Multiple sequence alignment - TraesCS7B01G354700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G354700 chr7B 100.000 2837 0 0 1 2837 613014462 613017298 0 5240
1 TraesCS7B01G354700 chr7B 98.344 2838 45 2 1 2837 368080842 368078006 0 4979
2 TraesCS7B01G354700 chr6A 98.520 2837 38 2 1 2837 531357174 531354342 0 5003
3 TraesCS7B01G354700 chr4B 98.486 2840 40 2 1 2837 123877751 123874912 0 5003
4 TraesCS7B01G354700 chr5A 98.521 2839 32 6 1 2837 21853806 21856636 0 5001
5 TraesCS7B01G354700 chr5A 97.865 2857 40 13 1 2837 21862121 21864976 0 4918
6 TraesCS7B01G354700 chr5A 97.953 977 18 2 1862 2837 21848827 21847852 0 1692
7 TraesCS7B01G354700 chr4A 98.379 2838 38 6 1 2837 59258887 59256057 0 4979
8 TraesCS7B01G354700 chr2B 98.273 2838 40 6 1 2837 791884166 791881337 0 4961
9 TraesCS7B01G354700 chr2B 98.203 2838 42 7 1 2837 791877748 791874919 0 4950
10 TraesCS7B01G354700 chr2B 98.064 2841 49 6 1 2837 791908651 791911489 0 4937


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G354700 chr7B 613014462 613017298 2836 False 5240.0 5240 100.000 1 2837 1 chr7B.!!$F1 2836
1 TraesCS7B01G354700 chr7B 368078006 368080842 2836 True 4979.0 4979 98.344 1 2837 1 chr7B.!!$R1 2836
2 TraesCS7B01G354700 chr6A 531354342 531357174 2832 True 5003.0 5003 98.520 1 2837 1 chr6A.!!$R1 2836
3 TraesCS7B01G354700 chr4B 123874912 123877751 2839 True 5003.0 5003 98.486 1 2837 1 chr4B.!!$R1 2836
4 TraesCS7B01G354700 chr5A 21853806 21856636 2830 False 5001.0 5001 98.521 1 2837 1 chr5A.!!$F1 2836
5 TraesCS7B01G354700 chr5A 21862121 21864976 2855 False 4918.0 4918 97.865 1 2837 1 chr5A.!!$F2 2836
6 TraesCS7B01G354700 chr5A 21847852 21848827 975 True 1692.0 1692 97.953 1862 2837 1 chr5A.!!$R1 975
7 TraesCS7B01G354700 chr4A 59256057 59258887 2830 True 4979.0 4979 98.379 1 2837 1 chr4A.!!$R1 2836
8 TraesCS7B01G354700 chr2B 791874919 791884166 9247 True 4955.5 4961 98.238 1 2837 2 chr2B.!!$R1 2836
9 TraesCS7B01G354700 chr2B 791908651 791911489 2838 False 4937.0 4937 98.064 1 2837 1 chr2B.!!$F1 2836

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
21 22 3.588955 GGCAAGTAAAAATGGCTGAAGG 58.411 45.455 0.0 0.0 38.91 3.46 F
1441 7862 5.005628 ACTTTGGGCAAGGAAGGTATTAA 57.994 39.130 0.0 0.0 36.72 1.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1520 7941 0.258774 GCTTGATGCCTCCCCCTTTA 59.741 55.0 0.00 0.00 35.15 1.85 R
2314 8771 2.880890 CCTACTAGGGTATACGCGTGTT 59.119 50.0 24.59 12.08 0.00 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
21 22 3.588955 GGCAAGTAAAAATGGCTGAAGG 58.411 45.455 0.00 0.00 38.91 3.46
434 435 7.822822 AGTTCTTAGGAATTGTAAACTATGCGT 59.177 33.333 0.00 0.00 33.71 5.24
682 683 6.261826 CCAATAAATACTCTCCAAAGGCAGAG 59.738 42.308 9.49 9.49 41.81 3.35
1098 1099 6.534793 AGCCAAATACATTCAATTTTAAGCCG 59.465 34.615 0.00 0.00 0.00 5.52
1106 1107 5.993748 TTCAATTTTAAGCCGAAATCCCT 57.006 34.783 0.00 0.00 0.00 4.20
1158 1159 7.125507 TGCATATTGGATAACTTTTGGTTCCAT 59.874 33.333 0.00 0.00 39.17 3.41
1441 7862 5.005628 ACTTTGGGCAAGGAAGGTATTAA 57.994 39.130 0.00 0.00 36.72 1.40
1520 7941 0.038744 CCTGCTTCACCAACTCCCAT 59.961 55.000 0.00 0.00 0.00 4.00
2291 8748 1.040646 AACTTGTCGGCACTCTCTCA 58.959 50.000 0.00 0.00 0.00 3.27
2354 8811 0.948623 GACACGTGTGCATGCTACCA 60.949 55.000 28.82 10.10 0.00 3.25
2797 9255 2.655090 TGAATGAGAACCTTGTGGCA 57.345 45.000 0.00 0.00 36.63 4.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
21 22 6.939163 AGTAAATGCTGTCCATGGAATAGATC 59.061 38.462 24.42 10.41 33.49 2.75
1098 1099 7.572168 GCTTCATCGAGCTTAATAAGGGATTTC 60.572 40.741 1.88 0.00 39.57 2.17
1158 1159 6.032956 TGTTCCTCTCTTTTGCGAGTATAA 57.967 37.500 0.00 0.00 32.83 0.98
1314 1317 5.865977 TCTCCCATTCCAAATATATGCCT 57.134 39.130 0.00 0.00 0.00 4.75
1441 7862 9.799106 CTTTGGGTCAATATAATAATCTGGTCT 57.201 33.333 0.00 0.00 0.00 3.85
1520 7941 0.258774 GCTTGATGCCTCCCCCTTTA 59.741 55.000 0.00 0.00 35.15 1.85
1827 8248 5.249780 TGTAGTTTGGGCTTTATTCAGGA 57.750 39.130 0.00 0.00 0.00 3.86
2314 8771 2.880890 CCTACTAGGGTATACGCGTGTT 59.119 50.000 24.59 12.08 0.00 3.32
2354 8811 5.656859 GCCTTCCTTCACTTATTTTACCCAT 59.343 40.000 0.00 0.00 0.00 4.00
2705 9162 4.820775 AGGATCCCTAGCATAAGAACTCA 58.179 43.478 8.55 0.00 28.47 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.