Multiple sequence alignment - TraesCS7B01G331100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G331100 chr7B 100.000 2285 0 0 1 2285 586374684 586372400 0.000000e+00 4220
1 TraesCS7B01G331100 chr7B 98.145 1725 26 3 565 2285 577195154 577193432 0.000000e+00 3003
2 TraesCS7B01G331100 chr7B 86.395 588 64 11 1 578 708540708 708540127 1.490000e-176 628
3 TraesCS7B01G331100 chr3A 98.667 1725 19 2 565 2285 514529503 514531227 0.000000e+00 3055
4 TraesCS7B01G331100 chr3A 98.377 1725 24 2 565 2285 627956385 627954661 0.000000e+00 3027
5 TraesCS7B01G331100 chr3A 86.395 588 64 12 1 578 25517650 25517069 1.490000e-176 628
6 TraesCS7B01G331100 chr6B 98.377 1725 23 3 565 2285 439442409 439440686 0.000000e+00 3025
7 TraesCS7B01G331100 chr5B 98.319 1725 25 2 565 2285 524582420 524580696 0.000000e+00 3022
8 TraesCS7B01G331100 chr6A 98.152 1732 27 3 558 2285 214162559 214160829 0.000000e+00 3016
9 TraesCS7B01G331100 chr6A 98.145 1725 28 2 565 2285 157652795 157654519 0.000000e+00 3005
10 TraesCS7B01G331100 chr6A 87.193 570 59 9 1 560 581575664 581576229 8.900000e-179 636
11 TraesCS7B01G331100 chr7A 98.203 1725 27 2 565 2285 613754712 613752988 0.000000e+00 3011
12 TraesCS7B01G331100 chr7A 99.472 568 3 0 1 568 613758414 613757847 0.000000e+00 1033
13 TraesCS7B01G331100 chr7A 99.472 568 3 0 1 568 628974842 628975409 0.000000e+00 1033
14 TraesCS7B01G331100 chr2B 98.203 1725 27 2 565 2285 708697070 708695346 0.000000e+00 3011
15 TraesCS7B01G331100 chr5A 99.648 568 2 0 1 568 626240614 626241181 0.000000e+00 1038
16 TraesCS7B01G331100 chr1A 99.648 568 2 0 1 568 3650274 3649707 0.000000e+00 1038
17 TraesCS7B01G331100 chr1A 99.472 568 3 0 1 568 64894110 64893543 0.000000e+00 1033
18 TraesCS7B01G331100 chr1A 86.519 586 63 11 1 576 530878995 530878416 4.140000e-177 630
19 TraesCS7B01G331100 chr3B 99.472 568 3 0 1 568 53367600 53368167 0.000000e+00 1033
20 TraesCS7B01G331100 chr2A 99.472 568 3 0 1 568 411120344 411119777 0.000000e+00 1033
21 TraesCS7B01G331100 chr2A 99.472 568 3 0 1 568 470630414 470630981 0.000000e+00 1033
22 TraesCS7B01G331100 chr1B 99.296 568 4 0 1 568 659694455 659695022 0.000000e+00 1027
23 TraesCS7B01G331100 chr4D 87.346 569 59 9 1 560 460572067 460572631 6.880000e-180 640
24 TraesCS7B01G331100 chr1D 86.356 579 65 9 1 569 99783231 99783805 8.970000e-174 619
25 TraesCS7B01G331100 chr7D 86.467 569 65 7 1 560 536599608 536600173 4.170000e-172 614
26 TraesCS7B01G331100 chr4A 85.836 586 67 11 1 576 163943893 163943314 1.940000e-170 608
27 TraesCS7B01G331100 chr2D 87.780 491 52 7 91 578 625515154 625514669 3.290000e-158 568


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G331100 chr7B 586372400 586374684 2284 True 4220 4220 100.0000 1 2285 1 chr7B.!!$R2 2284
1 TraesCS7B01G331100 chr7B 577193432 577195154 1722 True 3003 3003 98.1450 565 2285 1 chr7B.!!$R1 1720
2 TraesCS7B01G331100 chr7B 708540127 708540708 581 True 628 628 86.3950 1 578 1 chr7B.!!$R3 577
3 TraesCS7B01G331100 chr3A 514529503 514531227 1724 False 3055 3055 98.6670 565 2285 1 chr3A.!!$F1 1720
4 TraesCS7B01G331100 chr3A 627954661 627956385 1724 True 3027 3027 98.3770 565 2285 1 chr3A.!!$R2 1720
5 TraesCS7B01G331100 chr3A 25517069 25517650 581 True 628 628 86.3950 1 578 1 chr3A.!!$R1 577
6 TraesCS7B01G331100 chr6B 439440686 439442409 1723 True 3025 3025 98.3770 565 2285 1 chr6B.!!$R1 1720
7 TraesCS7B01G331100 chr5B 524580696 524582420 1724 True 3022 3022 98.3190 565 2285 1 chr5B.!!$R1 1720
8 TraesCS7B01G331100 chr6A 214160829 214162559 1730 True 3016 3016 98.1520 558 2285 1 chr6A.!!$R1 1727
9 TraesCS7B01G331100 chr6A 157652795 157654519 1724 False 3005 3005 98.1450 565 2285 1 chr6A.!!$F1 1720
10 TraesCS7B01G331100 chr6A 581575664 581576229 565 False 636 636 87.1930 1 560 1 chr6A.!!$F2 559
11 TraesCS7B01G331100 chr7A 613752988 613758414 5426 True 2022 3011 98.8375 1 2285 2 chr7A.!!$R1 2284
12 TraesCS7B01G331100 chr7A 628974842 628975409 567 False 1033 1033 99.4720 1 568 1 chr7A.!!$F1 567
13 TraesCS7B01G331100 chr2B 708695346 708697070 1724 True 3011 3011 98.2030 565 2285 1 chr2B.!!$R1 1720
14 TraesCS7B01G331100 chr5A 626240614 626241181 567 False 1038 1038 99.6480 1 568 1 chr5A.!!$F1 567
15 TraesCS7B01G331100 chr1A 3649707 3650274 567 True 1038 1038 99.6480 1 568 1 chr1A.!!$R1 567
16 TraesCS7B01G331100 chr1A 64893543 64894110 567 True 1033 1033 99.4720 1 568 1 chr1A.!!$R2 567
17 TraesCS7B01G331100 chr1A 530878416 530878995 579 True 630 630 86.5190 1 576 1 chr1A.!!$R3 575
18 TraesCS7B01G331100 chr3B 53367600 53368167 567 False 1033 1033 99.4720 1 568 1 chr3B.!!$F1 567
19 TraesCS7B01G331100 chr2A 411119777 411120344 567 True 1033 1033 99.4720 1 568 1 chr2A.!!$R1 567
20 TraesCS7B01G331100 chr2A 470630414 470630981 567 False 1033 1033 99.4720 1 568 1 chr2A.!!$F1 567
21 TraesCS7B01G331100 chr1B 659694455 659695022 567 False 1027 1027 99.2960 1 568 1 chr1B.!!$F1 567
22 TraesCS7B01G331100 chr4D 460572067 460572631 564 False 640 640 87.3460 1 560 1 chr4D.!!$F1 559
23 TraesCS7B01G331100 chr1D 99783231 99783805 574 False 619 619 86.3560 1 569 1 chr1D.!!$F1 568
24 TraesCS7B01G331100 chr7D 536599608 536600173 565 False 614 614 86.4670 1 560 1 chr7D.!!$F1 559
25 TraesCS7B01G331100 chr4A 163943314 163943893 579 True 608 608 85.8360 1 576 1 chr4A.!!$R1 575

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
735 3880 0.396278 GAAGCCAATCCCCTCCCTTG 60.396 60.0 0.0 0.0 0.0 3.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1589 4737 2.460669 GCCATTTCCCCTTCTTGTCAT 58.539 47.619 0.0 0.0 0.0 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
472 479 1.070786 TTCACGTGGTTGAGCCTCC 59.929 57.895 17.00 0.0 38.35 4.30
735 3880 0.396278 GAAGCCAATCCCCTCCCTTG 60.396 60.000 0.00 0.0 0.00 3.61
792 3937 6.350361 CCATAGGAATTGTCACATTTGCTCAA 60.350 38.462 9.45 0.0 30.60 3.02
957 4102 5.507315 GGTCTTAGGGTTGTGTTCATTGTTG 60.507 44.000 0.00 0.0 0.00 3.33
1048 4193 2.151202 CACCGTGTGCTAACCAAGAAT 58.849 47.619 0.00 0.0 0.00 2.40
1186 4331 4.856801 CATGGACGGAAGGGCGGG 62.857 72.222 0.00 0.0 0.00 6.13
1211 4356 6.430000 GGATATTTTGTATGCCCGAACTATGT 59.570 38.462 0.00 0.0 0.00 2.29
1252 4397 2.504175 ACTAACGCCTATGACCAACCAT 59.496 45.455 0.00 0.0 0.00 3.55
1417 4562 2.292267 CAGATTGTCTTAGGCGGCAAT 58.708 47.619 13.08 0.0 34.67 3.56
1459 4604 0.476611 AAGGGGCTTGGAGGAAGAGT 60.477 55.000 0.00 0.0 32.82 3.24
2010 5158 0.721718 GTACAGTGCAGCGCCTAAAG 59.278 55.000 2.29 0.0 0.00 1.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
472 479 2.364970 TGAATCAAAGTTTGGTGCCCAG 59.635 45.455 15.47 0.00 33.81 4.45
792 3937 1.668826 TCCCCCACACTAGCAAGATT 58.331 50.000 0.00 0.00 0.00 2.40
843 3988 7.151976 ACCATACCAAATTAGCAAAGAAACAC 58.848 34.615 0.00 0.00 0.00 3.32
957 4102 0.327259 GTCAACCCTAACCCCCACTC 59.673 60.000 0.00 0.00 0.00 3.51
1048 4193 0.687920 TCCCACTTGTTCGGCATGTA 59.312 50.000 0.00 0.00 34.26 2.29
1186 4331 6.430000 ACATAGTTCGGGCATACAAAATATCC 59.570 38.462 0.00 0.00 0.00 2.59
1211 4356 4.323417 AGTTGGAAGTGCACGATCATAAA 58.677 39.130 21.89 12.83 0.00 1.40
1252 4397 4.771590 TTTTACTTCTCGAGCTTACCGA 57.228 40.909 7.81 0.00 34.61 4.69
1459 4604 2.095461 CATCCTCTCCTTCTGACGACA 58.905 52.381 0.00 0.00 0.00 4.35
1589 4737 2.460669 GCCATTTCCCCTTCTTGTCAT 58.539 47.619 0.00 0.00 0.00 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.