Multiple sequence alignment - TraesCS7B01G338400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G338400 chr7B 100.000 2873 0 0 1 2873 592806935 592809807 0.000000e+00 5306
1 TraesCS7B01G338400 chr7B 98.539 2875 39 3 1 2873 592866726 592869599 0.000000e+00 5073
2 TraesCS7B01G338400 chr7B 92.566 1789 75 14 782 2548 592718270 592720022 0.000000e+00 2514
3 TraesCS7B01G338400 chr7B 92.479 585 28 7 219 790 592716559 592717140 0.000000e+00 822
4 TraesCS7B01G338400 chr7B 85.414 809 88 18 993 1776 592534855 592534052 0.000000e+00 813
5 TraesCS7B01G338400 chr7B 95.833 432 15 3 2117 2548 592912364 592912792 0.000000e+00 695
6 TraesCS7B01G338400 chr7A 92.055 1737 73 34 693 2393 634476617 634478324 0.000000e+00 2383
7 TraesCS7B01G338400 chr7A 92.119 1675 79 32 428 2076 634463419 634465066 0.000000e+00 2313
8 TraesCS7B01G338400 chr7A 90.777 1312 70 22 745 2029 634605253 634606540 0.000000e+00 1705
9 TraesCS7B01G338400 chr7A 87.500 688 72 12 52 732 634604254 634604934 0.000000e+00 782
10 TraesCS7B01G338400 chr7A 89.817 383 37 2 49 430 634462446 634462827 9.250000e-135 490
11 TraesCS7B01G338400 chr7A 82.384 562 58 18 52 608 634475718 634476243 4.370000e-123 451
12 TraesCS7B01G338400 chr7A 84.756 164 17 7 2389 2548 634478914 634479073 1.070000e-34 158
13 TraesCS7B01G338400 chr7D 90.005 1841 110 29 693 2495 549134480 549136284 0.000000e+00 2313
14 TraesCS7B01G338400 chr7D 93.109 1277 61 11 815 2085 549274160 549275415 0.000000e+00 1845
15 TraesCS7B01G338400 chr7D 84.912 855 95 26 948 1776 548916136 548915290 0.000000e+00 833
16 TraesCS7B01G338400 chr7D 89.392 641 54 11 49 682 549133861 549134494 0.000000e+00 795
17 TraesCS7B01G338400 chr7D 93.417 319 20 1 2547 2864 544371422 544371740 3.350000e-129 472
18 TraesCS7B01G338400 chr7D 85.380 171 19 4 998 1164 614535594 614535762 3.810000e-39 172
19 TraesCS7B01G338400 chr3A 92.790 319 22 1 2547 2864 24682216 24681898 7.250000e-126 460
20 TraesCS7B01G338400 chr5A 91.509 318 26 1 2547 2863 23431699 23432016 1.220000e-118 436
21 TraesCS7B01G338400 chr5A 78.214 280 58 3 2596 2873 635563907 635563629 2.940000e-40 176
22 TraesCS7B01G338400 chr4B 91.223 319 27 1 2547 2864 107849876 107849558 1.580000e-117 433
23 TraesCS7B01G338400 chr6B 90.062 322 27 3 2548 2864 116461244 116461565 2.060000e-111 412
24 TraesCS7B01G338400 chr2A 89.320 206 19 3 2547 2749 740253457 740253252 3.670000e-64 255
25 TraesCS7B01G338400 chrUn 78.481 316 60 7 2547 2857 41471239 41470927 1.750000e-47 200


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G338400 chr7B 592806935 592809807 2872 False 5306.000000 5306 100.000000 1 2873 1 chr7B.!!$F1 2872
1 TraesCS7B01G338400 chr7B 592866726 592869599 2873 False 5073.000000 5073 98.539000 1 2873 1 chr7B.!!$F2 2872
2 TraesCS7B01G338400 chr7B 592716559 592720022 3463 False 1668.000000 2514 92.522500 219 2548 2 chr7B.!!$F4 2329
3 TraesCS7B01G338400 chr7B 592534052 592534855 803 True 813.000000 813 85.414000 993 1776 1 chr7B.!!$R1 783
4 TraesCS7B01G338400 chr7A 634462446 634465066 2620 False 1401.500000 2313 90.968000 49 2076 2 chr7A.!!$F1 2027
5 TraesCS7B01G338400 chr7A 634604254 634606540 2286 False 1243.500000 1705 89.138500 52 2029 2 chr7A.!!$F3 1977
6 TraesCS7B01G338400 chr7A 634475718 634479073 3355 False 997.333333 2383 86.398333 52 2548 3 chr7A.!!$F2 2496
7 TraesCS7B01G338400 chr7D 549274160 549275415 1255 False 1845.000000 1845 93.109000 815 2085 1 chr7D.!!$F2 1270
8 TraesCS7B01G338400 chr7D 549133861 549136284 2423 False 1554.000000 2313 89.698500 49 2495 2 chr7D.!!$F4 2446
9 TraesCS7B01G338400 chr7D 548915290 548916136 846 True 833.000000 833 84.912000 948 1776 1 chr7D.!!$R1 828

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
747 1996 0.037605 CCTACTCCGCAAAACGTCCT 60.038 55.0 0.0 0.0 41.42 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1904 4338 2.768833 TGTATACGTGATCGAGCACC 57.231 50.0 26.63 13.43 40.62 5.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 43 3.869246 CGAACGGTAGCCATGTTTTCTAT 59.131 43.478 0.00 0.0 0.00 1.98
345 348 4.634443 CACTTTAATTAACAGGACCGAGGG 59.366 45.833 0.00 0.0 0.00 4.30
747 1996 0.037605 CCTACTCCGCAAAACGTCCT 60.038 55.000 0.00 0.0 41.42 3.85
1272 3697 4.947147 GTGGCGTGCAAGGACCCA 62.947 66.667 0.79 0.0 0.00 4.51
1533 3961 1.276622 ACCCGGACAACAAGCTCTAT 58.723 50.000 0.73 0.0 0.00 1.98
1904 4338 5.739752 TTTGGAGCAGTATCAATTCGATG 57.260 39.130 0.00 0.0 35.39 3.84
2002 4438 8.945481 TGAACAAATCTTCACATTCATTTTGT 57.055 26.923 0.00 0.0 37.40 2.83
2727 5786 6.201425 GGCCGAACGATTTATATGAAGTACAA 59.799 38.462 0.00 0.0 0.00 2.41
2774 5833 6.327386 AGCCCTCCAATTTCAAGTAAGATA 57.673 37.500 0.00 0.0 0.00 1.98
2823 5882 3.270027 CGAGTATTCCTGATTGCACCAA 58.730 45.455 0.00 0.0 0.00 3.67
2838 5897 1.347707 CACCAACTCCAGGCAGTCTAA 59.652 52.381 0.00 0.0 0.00 2.10
2869 5928 1.344438 ACATGCGTGAGTCCTTGAAGA 59.656 47.619 14.17 0.0 0.00 2.87
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 43 4.496840 CGGTGCGTATGTCACTATCACTAA 60.497 45.833 8.68 0.00 34.97 2.24
123 125 5.084519 TCCTACACAATTGTCAGGTCTACT 58.915 41.667 25.02 0.00 37.15 2.57
345 348 2.672714 GAAATGGGTCGGCAAAGTTTC 58.327 47.619 0.00 0.00 0.00 2.78
466 1073 5.234757 ACTCAGTGTGTTTATTTTTCGCGTA 59.765 36.000 5.77 0.00 0.00 4.42
747 1996 5.529430 TGCAAGTCGAATTTTAGGTTCTCAA 59.471 36.000 0.00 0.00 0.00 3.02
1904 4338 2.768833 TGTATACGTGATCGAGCACC 57.231 50.000 26.63 13.43 40.62 5.01
2699 5758 5.007332 ACTTCATATAAATCGTTCGGCCAAC 59.993 40.000 2.24 5.75 0.00 3.77
2702 5761 5.693104 TGTACTTCATATAAATCGTTCGGCC 59.307 40.000 0.00 0.00 0.00 6.13
2747 5806 4.388577 ACTTGAAATTGGAGGGCTAGTT 57.611 40.909 0.00 0.00 0.00 2.24
2749 5808 5.745227 TCTTACTTGAAATTGGAGGGCTAG 58.255 41.667 0.00 0.00 0.00 3.42
2774 5833 1.347707 TCTCGTTCAATTGTGCCTCCT 59.652 47.619 5.13 0.00 0.00 3.69
2823 5882 1.203187 TGGAGTTAGACTGCCTGGAGT 60.203 52.381 0.00 0.00 35.52 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.