Multiple sequence alignment - TraesCS7B01G383400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G383400 chr7B 100.000 2445 0 0 1 2445 649152885 649155329 0.000000e+00 4516.0
1 TraesCS7B01G383400 chr7B 92.254 2285 135 12 194 2445 335975198 335977473 0.000000e+00 3201.0
2 TraesCS7B01G383400 chr7B 88.725 204 21 2 1 202 733441251 733441454 5.220000e-62 248.0
3 TraesCS7B01G383400 chrUn 98.410 2138 32 2 1 2137 322407450 322405314 0.000000e+00 3759.0
4 TraesCS7B01G383400 chrUn 100.000 429 0 0 1 429 330879537 330879109 0.000000e+00 793.0
5 TraesCS7B01G383400 chrUn 87.736 212 14 4 195 396 350482294 350482085 1.130000e-58 237.0
6 TraesCS7B01G383400 chrUn 97.959 49 1 0 203 251 463251990 463251942 4.330000e-13 86.1
7 TraesCS7B01G383400 chrUn 97.059 34 1 0 111 144 16690520 16690553 9.440000e-05 58.4
8 TraesCS7B01G383400 chrUn 100.000 29 0 0 116 144 124714038 124714010 1.000000e-03 54.7
9 TraesCS7B01G383400 chrUn 100.000 28 0 0 117 144 124713749 124713722 4.000000e-03 52.8
10 TraesCS7B01G383400 chrUn 100.000 28 0 0 117 144 124713845 124713818 4.000000e-03 52.8
11 TraesCS7B01G383400 chrUn 100.000 28 0 0 117 144 124714129 124714102 4.000000e-03 52.8
12 TraesCS7B01G383400 chr4B 93.372 2263 128 8 203 2445 12629302 12631562 0.000000e+00 3328.0
13 TraesCS7B01G383400 chr4B 92.207 2284 133 10 203 2443 416121484 416123765 0.000000e+00 3190.0
14 TraesCS7B01G383400 chr4B 91.536 2292 143 9 203 2445 656105768 656103479 0.000000e+00 3110.0
15 TraesCS7B01G383400 chr4B 91.301 2299 141 16 203 2445 15373679 15375974 0.000000e+00 3083.0
16 TraesCS7B01G383400 chr4B 87.008 254 23 2 200 444 604041734 604041482 6.660000e-71 278.0
17 TraesCS7B01G383400 chr4B 86.603 209 22 6 1 206 664504345 664504140 2.450000e-55 226.0
18 TraesCS7B01G383400 chr5D 92.966 2289 110 19 203 2443 550663421 550665706 0.000000e+00 3288.0
19 TraesCS7B01G383400 chr5D 91.350 2185 155 24 203 2365 379940142 379937970 0.000000e+00 2957.0
20 TraesCS7B01G383400 chr5D 87.052 2147 231 33 313 2443 324577014 324574899 0.000000e+00 2381.0
21 TraesCS7B01G383400 chr5D 86.700 203 26 1 1 202 398369996 398370198 8.800000e-55 224.0
22 TraesCS7B01G383400 chr1B 92.432 2286 119 12 203 2445 387822035 387819761 0.000000e+00 3214.0
23 TraesCS7B01G383400 chr6B 91.217 2300 144 22 202 2445 305028268 305030565 0.000000e+00 3075.0
24 TraesCS7B01G383400 chr2B 91.255 2287 155 9 203 2445 36087969 36085684 0.000000e+00 3073.0
25 TraesCS7B01G383400 chr2B 89.655 203 17 4 1 202 82865812 82866011 3.120000e-64 255.0
26 TraesCS7B01G383400 chr5B 91.446 2233 134 10 203 2388 641513659 641511437 0.000000e+00 3013.0
27 TraesCS7B01G383400 chr5B 88.177 203 23 1 1 202 493937355 493937557 8.740000e-60 241.0
28 TraesCS7B01G383400 chr4A 90.065 2295 166 16 199 2445 695140278 695142558 0.000000e+00 2918.0
29 TraesCS7B01G383400 chr4A 89.848 197 11 1 201 388 666796240 666796044 6.750000e-61 244.0
30 TraesCS7B01G383400 chr4A 88.235 204 21 3 1 202 715175532 715175734 8.740000e-60 241.0
31 TraesCS7B01G383400 chr3B 88.962 2265 199 26 201 2445 37856871 37854638 0.000000e+00 2750.0
32 TraesCS7B01G383400 chr3B 87.736 212 14 4 195 396 822279069 822279278 1.130000e-58 237.0
33 TraesCS7B01G383400 chr3B 87.736 212 14 4 195 396 825174079 825173870 1.130000e-58 237.0
34 TraesCS7B01G383400 chr7D 86.715 2213 242 32 259 2445 159087559 159089745 0.000000e+00 2410.0
35 TraesCS7B01G383400 chr7D 88.500 200 22 1 7 205 631258231 631258032 8.740000e-60 241.0
36 TraesCS7B01G383400 chr4D 85.612 2099 230 47 364 2442 494425551 494427597 0.000000e+00 2137.0
37 TraesCS7B01G383400 chr4D 88.725 204 20 3 1 202 462735542 462735744 1.880000e-61 246.0
38 TraesCS7B01G383400 chr4D 87.379 206 25 1 1 205 496334227 496334022 4.060000e-58 235.0
39 TraesCS7B01G383400 chr4D 94.118 34 2 0 111 144 496330340 496330373 4.000000e-03 52.8
40 TraesCS7B01G383400 chr7A 90.710 1367 108 6 1084 2443 461475439 461474085 0.000000e+00 1803.0
41 TraesCS7B01G383400 chr1D 90.291 206 19 1 1 205 6977122 6976917 4.010000e-68 268.0
42 TraesCS7B01G383400 chr1D 84.925 199 28 2 6 202 4670659 4670857 1.480000e-47 200.0
43 TraesCS7B01G383400 chr1D 80.097 206 19 6 1 205 72433439 72433255 1.530000e-27 134.0
44 TraesCS7B01G383400 chr1D 77.419 186 38 2 10 192 381965262 381965078 9.240000e-20 108.0
45 TraesCS7B01G383400 chr2D 90.196 204 18 2 1 202 638655181 638655384 5.180000e-67 265.0
46 TraesCS7B01G383400 chr6D 89.372 207 21 1 1 206 448962746 448962952 2.410000e-65 259.0
47 TraesCS7B01G383400 chr6D 100.000 29 0 0 114 142 33148808 33148780 1.000000e-03 54.7
48 TraesCS7B01G383400 chr6D 100.000 29 0 0 114 142 55164119 55164147 1.000000e-03 54.7
49 TraesCS7B01G383400 chr6D 100.000 29 0 0 114 142 55164215 55164243 1.000000e-03 54.7
50 TraesCS7B01G383400 chr6D 100.000 29 0 0 114 142 55164311 55164339 1.000000e-03 54.7
51 TraesCS7B01G383400 chr3D 86.829 205 24 2 1 202 563689405 563689609 2.450000e-55 226.0
52 TraesCS7B01G383400 chr1A 86.070 201 27 1 1 200 41900373 41900173 5.300000e-52 215.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G383400 chr7B 649152885 649155329 2444 False 4516 4516 100.000 1 2445 1 chr7B.!!$F2 2444
1 TraesCS7B01G383400 chr7B 335975198 335977473 2275 False 3201 3201 92.254 194 2445 1 chr7B.!!$F1 2251
2 TraesCS7B01G383400 chrUn 322405314 322407450 2136 True 3759 3759 98.410 1 2137 1 chrUn.!!$R1 2136
3 TraesCS7B01G383400 chr4B 12629302 12631562 2260 False 3328 3328 93.372 203 2445 1 chr4B.!!$F1 2242
4 TraesCS7B01G383400 chr4B 416121484 416123765 2281 False 3190 3190 92.207 203 2443 1 chr4B.!!$F3 2240
5 TraesCS7B01G383400 chr4B 656103479 656105768 2289 True 3110 3110 91.536 203 2445 1 chr4B.!!$R2 2242
6 TraesCS7B01G383400 chr4B 15373679 15375974 2295 False 3083 3083 91.301 203 2445 1 chr4B.!!$F2 2242
7 TraesCS7B01G383400 chr5D 550663421 550665706 2285 False 3288 3288 92.966 203 2443 1 chr5D.!!$F2 2240
8 TraesCS7B01G383400 chr5D 379937970 379940142 2172 True 2957 2957 91.350 203 2365 1 chr5D.!!$R2 2162
9 TraesCS7B01G383400 chr5D 324574899 324577014 2115 True 2381 2381 87.052 313 2443 1 chr5D.!!$R1 2130
10 TraesCS7B01G383400 chr1B 387819761 387822035 2274 True 3214 3214 92.432 203 2445 1 chr1B.!!$R1 2242
11 TraesCS7B01G383400 chr6B 305028268 305030565 2297 False 3075 3075 91.217 202 2445 1 chr6B.!!$F1 2243
12 TraesCS7B01G383400 chr2B 36085684 36087969 2285 True 3073 3073 91.255 203 2445 1 chr2B.!!$R1 2242
13 TraesCS7B01G383400 chr5B 641511437 641513659 2222 True 3013 3013 91.446 203 2388 1 chr5B.!!$R1 2185
14 TraesCS7B01G383400 chr4A 695140278 695142558 2280 False 2918 2918 90.065 199 2445 1 chr4A.!!$F1 2246
15 TraesCS7B01G383400 chr3B 37854638 37856871 2233 True 2750 2750 88.962 201 2445 1 chr3B.!!$R1 2244
16 TraesCS7B01G383400 chr7D 159087559 159089745 2186 False 2410 2410 86.715 259 2445 1 chr7D.!!$F1 2186
17 TraesCS7B01G383400 chr4D 494425551 494427597 2046 False 2137 2137 85.612 364 2442 1 chr4D.!!$F2 2078
18 TraesCS7B01G383400 chr7A 461474085 461475439 1354 True 1803 1803 90.710 1084 2443 1 chr7A.!!$R1 1359

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
545 567 2.376855 CCCTCTGTTTTTCCCTCCTCTT 59.623 50.0 0.0 0.0 0.0 2.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2335 2541 1.004745 TCACCTTGGCAGGAATCTTCC 59.995 52.381 9.53 0.42 44.19 3.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
545 567 2.376855 CCCTCTGTTTTTCCCTCCTCTT 59.623 50.000 0.00 0.00 0.00 2.85
863 897 4.344865 AATTGCCCGCACCGTCCT 62.345 61.111 0.00 0.00 0.00 3.85
1333 1382 5.475273 TGCGCTTGAAGATTAGAAAGATG 57.525 39.130 9.73 0.00 0.00 2.90
1536 1628 3.007074 TGGTCTATTCGGTGCTGTGTAAA 59.993 43.478 0.00 0.00 0.00 2.01
1555 1647 2.936919 ATGAAGATGAGCCGGCAATA 57.063 45.000 31.54 14.91 0.00 1.90
1591 1684 5.010820 ACCGATGCTCTCCCTAGTTTATTAC 59.989 44.000 0.00 0.00 0.00 1.89
1651 1751 2.525368 GGGTGGTTTTATGCCTTGTCT 58.475 47.619 0.00 0.00 0.00 3.41
2089 2289 2.488153 GTGTATCTGACAAGGGGTTTGC 59.512 50.000 0.00 0.00 40.66 3.68
2284 2490 2.676029 TATGCGGTGCGTTGTGCTG 61.676 57.895 0.00 0.00 46.63 4.41
2376 2582 7.124901 AGGTGATGTGGTATGCTCCTATAATAG 59.875 40.741 0.00 0.00 0.00 1.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
863 897 3.484806 AAGGTGGTGCCGGTGACA 61.485 61.111 1.90 0.00 43.70 3.58
1333 1382 6.312426 CCTCACTATCGATGGCATATTTTCTC 59.688 42.308 8.54 0.00 0.00 2.87
1536 1628 2.369860 TCTATTGCCGGCTCATCTTCAT 59.630 45.455 29.70 8.81 0.00 2.57
1555 1647 1.957177 AGCATCGGTCATCGTACATCT 59.043 47.619 0.00 0.00 40.32 2.90
1591 1684 1.298863 GCAAGCATATGCACGCCAG 60.299 57.895 28.62 12.39 45.70 4.85
1684 1784 4.753107 GGACGTGAATGGTTCTTGACTTAA 59.247 41.667 0.00 0.00 0.00 1.85
2089 2289 9.897744 TCTTCTTTAACATTATCAGCAACTTTG 57.102 29.630 0.00 0.00 0.00 2.77
2284 2490 1.132588 GTCATCGCGGCTGATCTTAC 58.867 55.000 6.13 0.00 0.00 2.34
2335 2541 1.004745 TCACCTTGGCAGGAATCTTCC 59.995 52.381 9.53 0.42 44.19 3.46
2376 2582 4.125703 TGGAACAAACATTTCAACCATGC 58.874 39.130 0.00 0.00 31.92 4.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.