Multiple sequence alignment - TraesCS7B01G378500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G378500 chr7B 100.000 2658 0 0 1 2658 643016462 643013805 0.000000e+00 4909.0
1 TraesCS7B01G378500 chr7B 97.788 2667 35 3 1 2658 643003504 643000853 0.000000e+00 4577.0
2 TraesCS7B01G378500 chr7B 97.338 2667 34 2 1 2658 642975135 642972497 0.000000e+00 4497.0
3 TraesCS7B01G378500 chr7B 97.997 2396 36 4 1 2387 642990207 642987815 0.000000e+00 4148.0
4 TraesCS7B01G378500 chr7B 85.428 899 82 27 950 1810 642831638 642830751 0.000000e+00 889.0
5 TraesCS7B01G378500 chr7B 90.031 652 41 9 764 1394 645265898 645265250 0.000000e+00 822.0
6 TraesCS7B01G378500 chr7B 94.659 337 15 2 232 565 426974430 426974766 1.090000e-143 520.0
7 TraesCS7B01G378500 chr7B 99.262 271 1 1 2388 2658 642987843 642987574 3.080000e-134 488.0
8 TraesCS7B01G378500 chr7B 92.248 258 19 1 2402 2658 719556093 719555836 5.410000e-97 364.0
9 TraesCS7B01G378500 chr7B 90.698 258 18 2 2402 2658 719539283 719539031 3.280000e-89 339.0
10 TraesCS7B01G378500 chr7B 93.213 221 13 2 2439 2658 642970679 642970460 9.180000e-85 324.0
11 TraesCS7B01G378500 chr7B 85.417 288 30 6 2091 2375 719539554 719539276 3.350000e-74 289.0
12 TraesCS7B01G378500 chr7B 92.432 185 9 1 764 948 642831862 642831683 2.620000e-65 259.0
13 TraesCS7B01G378500 chr7B 97.902 143 3 0 90 232 426974760 426974618 5.680000e-62 248.0
14 TraesCS7B01G378500 chr7B 84.324 185 20 1 1918 2093 719556517 719556333 3.520000e-39 172.0
15 TraesCS7B01G378500 chr7B 96.429 56 2 0 14 69 645265984 645265929 2.820000e-15 93.5
16 TraesCS7B01G378500 chr7B 85.897 78 7 4 14 89 642831935 642831860 2.190000e-11 80.5
17 TraesCS7B01G378500 chr7A 85.479 1033 71 25 764 1726 670865274 670864251 0.000000e+00 1003.0
18 TraesCS7B01G378500 chr7A 82.953 745 67 28 764 1477 671200596 671201311 3.760000e-173 617.0
19 TraesCS7B01G378500 chr7A 89.474 133 14 0 1961 2093 30505240 30505372 4.550000e-38 169.0
20 TraesCS7B01G378500 chr7D 87.057 819 62 15 950 1741 578810790 578809989 0.000000e+00 885.0
21 TraesCS7B01G378500 chr7D 85.022 908 70 25 766 1614 578912782 578911882 0.000000e+00 863.0
22 TraesCS7B01G378500 chr7D 91.667 180 9 2 766 944 578811007 578810833 7.350000e-61 244.0
23 TraesCS7B01G378500 chr7D 88.148 135 16 0 1959 2093 50168601 50168735 7.610000e-36 161.0
24 TraesCS7B01G378500 chr7D 85.135 74 6 4 20 89 579361978 579362050 1.320000e-08 71.3
25 TraesCS7B01G378500 chr2A 85.973 663 72 11 124 765 779808686 779808024 0.000000e+00 689.0
26 TraesCS7B01G378500 chr3A 95.495 333 13 1 232 562 468166197 468165865 5.040000e-147 531.0
27 TraesCS7B01G378500 chr2B 95.468 331 13 1 232 560 223728495 223728825 6.520000e-146 527.0
28 TraesCS7B01G378500 chr2B 86.275 306 32 2 2092 2396 786869585 786869881 9.180000e-85 324.0
29 TraesCS7B01G378500 chr2B 82.105 190 25 2 2154 2343 449227266 449227086 1.270000e-33 154.0
30 TraesCS7B01G378500 chr3B 94.910 334 15 1 232 563 678449827 678450160 3.030000e-144 521.0
31 TraesCS7B01G378500 chr3B 94.712 208 10 1 559 765 260864915 260865122 3.300000e-84 322.0
32 TraesCS7B01G378500 chr3B 94.410 161 5 4 74 232 335835243 335835085 7.350000e-61 244.0
33 TraesCS7B01G378500 chr3B 83.030 165 24 3 1959 2122 752975374 752975213 2.130000e-31 147.0
34 TraesCS7B01G378500 chr1B 95.427 328 12 2 232 556 563062545 563062872 1.090000e-143 520.0
35 TraesCS7B01G378500 chr1B 92.941 255 18 0 2402 2656 133046948 133047202 3.230000e-99 372.0
36 TraesCS7B01G378500 chr1B 91.506 259 21 1 2401 2658 596309395 596309653 3.250000e-94 355.0
37 TraesCS7B01G378500 chr1B 87.805 287 25 4 2092 2377 133046678 133046955 7.090000e-86 327.0
38 TraesCS7B01G378500 chr1B 94.686 207 10 1 559 764 37625789 37625995 1.190000e-83 320.0
39 TraesCS7B01G378500 chr1B 86.760 287 28 4 2092 2377 40602718 40602995 7.140000e-81 311.0
40 TraesCS7B01G378500 chr1B 98.601 143 2 0 90 232 563062875 563062733 1.220000e-63 254.0
41 TraesCS7B01G378500 chr1B 84.865 185 19 3 1918 2093 403135958 403136142 7.560000e-41 178.0
42 TraesCS7B01G378500 chrUn 88.889 288 30 2 2092 2377 307283515 307283228 1.170000e-93 353.0
43 TraesCS7B01G378500 chrUn 88.889 288 30 2 2092 2377 374202173 374202460 1.170000e-93 353.0
44 TraesCS7B01G378500 chr4B 89.883 257 23 1 2402 2658 604041285 604041032 7.090000e-86 327.0
45 TraesCS7B01G378500 chr4B 95.169 207 9 1 559 764 663723260 663723466 2.550000e-85 326.0
46 TraesCS7B01G378500 chr4B 97.315 149 3 1 84 232 590368535 590368682 4.390000e-63 252.0
47 TraesCS7B01G378500 chr4B 96.000 150 6 0 83 232 13950946 13950797 7.350000e-61 244.0
48 TraesCS7B01G378500 chr4A 95.192 208 9 1 559 765 691286455 691286248 7.090000e-86 327.0
49 TraesCS7B01G378500 chr4A 97.902 143 3 0 90 232 691286594 691286452 5.680000e-62 248.0
50 TraesCS7B01G378500 chr5D 92.825 223 13 3 559 779 421210728 421210507 1.190000e-83 320.0
51 TraesCS7B01G378500 chr5D 88.889 135 15 0 1959 2093 379940088 379939954 1.640000e-37 167.0
52 TraesCS7B01G378500 chr2D 84.965 286 32 4 2092 2375 82551732 82552008 2.010000e-71 279.0
53 TraesCS7B01G378500 chr5B 85.455 275 30 5 2092 2365 34891648 34891383 7.250000e-71 278.0
54 TraesCS7B01G378500 chr5B 80.978 184 26 3 1919 2093 28411619 28411802 1.280000e-28 137.0
55 TraesCS7B01G378500 chr6B 81.395 215 30 6 2153 2363 471693014 471692806 1.640000e-37 167.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G378500 chr7B 643013805 643016462 2657 True 4909.00 4909 100.0000 1 2658 1 chr7B.!!$R3 2657
1 TraesCS7B01G378500 chr7B 643000853 643003504 2651 True 4577.00 4577 97.7880 1 2658 1 chr7B.!!$R2 2657
2 TraesCS7B01G378500 chr7B 642970460 642975135 4675 True 2410.50 4497 95.2755 1 2658 2 chr7B.!!$R5 2657
3 TraesCS7B01G378500 chr7B 642987574 642990207 2633 True 2318.00 4148 98.6295 1 2658 2 chr7B.!!$R6 2657
4 TraesCS7B01G378500 chr7B 645265250 645265984 734 True 457.75 822 93.2300 14 1394 2 chr7B.!!$R7 1380
5 TraesCS7B01G378500 chr7B 642830751 642831935 1184 True 409.50 889 87.9190 14 1810 3 chr7B.!!$R4 1796
6 TraesCS7B01G378500 chr7B 719539031 719539554 523 True 314.00 339 88.0575 2091 2658 2 chr7B.!!$R8 567
7 TraesCS7B01G378500 chr7B 719555836 719556517 681 True 268.00 364 88.2860 1918 2658 2 chr7B.!!$R9 740
8 TraesCS7B01G378500 chr7A 670864251 670865274 1023 True 1003.00 1003 85.4790 764 1726 1 chr7A.!!$R1 962
9 TraesCS7B01G378500 chr7A 671200596 671201311 715 False 617.00 617 82.9530 764 1477 1 chr7A.!!$F2 713
10 TraesCS7B01G378500 chr7D 578911882 578912782 900 True 863.00 863 85.0220 766 1614 1 chr7D.!!$R1 848
11 TraesCS7B01G378500 chr7D 578809989 578811007 1018 True 564.50 885 89.3620 766 1741 2 chr7D.!!$R2 975
12 TraesCS7B01G378500 chr2A 779808024 779808686 662 True 689.00 689 85.9730 124 765 1 chr2A.!!$R1 641
13 TraesCS7B01G378500 chr1B 133046678 133047202 524 False 349.50 372 90.3730 2092 2656 2 chr1B.!!$F6 564

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
979 1083 1.550327 CTGCTCCACTCCACTCACTA 58.45 55.0 0.0 0.0 0.0 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1845 2029 4.441079 GGCCTAACGTCTCAGCAAGTATTA 60.441 45.833 0.0 0.0 0.0 0.98 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
356 387 4.965283 TTATCCTCCAAACCCTCCAATT 57.035 40.909 0.00 0.0 0.00 2.32
428 462 9.628500 GATTAATCCACATTTTAGTAGGGTTCT 57.372 33.333 3.92 0.0 0.00 3.01
597 631 5.654650 GTCCTCTCTCTCCTCATTTAACTCA 59.345 44.000 0.00 0.0 0.00 3.41
979 1083 1.550327 CTGCTCCACTCCACTCACTA 58.450 55.000 0.00 0.0 0.00 2.74
1696 1880 7.537596 TTCTTGAATTTCTTGGCCTCATTTA 57.462 32.000 3.32 0.0 0.00 1.40
1845 2029 4.544683 GGAGTGGTTGGAGGTACTAGTAT 58.455 47.826 5.75 0.0 41.55 2.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
356 387 2.442212 TTAACACATGCGAGTTCGGA 57.558 45.000 3.50 0.28 45.29 4.55
597 631 7.365741 CAGAACTTGCATGTGTTAAAAGAGAT 58.634 34.615 5.94 0.00 0.00 2.75
979 1083 1.153745 GTTGTCGAGCTGATCCGCT 60.154 57.895 11.83 11.83 44.33 5.52
1845 2029 4.441079 GGCCTAACGTCTCAGCAAGTATTA 60.441 45.833 0.00 0.00 0.00 0.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.