Multiple sequence alignment - TraesCS7B01G360700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G360700 chr7B 100.000 2620 0 0 1 2620 622688765 622686146 0.000000e+00 4839.0
1 TraesCS7B01G360700 chr7B 99.812 1595 3 0 1026 2620 622674980 622673386 0.000000e+00 2929.0
2 TraesCS7B01G360700 chr7B 95.414 1243 55 2 138 1380 622788861 622787621 0.000000e+00 1978.0
3 TraesCS7B01G360700 chr7B 99.465 935 4 1 1 934 622675929 622674995 0.000000e+00 1698.0
4 TraesCS7B01G360700 chr7B 90.577 711 39 16 1375 2063 622765465 622764761 0.000000e+00 917.0
5 TraesCS7B01G360700 chr7B 87.079 178 12 7 2305 2474 622764172 622763998 9.570000e-45 191.0
6 TraesCS7B01G360700 chr7B 85.256 156 22 1 1263 1417 623270640 623270485 2.700000e-35 159.0
7 TraesCS7B01G360700 chr7B 84.828 145 21 1 1272 1415 623522609 623522465 7.560000e-31 145.0
8 TraesCS7B01G360700 chr7B 84.354 147 22 1 1272 1417 623372736 623372590 2.720000e-30 143.0
9 TraesCS7B01G360700 chrUn 99.572 935 3 1 1 934 381285021 381284087 0.000000e+00 1703.0
10 TraesCS7B01G360700 chr7D 92.512 1202 52 19 858 2030 568032082 568030890 0.000000e+00 1687.0
11 TraesCS7B01G360700 chr7D 95.278 360 16 1 610 969 568032434 568032076 1.050000e-158 569.0
12 TraesCS7B01G360700 chr7D 88.158 380 27 10 121 495 568033452 568033086 1.110000e-118 436.0
13 TraesCS7B01G360700 chr7D 74.429 438 87 18 997 1417 568235818 568235389 5.800000e-37 165.0
14 TraesCS7B01G360700 chr7D 82.857 105 1 5 491 578 568032800 568032696 7.770000e-11 78.7
15 TraesCS7B01G360700 chr7A 92.871 1066 52 13 1016 2063 655406161 655405102 0.000000e+00 1526.0
16 TraesCS7B01G360700 chr7A 93.385 1028 59 8 858 1878 655419554 655418529 0.000000e+00 1513.0
17 TraesCS7B01G360700 chr7A 93.979 382 22 1 588 969 655411167 655410787 6.290000e-161 577.0
18 TraesCS7B01G360700 chr7A 88.957 326 19 9 491 799 655442482 655442157 1.140000e-103 387.0
19 TraesCS7B01G360700 chr7A 97.093 172 4 1 798 969 655419824 655419654 3.300000e-74 289.0
20 TraesCS7B01G360700 chr7A 95.062 162 7 1 858 1018 655410687 655410526 1.200000e-63 254.0
21 TraesCS7B01G360700 chr7A 90.104 192 10 4 305 495 655412212 655412029 9.370000e-60 241.0
22 TraesCS7B01G360700 chr7A 86.500 200 13 7 1877 2063 655412922 655412724 9.500000e-50 207.0
23 TraesCS7B01G360700 chr7A 82.857 105 1 6 491 578 655411744 655411640 7.770000e-11 78.7
24 TraesCS7B01G360700 chr1B 78.657 417 65 12 2160 2562 632156025 632156431 3.350000e-64 255.0
25 TraesCS7B01G360700 chr6D 92.742 124 9 0 1 124 53767605 53767728 2.070000e-41 180.0
26 TraesCS7B01G360700 chr5A 92.742 124 9 0 1 124 114684454 114684577 2.070000e-41 180.0
27 TraesCS7B01G360700 chr1D 91.935 124 10 0 1 124 300030581 300030458 9.640000e-40 174.0
28 TraesCS7B01G360700 chr1D 91.935 124 10 0 1 124 491606321 491606444 9.640000e-40 174.0
29 TraesCS7B01G360700 chr1A 91.935 124 10 0 1 124 532737880 532738003 9.640000e-40 174.0
30 TraesCS7B01G360700 chr5D 91.803 122 10 0 1 122 438948199 438948320 1.250000e-38 171.0
31 TraesCS7B01G360700 chr5D 91.129 124 11 0 1 124 76036436 76036559 4.480000e-38 169.0
32 TraesCS7B01G360700 chr5B 100.000 30 0 0 638 667 493088570 493088541 3.640000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G360700 chr7B 622686146 622688765 2619 True 4839.000 4839 100.00000 1 2620 1 chr7B.!!$R1 2619
1 TraesCS7B01G360700 chr7B 622673386 622675929 2543 True 2313.500 2929 99.63850 1 2620 2 chr7B.!!$R6 2619
2 TraesCS7B01G360700 chr7B 622787621 622788861 1240 True 1978.000 1978 95.41400 138 1380 1 chr7B.!!$R2 1242
3 TraesCS7B01G360700 chr7B 622763998 622765465 1467 True 554.000 917 88.82800 1375 2474 2 chr7B.!!$R7 1099
4 TraesCS7B01G360700 chrUn 381284087 381285021 934 True 1703.000 1703 99.57200 1 934 1 chrUn.!!$R1 933
5 TraesCS7B01G360700 chr7D 568030890 568033452 2562 True 692.675 1687 89.70125 121 2030 4 chr7D.!!$R2 1909
6 TraesCS7B01G360700 chr7A 655405102 655406161 1059 True 1526.000 1526 92.87100 1016 2063 1 chr7A.!!$R1 1047
7 TraesCS7B01G360700 chr7A 655418529 655419824 1295 True 901.000 1513 95.23900 798 1878 2 chr7A.!!$R4 1080
8 TraesCS7B01G360700 chr7A 655410526 655412922 2396 True 271.540 577 89.70040 305 2063 5 chr7A.!!$R3 1758

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
88 89 1.266989 CCAAGCTTCTCAACGGTTTCC 59.733 52.381 0.0 0.0 0.0 3.13 F
993 2709 3.054878 GACCAAAGAGCGAACGAGTTTA 58.945 45.455 0.0 0.0 0.0 2.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1020 2737 8.774890 ATGTGTTTTATGCAATAATTCAGCAA 57.225 26.923 0.0 0.0 38.83 3.91 R
2521 4687 2.317609 CGGCACACACTCTTTCCCG 61.318 63.158 0.0 0.0 0.00 5.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
88 89 1.266989 CCAAGCTTCTCAACGGTTTCC 59.733 52.381 0.00 0.00 0.00 3.13
98 99 4.021192 TCTCAACGGTTTCCCTATAACGTT 60.021 41.667 5.88 5.88 0.00 3.99
993 2709 3.054878 GACCAAAGAGCGAACGAGTTTA 58.945 45.455 0.00 0.00 0.00 2.01
1020 2737 9.793259 CAACCAATATATATAGAACCCAAGTGT 57.207 33.333 0.00 0.00 0.00 3.55
2359 4521 3.445096 CCATGTTGGAGGAAGAACCATTC 59.555 47.826 0.00 0.00 40.96 2.67
2521 4687 5.183140 ACTCAAATTGCCATACAGGTTACAC 59.817 40.000 0.00 0.00 40.61 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
88 89 9.712305 ATATTCAATTCAGGAGAACGTTATAGG 57.288 33.333 0.00 0.0 36.39 2.57
956 2672 9.860898 GCTCTTTGGTCATTTAATTAACTGAAT 57.139 29.630 17.04 0.0 28.64 2.57
993 2709 9.793259 CACTTGGGTTCTATATATATTGGTTGT 57.207 33.333 0.00 0.0 0.00 3.32
1020 2737 8.774890 ATGTGTTTTATGCAATAATTCAGCAA 57.225 26.923 0.00 0.0 38.83 3.91
2521 4687 2.317609 CGGCACACACTCTTTCCCG 61.318 63.158 0.00 0.0 0.00 5.14


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.