Multiple sequence alignment - TraesCS7B01G314700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G314700 chr7B 100.000 2322 0 0 1 2322 562400470 562398149 0 4289
1 TraesCS7B01G314700 chr7B 96.942 1537 42 4 1 1532 415417065 415418601 0 2573
2 TraesCS7B01G314700 chr7B 96.810 1536 45 4 1 1532 664294590 664296125 0 2562
3 TraesCS7B01G314700 chr7B 97.862 795 16 1 1528 2322 134325554 134324761 0 1373
4 TraesCS7B01G314700 chr7B 97.233 795 20 2 1528 2322 678103851 678104643 0 1345
5 TraesCS7B01G314700 chr5B 98.172 1532 25 2 4 1532 351452615 351451084 0 2671
6 TraesCS7B01G314700 chr5B 98.868 795 9 0 1528 2322 351449387 351448593 0 1419
7 TraesCS7B01G314700 chr3B 98.046 1535 27 2 1 1532 28344925 28346459 0 2665
8 TraesCS7B01G314700 chr3B 97.454 1532 36 2 4 1532 542641755 542640224 0 2610
9 TraesCS7B01G314700 chr3B 97.391 1533 34 5 4 1532 81550471 81548941 0 2604
10 TraesCS7B01G314700 chr3B 98.113 795 13 2 1528 2322 542638624 542637832 0 1384
11 TraesCS7B01G314700 chr3B 96.851 794 22 1 1528 2321 737832923 737832133 0 1325
12 TraesCS7B01G314700 chr6B 97.066 1534 40 4 4 1532 22813121 22811588 0 2579
13 TraesCS7B01G314700 chr1B 96.615 1536 42 7 1 1532 615476939 615478468 0 2540
14 TraesCS7B01G314700 chr1B 96.540 1532 44 6 4 1532 618191021 618189496 0 2527
15 TraesCS7B01G314700 chr1B 96.851 794 23 2 1528 2321 122765445 122766236 0 1327
16 TraesCS7B01G314700 chr1B 96.742 798 21 3 1528 2322 615480068 615480863 0 1325
17 TraesCS7B01G314700 chr4B 98.113 795 15 0 1528 2322 82263003 82262209 0 1386
18 TraesCS7B01G314700 chr2B 96.981 795 24 0 1528 2322 631379414 631378620 0 1336


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G314700 chr7B 562398149 562400470 2321 True 4289.0 4289 100.0000 1 2322 1 chr7B.!!$R2 2321
1 TraesCS7B01G314700 chr7B 415417065 415418601 1536 False 2573.0 2573 96.9420 1 1532 1 chr7B.!!$F1 1531
2 TraesCS7B01G314700 chr7B 664294590 664296125 1535 False 2562.0 2562 96.8100 1 1532 1 chr7B.!!$F2 1531
3 TraesCS7B01G314700 chr7B 134324761 134325554 793 True 1373.0 1373 97.8620 1528 2322 1 chr7B.!!$R1 794
4 TraesCS7B01G314700 chr7B 678103851 678104643 792 False 1345.0 1345 97.2330 1528 2322 1 chr7B.!!$F3 794
5 TraesCS7B01G314700 chr5B 351448593 351452615 4022 True 2045.0 2671 98.5200 4 2322 2 chr5B.!!$R1 2318
6 TraesCS7B01G314700 chr3B 28344925 28346459 1534 False 2665.0 2665 98.0460 1 1532 1 chr3B.!!$F1 1531
7 TraesCS7B01G314700 chr3B 81548941 81550471 1530 True 2604.0 2604 97.3910 4 1532 1 chr3B.!!$R1 1528
8 TraesCS7B01G314700 chr3B 542637832 542641755 3923 True 1997.0 2610 97.7835 4 2322 2 chr3B.!!$R3 2318
9 TraesCS7B01G314700 chr3B 737832133 737832923 790 True 1325.0 1325 96.8510 1528 2321 1 chr3B.!!$R2 793
10 TraesCS7B01G314700 chr6B 22811588 22813121 1533 True 2579.0 2579 97.0660 4 1532 1 chr6B.!!$R1 1528
11 TraesCS7B01G314700 chr1B 618189496 618191021 1525 True 2527.0 2527 96.5400 4 1532 1 chr1B.!!$R1 1528
12 TraesCS7B01G314700 chr1B 615476939 615480863 3924 False 1932.5 2540 96.6785 1 2322 2 chr1B.!!$F2 2321
13 TraesCS7B01G314700 chr1B 122765445 122766236 791 False 1327.0 1327 96.8510 1528 2321 1 chr1B.!!$F1 793
14 TraesCS7B01G314700 chr4B 82262209 82263003 794 True 1386.0 1386 98.1130 1528 2322 1 chr4B.!!$R1 794
15 TraesCS7B01G314700 chr2B 631378620 631379414 794 True 1336.0 1336 96.9810 1528 2322 1 chr2B.!!$R1 794

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
779 784 4.517075 GCAAGGGCTTACTTATGGAATCTC 59.483 45.833 0.0 0.0 36.96 2.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1726 3459 5.221422 ACAATTGCTCTAGACTCCTCTATGC 60.221 44.0 5.05 0.0 32.88 3.14 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
546 549 4.897509 TGGAGGATATTGCGATGATCTT 57.102 40.909 0.00 0.00 0.00 2.40
664 667 5.922544 CCAGTGGATTCATGAAACAAAGAAC 59.077 40.000 13.09 4.72 0.00 3.01
779 784 4.517075 GCAAGGGCTTACTTATGGAATCTC 59.483 45.833 0.00 0.00 36.96 2.75
1081 1087 2.365635 AGCGTATCCCTGTGGGCT 60.366 61.111 0.00 0.00 43.94 5.19
1340 1347 4.227300 TGTGATGTAGGTTAATTGGAGGCT 59.773 41.667 0.00 0.00 0.00 4.58
1368 1375 4.169666 TGGTACTTAGGCAGTTCCCTTTA 58.830 43.478 0.00 0.00 41.37 1.85
1412 1419 0.317770 CATCTTTGGCGTGTGCGTTT 60.318 50.000 0.00 0.00 44.10 3.60
1453 1460 0.257039 GGTGGAGTGGCATCTTCCAT 59.743 55.000 17.54 0.00 38.57 3.41
1488 1495 3.630312 AGCAATTTGGAGTACAACAACGT 59.370 39.130 0.00 0.00 39.19 3.99
1726 3459 7.544566 ACATAGTTCACCACATAAAAGAGTACG 59.455 37.037 0.00 0.00 0.00 3.67
2308 4044 0.971386 CAAGCCCCTTCATTGTTGCT 59.029 50.000 0.00 0.00 0.00 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2 3 3.745799 TCACGAACCACATTACCAACAT 58.254 40.909 0.00 0.00 0.00 2.71
664 667 0.319728 CACCAGATGGCCTAGGATCG 59.680 60.000 14.75 4.43 39.32 3.69
896 901 3.906720 ATTAGCATTACCTGACGGTGT 57.093 42.857 0.00 0.00 45.18 4.16
897 902 4.634004 TCAAATTAGCATTACCTGACGGTG 59.366 41.667 0.00 0.00 45.18 4.94
1081 1087 2.422597 CGGAGCAATGGTCAAGTTACA 58.577 47.619 14.70 0.00 0.00 2.41
1340 1347 4.081309 GGAACTGCCTAAGTACCATGTACA 60.081 45.833 0.00 0.00 38.56 2.90
1412 1419 3.758023 CGCATAAAAGCATATCATGGGGA 59.242 43.478 0.00 0.00 0.00 4.81
1488 1495 1.381599 AACATACTCCGGCGGGGTA 60.382 57.895 38.07 38.07 37.00 3.69
1726 3459 5.221422 ACAATTGCTCTAGACTCCTCTATGC 60.221 44.000 5.05 0.00 32.88 3.14
1894 3627 8.864087 TCTACACAATAGAGCTATGATGTGAAT 58.136 33.333 25.58 12.90 36.85 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.