Multiple sequence alignment - TraesCS7B01G385000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G385000 chr7B 100.000 2933 0 0 1 2933 650409929 650406997 0.000000e+00 5417
1 TraesCS7B01G385000 chr7B 99.557 2934 10 2 1 2933 650362944 650360013 0.000000e+00 5343
2 TraesCS7B01G385000 chr7B 96.391 2937 95 7 1 2933 650318674 650315745 0.000000e+00 4826
3 TraesCS7B01G385000 chr7B 96.196 2944 89 10 1 2933 650295749 650292818 0.000000e+00 4795
4 TraesCS7B01G385000 chr7B 94.623 2957 92 22 1 2933 650456650 650453737 0.000000e+00 4518
5 TraesCS7B01G385000 chr7B 96.780 1646 29 4 1 1637 650301887 650300257 0.000000e+00 2724
6 TraesCS7B01G385000 chr7B 94.259 958 44 5 1977 2933 19347180 19346233 0.000000e+00 1454
7 TraesCS7B01G385000 chr7B 93.983 964 47 6 1971 2933 613665011 613664058 0.000000e+00 1448
8 TraesCS7B01G385000 chr7B 76.699 412 59 20 19 416 625611860 625612248 8.290000e-46 195
9 TraesCS7B01G385000 chrUn 100.000 1426 0 0 1508 2933 388901873 388903298 0.000000e+00 2634
10 TraesCS7B01G385000 chrUn 99.790 1426 3 0 1508 2933 388900209 388901634 0.000000e+00 2617
11 TraesCS7B01G385000 chr7D 91.550 1503 87 15 481 1976 582651347 582649878 0.000000e+00 2036
12 TraesCS7B01G385000 chr7D 90.885 1503 80 21 481 1976 582545874 582544422 0.000000e+00 1964
13 TraesCS7B01G385000 chr7D 90.468 1175 90 14 532 1699 582748400 582747241 0.000000e+00 1530
14 TraesCS7B01G385000 chr7D 88.490 1225 96 18 481 1699 582662724 582661539 0.000000e+00 1439
15 TraesCS7B01G385000 chr7D 90.977 133 6 3 20 146 635385358 635385490 1.080000e-39 174
16 TraesCS7B01G385000 chr7A 87.723 1401 135 28 484 1864 674506723 674505340 0.000000e+00 1600
17 TraesCS7B01G385000 chr7A 89.216 1224 102 16 481 1698 674738320 674737121 0.000000e+00 1502
18 TraesCS7B01G385000 chr7A 89.216 1224 102 16 481 1698 674753054 674751855 0.000000e+00 1502
19 TraesCS7B01G385000 chr7A 91.729 399 26 4 481 879 674522976 674522585 5.530000e-152 547
20 TraesCS7B01G385000 chr7A 91.272 401 27 5 481 881 674527245 674526853 9.250000e-150 540
21 TraesCS7B01G385000 chr4B 94.062 960 48 4 1975 2933 621843322 621842371 0.000000e+00 1448
22 TraesCS7B01G385000 chr1B 94.056 959 45 6 1976 2933 55392342 55391395 0.000000e+00 1445
23 TraesCS7B01G385000 chr3B 86.928 306 35 4 143 445 446983220 446983523 3.620000e-89 339
24 TraesCS7B01G385000 chr2D 84.831 178 19 5 303 480 11981071 11981240 3.890000e-39 172
25 TraesCS7B01G385000 chr5D 84.667 150 19 2 297 446 455873439 455873294 2.360000e-31 147


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G385000 chr7B 650406997 650409929 2932 True 5417.0 5417 100.0000 1 2933 1 chr7B.!!$R7 2932
1 TraesCS7B01G385000 chr7B 650360013 650362944 2931 True 5343.0 5343 99.5570 1 2933 1 chr7B.!!$R6 2932
2 TraesCS7B01G385000 chr7B 650315745 650318674 2929 True 4826.0 4826 96.3910 1 2933 1 chr7B.!!$R5 2932
3 TraesCS7B01G385000 chr7B 650292818 650295749 2931 True 4795.0 4795 96.1960 1 2933 1 chr7B.!!$R3 2932
4 TraesCS7B01G385000 chr7B 650453737 650456650 2913 True 4518.0 4518 94.6230 1 2933 1 chr7B.!!$R8 2932
5 TraesCS7B01G385000 chr7B 650300257 650301887 1630 True 2724.0 2724 96.7800 1 1637 1 chr7B.!!$R4 1636
6 TraesCS7B01G385000 chr7B 19346233 19347180 947 True 1454.0 1454 94.2590 1977 2933 1 chr7B.!!$R1 956
7 TraesCS7B01G385000 chr7B 613664058 613665011 953 True 1448.0 1448 93.9830 1971 2933 1 chr7B.!!$R2 962
8 TraesCS7B01G385000 chrUn 388900209 388903298 3089 False 2625.5 2634 99.8950 1508 2933 2 chrUn.!!$F1 1425
9 TraesCS7B01G385000 chr7D 582649878 582651347 1469 True 2036.0 2036 91.5500 481 1976 1 chr7D.!!$R2 1495
10 TraesCS7B01G385000 chr7D 582544422 582545874 1452 True 1964.0 1964 90.8850 481 1976 1 chr7D.!!$R1 1495
11 TraesCS7B01G385000 chr7D 582747241 582748400 1159 True 1530.0 1530 90.4680 532 1699 1 chr7D.!!$R4 1167
12 TraesCS7B01G385000 chr7D 582661539 582662724 1185 True 1439.0 1439 88.4900 481 1699 1 chr7D.!!$R3 1218
13 TraesCS7B01G385000 chr7A 674505340 674506723 1383 True 1600.0 1600 87.7230 484 1864 1 chr7A.!!$R1 1380
14 TraesCS7B01G385000 chr7A 674737121 674738320 1199 True 1502.0 1502 89.2160 481 1698 1 chr7A.!!$R2 1217
15 TraesCS7B01G385000 chr7A 674751855 674753054 1199 True 1502.0 1502 89.2160 481 1698 1 chr7A.!!$R3 1217
16 TraesCS7B01G385000 chr7A 674522585 674527245 4660 True 543.5 547 91.5005 481 881 2 chr7A.!!$R4 400
17 TraesCS7B01G385000 chr4B 621842371 621843322 951 True 1448.0 1448 94.0620 1975 2933 1 chr4B.!!$R1 958
18 TraesCS7B01G385000 chr1B 55391395 55392342 947 True 1445.0 1445 94.0560 1976 2933 1 chr1B.!!$R1 957

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1076 5368 3.149648 GCAATGGCGCCCTCCAAT 61.15 61.111 26.77 7.28 39.96 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2070 6425 0.989602 AAGAACCGGGACTAAAGGGG 59.01 55.0 6.32 0.0 0.0 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1076 5368 3.149648 GCAATGGCGCCCTCCAAT 61.15 61.111 26.77 7.28 39.96 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1076 5368 3.812019 GCGAGGAAGACGGCGAGA 61.812 66.667 16.62 0.0 0.0 4.04
1354 5649 1.750399 CCGAGAATGTTGGCCCTGG 60.750 63.158 0.00 0.0 0.0 4.45
2070 6425 0.989602 AAGAACCGGGACTAAAGGGG 59.010 55.000 6.32 0.0 0.0 4.79


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.