Multiple sequence alignment - TraesCS7B01G344000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G344000 chr7B 100.000 2678 0 0 1 2678 600350144 600352821 0.000000e+00 4946.0
1 TraesCS7B01G344000 chr7B 98.517 2091 21 2 588 2678 600389061 600391141 0.000000e+00 3681.0
2 TraesCS7B01G344000 chr7B 92.787 1317 67 12 588 1902 600363715 600365005 0.000000e+00 1881.0
3 TraesCS7B01G344000 chr7B 92.711 1317 68 12 588 1902 600311088 600312378 0.000000e+00 1875.0
4 TraesCS7B01G344000 chr7B 95.962 743 16 7 3 732 600387625 600388366 0.000000e+00 1194.0
5 TraesCS7B01G344000 chr7B 95.340 751 25 3 994 1737 600093620 600094367 0.000000e+00 1184.0
6 TraesCS7B01G344000 chr7B 94.333 600 33 1 2076 2675 600094875 600095473 0.000000e+00 918.0
7 TraesCS7B01G344000 chr7B 94.097 559 18 7 42 587 616759002 616758446 0.000000e+00 835.0
8 TraesCS7B01G344000 chr7B 96.855 318 10 0 1767 2084 600094365 600094682 1.410000e-147 532.0
9 TraesCS7B01G344000 chr7B 88.182 330 31 6 668 996 600093209 600093531 1.160000e-103 387.0
10 TraesCS7B01G344000 chr7D 90.652 1380 87 17 613 1963 554531079 554529713 0.000000e+00 1796.0
11 TraesCS7B01G344000 chr7D 91.141 982 79 7 1339 2316 554486279 554485302 0.000000e+00 1325.0
12 TraesCS7B01G344000 chr7D 91.068 918 53 17 994 1902 554474678 554473781 0.000000e+00 1214.0
13 TraesCS7B01G344000 chr7D 92.837 363 22 2 2314 2676 554484184 554483826 8.490000e-145 523.0
14 TraesCS7B01G344000 chr7D 93.503 354 14 3 613 963 554475487 554475140 3.950000e-143 518.0
15 TraesCS7B01G344000 chr7D 95.000 60 1 2 729 788 554500898 554500841 2.840000e-15 93.5
16 TraesCS7B01G344000 chr7A 89.872 938 67 16 588 1524 639598589 639599499 0.000000e+00 1181.0
17 TraesCS7B01G344000 chr7A 92.877 730 37 8 798 1524 639579098 639579815 0.000000e+00 1046.0
18 TraesCS7B01G344000 chr7A 93.002 443 29 2 996 1438 639654761 639655201 0.000000e+00 645.0
19 TraesCS7B01G344000 chr7A 90.118 425 30 8 1445 1860 639599486 639599907 2.350000e-150 542.0
20 TraesCS7B01G344000 chr7A 87.119 427 44 7 1449 1875 639659228 639659643 8.680000e-130 473.0
21 TraesCS7B01G344000 chr7A 94.182 275 11 3 668 940 639654383 639654654 5.330000e-112 414.0
22 TraesCS7B01G344000 chr7A 96.053 76 1 1 588 663 639648566 639648639 3.620000e-24 122.0
23 TraesCS7B01G344000 chr7A 96.053 76 1 1 588 663 639650889 639650962 3.620000e-24 122.0
24 TraesCS7B01G344000 chr2B 93.489 599 22 6 5 587 135572857 135573454 0.000000e+00 874.0
25 TraesCS7B01G344000 chr2B 88.506 609 40 12 4 588 18738978 18738376 0.000000e+00 710.0
26 TraesCS7B01G344000 chr2B 86.971 614 36 10 1 591 100927707 100927115 0.000000e+00 651.0
27 TraesCS7B01G344000 chr5B 92.517 588 38 3 1 587 708685838 708685256 0.000000e+00 837.0
28 TraesCS7B01G344000 chr5B 88.522 575 33 6 4 550 547580052 547580621 0.000000e+00 665.0
29 TraesCS7B01G344000 chr3B 92.845 587 27 5 3 588 672608153 672608725 0.000000e+00 837.0
30 TraesCS7B01G344000 chr3B 91.792 597 31 5 5 587 50652649 50653241 0.000000e+00 815.0
31 TraesCS7B01G344000 chr3B 90.135 223 5 6 1 208 188050712 188050932 9.450000e-70 274.0
32 TraesCS7B01G344000 chr4A 91.000 600 34 7 4 588 738576568 738577162 0.000000e+00 791.0
33 TraesCS7B01G344000 chr4A 90.894 593 41 6 4 588 723024651 723024064 0.000000e+00 784.0
34 TraesCS7B01G344000 chr4A 89.803 608 43 7 1 594 693399953 693399351 0.000000e+00 761.0
35 TraesCS7B01G344000 chr4A 91.413 559 31 7 4 550 738575708 738575155 0.000000e+00 750.0
36 TraesCS7B01G344000 chr4B 90.849 601 36 8 4 587 27288911 27288313 0.000000e+00 787.0
37 TraesCS7B01G344000 chr6B 92.958 497 22 5 103 587 31717894 31717399 0.000000e+00 712.0
38 TraesCS7B01G344000 chr6B 94.444 54 3 0 2621 2674 12342428 12342375 1.710000e-12 84.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G344000 chr7B 600350144 600352821 2677 False 4946.00 4946 100.0000 1 2678 1 chr7B.!!$F2 2677
1 TraesCS7B01G344000 chr7B 600387625 600391141 3516 False 2437.50 3681 97.2395 3 2678 2 chr7B.!!$F5 2675
2 TraesCS7B01G344000 chr7B 600363715 600365005 1290 False 1881.00 1881 92.7870 588 1902 1 chr7B.!!$F3 1314
3 TraesCS7B01G344000 chr7B 600311088 600312378 1290 False 1875.00 1875 92.7110 588 1902 1 chr7B.!!$F1 1314
4 TraesCS7B01G344000 chr7B 616758446 616759002 556 True 835.00 835 94.0970 42 587 1 chr7B.!!$R1 545
5 TraesCS7B01G344000 chr7B 600093209 600095473 2264 False 755.25 1184 93.6775 668 2675 4 chr7B.!!$F4 2007
6 TraesCS7B01G344000 chr7D 554529713 554531079 1366 True 1796.00 1796 90.6520 613 1963 1 chr7D.!!$R2 1350
7 TraesCS7B01G344000 chr7D 554483826 554486279 2453 True 924.00 1325 91.9890 1339 2676 2 chr7D.!!$R4 1337
8 TraesCS7B01G344000 chr7D 554473781 554475487 1706 True 866.00 1214 92.2855 613 1902 2 chr7D.!!$R3 1289
9 TraesCS7B01G344000 chr7A 639579098 639579815 717 False 1046.00 1046 92.8770 798 1524 1 chr7A.!!$F1 726
10 TraesCS7B01G344000 chr7A 639598589 639599907 1318 False 861.50 1181 89.9950 588 1860 2 chr7A.!!$F3 1272
11 TraesCS7B01G344000 chr7A 639648566 639655201 6635 False 325.75 645 94.8225 588 1438 4 chr7A.!!$F4 850
12 TraesCS7B01G344000 chr2B 135572857 135573454 597 False 874.00 874 93.4890 5 587 1 chr2B.!!$F1 582
13 TraesCS7B01G344000 chr2B 18738376 18738978 602 True 710.00 710 88.5060 4 588 1 chr2B.!!$R1 584
14 TraesCS7B01G344000 chr2B 100927115 100927707 592 True 651.00 651 86.9710 1 591 1 chr2B.!!$R2 590
15 TraesCS7B01G344000 chr5B 708685256 708685838 582 True 837.00 837 92.5170 1 587 1 chr5B.!!$R1 586
16 TraesCS7B01G344000 chr5B 547580052 547580621 569 False 665.00 665 88.5220 4 550 1 chr5B.!!$F1 546
17 TraesCS7B01G344000 chr3B 672608153 672608725 572 False 837.00 837 92.8450 3 588 1 chr3B.!!$F3 585
18 TraesCS7B01G344000 chr3B 50652649 50653241 592 False 815.00 815 91.7920 5 587 1 chr3B.!!$F1 582
19 TraesCS7B01G344000 chr4A 738576568 738577162 594 False 791.00 791 91.0000 4 588 1 chr4A.!!$F1 584
20 TraesCS7B01G344000 chr4A 723024064 723024651 587 True 784.00 784 90.8940 4 588 1 chr4A.!!$R2 584
21 TraesCS7B01G344000 chr4A 693399351 693399953 602 True 761.00 761 89.8030 1 594 1 chr4A.!!$R1 593
22 TraesCS7B01G344000 chr4A 738575155 738575708 553 True 750.00 750 91.4130 4 550 1 chr4A.!!$R3 546
23 TraesCS7B01G344000 chr4B 27288313 27288911 598 True 787.00 787 90.8490 4 587 1 chr4B.!!$R1 583

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
663 740 1.544691 ACGCCGGTCAGATGGATATAC 59.455 52.381 1.9 0.0 0.0 1.47 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2157 9281 1.006832 CTCCCCGTTGATACAAAGCG 58.993 55.0 0.0 0.0 0.0 4.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
57 58 6.353602 GGGAAGTGGATAAGGGAACTATGAAA 60.354 42.308 0.0 0.0 42.68 2.69
415 492 3.826637 GCTGTAGGCGTAACTTGGA 57.173 52.632 0.0 0.0 0.00 3.53
420 497 4.632688 GCTGTAGGCGTAACTTGGAATAAA 59.367 41.667 0.0 0.0 0.00 1.40
663 740 1.544691 ACGCCGGTCAGATGGATATAC 59.455 52.381 1.9 0.0 0.00 1.47
1594 8512 2.256461 GCAACGCCAAGGAGCTTG 59.744 61.111 0.0 0.0 40.75 4.01
1758 8681 2.584791 GTGACGAATCATTGTGTTGGC 58.415 47.619 0.0 0.0 37.14 4.52
2157 9281 2.158885 GCAGGAGGTGTTCTATTCTCCC 60.159 54.545 0.0 0.0 45.04 4.30
2662 10906 5.833131 TCTACCTTTCCAATCACTTTTGCTT 59.167 36.000 0.0 0.0 0.00 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
415 492 2.618053 CAGAAGAGCCGTCGGTTTATT 58.382 47.619 13.94 6.19 0.00 1.40
420 497 4.421479 CGCAGAAGAGCCGTCGGT 62.421 66.667 13.94 0.00 0.00 4.69
663 740 6.744082 GGGAAACGGAAAATAACAAATACTCG 59.256 38.462 0.00 0.00 0.00 4.18
807 7177 0.793861 AGACGATAGAGCGAGCGATC 59.206 55.000 0.00 0.00 41.38 3.69
1170 8006 2.952273 CGTGTCGATATGGACGCAA 58.048 52.632 25.01 2.84 45.40 4.85
1594 8512 6.456501 CCATAGTTATAGCTACAACCTGTCC 58.543 44.000 11.26 0.00 0.00 4.02
1758 8681 5.749109 ACATACGCTTTCCTCTTCGATTAAG 59.251 40.000 0.00 0.00 36.45 1.85
2157 9281 1.006832 CTCCCCGTTGATACAAAGCG 58.993 55.000 0.00 0.00 0.00 4.68
2250 9374 2.281692 AGATGCGCACAACAGCCA 60.282 55.556 14.90 0.00 0.00 4.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.