00 0.00 0.00 2.67
2641 2824 6.519679 ACATTACATGCATTGATGTGTTCT 57.480 33.333 15.01 0.00 37.16 3.01
2780 2963 9.912634 GTTGAAATCTGAATCTTATCAACCAAA 57.087 29.630 0.00 0.00 39.29 3.28
3141 3325 6.541641 GGAATGATCTTTGCAATGAGTACTCT 59.458 38.462 23.01 6.72 0.00 3.24
3172 3356 2.238646 ACCCATTTATCGCAACCTGAGA 59.761 45.455 0.00 0.00 0.00 3.27
3272 3456 4.378978 CGAGATTTGGACGCATGGTTTAAA 60.379 41.667 0.00 0.00 0.00 1.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.