Multiple sequence alignment - TraesCS7B01G379700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G379700 chr7B 100.000 3617 0 0 1 3617 644449359 644445743 0 6680
1 TraesCS7B01G379700 chr7B 98.037 3617 68 3 1 3617 54066084 54062471 0 6283
2 TraesCS7B01G379700 chrUn 99.171 3617 27 2 1 3617 170992086 170995699 0 6510
3 TraesCS7B01G379700 chr6B 98.866 3617 38 2 1 3617 307011592 307015205 0 6449
4 TraesCS7B01G379700 chr1B 98.397 3618 54 3 1 3617 672525037 672528651 0 6357
5 TraesCS7B01G379700 chr1A 98.286 3617 58 2 1 3617 94680149 94676537 0 6333
6 TraesCS7B01G379700 chr4B 98.258 3617 57 5 1 3617 623331146 623334756 0 6325
7 TraesCS7B01G379700 chr7A 97.874 3622 68 4 1 3617 211380554 211376937 0 6253
8 TraesCS7B01G379700 chr2B 97.871 3617 61 7 1 3617 391128441 391132041 0 6239
9 TraesCS7B01G379700 chr3B 97.485 3618 84 6 1 3617 39860899 39864510 0 6170


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G379700 chr7B 644445743 644449359 3616 True 6680 6680 100.000 1 3617 1 chr7B.!!$R2 3616
1 TraesCS7B01G379700 chr7B 54062471 54066084 3613 True 6283 6283 98.037 1 3617 1 chr7B.!!$R1 3616
2 TraesCS7B01G379700 chrUn 170992086 170995699 3613 False 6510 6510 99.171 1 3617 1 chrUn.!!$F1 3616
3 TraesCS7B01G379700 chr6B 307011592 307015205 3613 False 6449 6449 98.866 1 3617 1 chr6B.!!$F1 3616
4 TraesCS7B01G379700 chr1B 672525037 672528651 3614 False 6357 6357 98.397 1 3617 1 chr1B.!!$F1 3616
5 TraesCS7B01G379700 chr1A 94676537 94680149 3612 True 6333 6333 98.286 1 3617 1 chr1A.!!$R1 3616
6 TraesCS7B01G379700 chr4B 623331146 623334756 3610 False 6325 6325 98.258 1 3617 1 chr4B.!!$F1 3616
7 TraesCS7B01G379700 chr7A 211376937 211380554 3617 True 6253 6253 97.874 1 3617 1 chr7A.!!$R1 3616
8 TraesCS7B01G379700 chr2B 391128441 391132041 3600 False 6239 6239 97.871 1 3617 1 chr2B.!!$F1 3616
9 TraesCS7B01G379700 chr3B 39860899 39864510 3611 False 6170 6170 97.485 1 3617 1 chr3B.!!$F1 3616

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
940 942 4.268939 GCGCTGTGCCAACTTGCA 62.269 61.111 0.00 0.0 39.37 4.08 F
2508 2520 0.749454 ATTCGCAGATTGGCCTGACC 60.749 55.000 3.32 0.0 36.29 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2615 2627 2.219325 GAGGGCTATGCGGATCCTCG 62.219 65.000 10.75 0.0 35.3 4.63 R
3579 3593 8.437575 AGGAGTAATAAGAAGTGAAAAGGACAA 58.562 33.333 0.00 0.0 0.0 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
940 942 4.268939 GCGCTGTGCCAACTTGCA 62.269 61.111 0.00 0.0 39.37 4.08
1645 1651 4.323028 GCTCCATGGATCTCATCGGAAATA 60.323 45.833 16.63 0.0 34.79 1.40
1677 1684 2.034221 GGGCTTCTTTGGCGACCT 59.966 61.111 0.00 0.0 0.00 3.85
1737 1744 1.598130 GGACGCTGCAGTTGTTCCT 60.598 57.895 16.64 0.0 0.00 3.36
1790 1797 2.376518 CCCTGGGGTATCATAGCATGTT 59.623 50.000 4.27 0.0 0.00 2.71
2508 2520 0.749454 ATTCGCAGATTGGCCTGACC 60.749 55.000 3.32 0.0 36.29 4.02
3179 3191 3.423539 ACTTTTGCAGGAGCTATGACA 57.576 42.857 2.62 0.0 42.74 3.58
3279 3291 4.722220 AGGCTATATGATCTTTGCTTGCA 58.278 39.130 0.00 0.0 0.00 4.08
3406 3418 1.808945 GCAAGATATGCGGAAGATGGG 59.191 52.381 0.00 0.0 46.87 4.00
3579 3593 3.555966 CTTTCTGGTTGGGAAGTGTCTT 58.444 45.455 0.00 0.0 0.00 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1395 1398 0.877071 CAGACAATGTTCAAGCGGCT 59.123 50.000 0.00 0.0 0.00 5.52
1457 1463 1.880027 ACTACCGAGCAAAGGCAAAAG 59.120 47.619 0.00 0.0 44.61 2.27
1522 1528 2.899976 CACGTGGTGGTCATTATAGCA 58.100 47.619 7.95 0.0 0.00 3.49
1645 1651 2.242882 AGCCCCAAGAAGCATCAAAT 57.757 45.000 0.00 0.0 0.00 2.32
1677 1684 2.487762 GCAATTCATCCGGTGACTTCAA 59.512 45.455 0.00 0.0 36.32 2.69
1737 1744 1.091771 GGTCGAGTCCGTATCACCGA 61.092 60.000 0.00 0.0 37.05 4.69
2508 2520 5.236478 ACACAGAGTCAAAAGTGAATTACGG 59.764 40.000 10.64 0.0 34.87 4.02
2615 2627 2.219325 GAGGGCTATGCGGATCCTCG 62.219 65.000 10.75 0.0 35.30 4.63
3579 3593 8.437575 AGGAGTAATAAGAAGTGAAAAGGACAA 58.562 33.333 0.00 0.0 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.