Multiple sequence alignment - TraesCS7B01G304300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G304300 chr7B 100.000 1457 0 0 838 2294 544973060 544974516 0.000000e+00 2691.0
1 TraesCS7B01G304300 chr7B 100.000 539 0 0 1 539 544972223 544972761 0.000000e+00 996.0
2 TraesCS7B01G304300 chr7B 94.131 426 24 1 1 426 656625394 656624970 0.000000e+00 647.0
3 TraesCS7B01G304300 chr7B 88.764 89 8 2 438 524 65082300 65082388 8.670000e-20 108.0
4 TraesCS7B01G304300 chr2A 94.997 1479 51 4 838 2294 23796225 23797702 0.000000e+00 2300.0
5 TraesCS7B01G304300 chr2A 94.478 1485 52 7 838 2294 600113393 600111911 0.000000e+00 2261.0
6 TraesCS7B01G304300 chr2A 94.467 741 19 9 1576 2294 107735556 107736296 0.000000e+00 1122.0
7 TraesCS7B01G304300 chr7A 94.730 1480 54 5 838 2294 707844431 707845909 0.000000e+00 2279.0
8 TraesCS7B01G304300 chr7A 94.595 1480 56 4 838 2294 650324519 650323041 0.000000e+00 2268.0
9 TraesCS7B01G304300 chr7A 94.118 1479 63 5 838 2294 650260703 650259227 0.000000e+00 2228.0
10 TraesCS7B01G304300 chr7A 92.095 1480 73 14 838 2294 615538998 615537540 0.000000e+00 2045.0
11 TraesCS7B01G304300 chr7A 94.467 741 18 2 1577 2294 211061485 211060745 0.000000e+00 1120.0
12 TraesCS7B01G304300 chr1A 94.659 1479 56 4 838 2294 531840010 531838533 0.000000e+00 2272.0
13 TraesCS7B01G304300 chr1A 94.189 1480 62 5 838 2294 380400853 380402331 0.000000e+00 2235.0
14 TraesCS7B01G304300 chr1A 95.246 1178 33 4 1139 2294 504203197 504204373 0.000000e+00 1844.0
15 TraesCS7B01G304300 chr1A 94.763 401 21 0 122 522 11026862 11026462 1.930000e-175 625.0
16 TraesCS7B01G304300 chr1A 93.701 127 8 0 413 539 380400719 380400845 8.360000e-45 191.0
17 TraesCS7B01G304300 chr1B 94.456 1479 59 4 838 2294 658504091 658502614 0.000000e+00 2255.0
18 TraesCS7B01G304300 chr1B 93.263 1143 54 4 838 1958 235897839 235898980 0.000000e+00 1663.0
19 TraesCS7B01G304300 chr1B 94.915 472 23 1 1 472 235896910 235897380 0.000000e+00 737.0
20 TraesCS7B01G304300 chr1B 95.632 435 18 1 1 435 658504920 658504487 0.000000e+00 697.0
21 TraesCS7B01G304300 chr1B 92.453 53 4 0 487 539 235897779 235897831 2.440000e-10 76.8
22 TraesCS7B01G304300 chr6B 92.717 1483 59 11 838 2294 363203635 363205094 0.000000e+00 2095.0
23 TraesCS7B01G304300 chr6B 89.720 107 10 1 433 539 685496378 685496273 3.980000e-28 135.0
24 TraesCS7B01G304300 chr3B 95.131 1335 43 3 982 2294 59100218 59101552 0.000000e+00 2085.0
25 TraesCS7B01G304300 chr3B 96.231 398 14 1 1 397 59099427 59099824 0.000000e+00 651.0
26 TraesCS7B01G304300 chr2B 93.263 1143 54 4 838 1958 811320 810179 0.000000e+00 1663.0
27 TraesCS7B01G304300 chrUn 94.848 427 21 1 1 426 24704644 24705070 0.000000e+00 665.0
28 TraesCS7B01G304300 chr5A 93.824 421 22 3 122 539 603018657 603019076 4.160000e-177 630.0
29 TraesCS7B01G304300 chr2D 92.723 426 28 1 1 426 251564254 251563832 1.510000e-171 612.0
30 TraesCS7B01G304300 chr1D 91.121 428 36 2 1 426 65740040 65740467 1.530000e-161 579.0
31 TraesCS7B01G304300 chr6A 89.423 104 9 2 438 539 578665321 578665218 1.850000e-26 130.0
32 TraesCS7B01G304300 chr5B 88.393 112 7 4 428 539 696003264 696003369 1.850000e-26 130.0
33 TraesCS7B01G304300 chr5B 97.222 72 2 0 428 499 61755074 61755145 3.090000e-24 122.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G304300 chr7B 544972223 544974516 2293 False 1843.5 2691 100.000000 1 2294 2 chr7B.!!$F2 2293
1 TraesCS7B01G304300 chr2A 23796225 23797702 1477 False 2300.0 2300 94.997000 838 2294 1 chr2A.!!$F1 1456
2 TraesCS7B01G304300 chr2A 600111911 600113393 1482 True 2261.0 2261 94.478000 838 2294 1 chr2A.!!$R1 1456
3 TraesCS7B01G304300 chr2A 107735556 107736296 740 False 1122.0 1122 94.467000 1576 2294 1 chr2A.!!$F2 718
4 TraesCS7B01G304300 chr7A 707844431 707845909 1478 False 2279.0 2279 94.730000 838 2294 1 chr7A.!!$F1 1456
5 TraesCS7B01G304300 chr7A 650323041 650324519 1478 True 2268.0 2268 94.595000 838 2294 1 chr7A.!!$R4 1456
6 TraesCS7B01G304300 chr7A 650259227 650260703 1476 True 2228.0 2228 94.118000 838 2294 1 chr7A.!!$R3 1456
7 TraesCS7B01G304300 chr7A 615537540 615538998 1458 True 2045.0 2045 92.095000 838 2294 1 chr7A.!!$R2 1456
8 TraesCS7B01G304300 chr7A 211060745 211061485 740 True 1120.0 1120 94.467000 1577 2294 1 chr7A.!!$R1 717
9 TraesCS7B01G304300 chr1A 531838533 531840010 1477 True 2272.0 2272 94.659000 838 2294 1 chr1A.!!$R2 1456
10 TraesCS7B01G304300 chr1A 504203197 504204373 1176 False 1844.0 1844 95.246000 1139 2294 1 chr1A.!!$F1 1155
11 TraesCS7B01G304300 chr1A 380400719 380402331 1612 False 1213.0 2235 93.945000 413 2294 2 chr1A.!!$F2 1881
12 TraesCS7B01G304300 chr1B 658502614 658504920 2306 True 1476.0 2255 95.044000 1 2294 2 chr1B.!!$R1 2293
13 TraesCS7B01G304300 chr1B 235896910 235898980 2070 False 825.6 1663 93.543667 1 1958 3 chr1B.!!$F1 1957
14 TraesCS7B01G304300 chr6B 363203635 363205094 1459 False 2095.0 2095 92.717000 838 2294 1 chr6B.!!$F1 1456
15 TraesCS7B01G304300 chr3B 59099427 59101552 2125 False 1368.0 2085 95.681000 1 2294 2 chr3B.!!$F1 2293
16 TraesCS7B01G304300 chr2B 810179 811320 1141 True 1663.0 1663 93.263000 838 1958 1 chr2B.!!$R1 1120

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
259 261 1.094785 CCAACCAAACCCTAGCATCG 58.905 55.0 0.0 0.0 0.0 3.84 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1303 1695 0.55822 AGATGGGATCGGAGGAGACA 59.442 55.0 0.0 0.0 0.0 3.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 93 2.036346 GGCAGTTGCTTGACAAATTCCT 59.964 45.455 3.88 0.00 40.82 3.36
175 176 2.797278 CCTCCCTTCCCACGGATCG 61.797 68.421 0.00 0.00 0.00 3.69
234 236 1.274167 TCCAACGTCTCCTAAACGCAT 59.726 47.619 0.00 0.00 43.76 4.73
259 261 1.094785 CCAACCAAACCCTAGCATCG 58.905 55.000 0.00 0.00 0.00 3.84
298 300 3.607299 TCCCTCTCCCCGACCCAA 61.607 66.667 0.00 0.00 0.00 4.12
383 385 3.387947 CAACTCCTACCCCGCCGT 61.388 66.667 0.00 0.00 0.00 5.68
421 423 1.303799 CGCTGCTCTTGACCTGCAAT 61.304 55.000 0.00 0.00 35.59 3.56
436 439 1.779061 CAATGACCAACGACGACGG 59.221 57.895 12.58 3.57 44.46 4.79
472 475 4.750695 TCCTTCCCCATCCCGCCA 62.751 66.667 0.00 0.00 0.00 5.69
499 886 2.108976 GATCCATTCTCGCCGCCA 59.891 61.111 0.00 0.00 0.00 5.69
500 887 1.958205 GATCCATTCTCGCCGCCAG 60.958 63.158 0.00 0.00 0.00 4.85
897 1284 4.401519 CAGATCCAGAGCACAAATCCAAAT 59.598 41.667 0.00 0.00 0.00 2.32
909 1296 5.933463 CACAAATCCAAATAGCACACCATTT 59.067 36.000 0.00 0.00 0.00 2.32
1017 1406 2.750637 ATGGACGCCGTCGACTCT 60.751 61.111 14.70 0.00 39.41 3.24
1026 1415 1.319541 CCGTCGACTCTATGGTGGAT 58.680 55.000 14.70 0.00 0.00 3.41
1088 1480 4.641645 CTGCCACAAGCCCGACCA 62.642 66.667 0.00 0.00 42.71 4.02
1151 1543 1.871676 GGTTCGTTTTCCTCTTTCGCT 59.128 47.619 0.00 0.00 0.00 4.93
1303 1695 2.186903 CCGGCTAGGTGCGAATGT 59.813 61.111 0.00 0.00 44.05 2.71
1433 1825 7.604164 CCTGCGATCTGACCAATATTTAGTAAT 59.396 37.037 0.00 0.00 0.00 1.89
1561 1954 2.705730 TGCTTAAGTCATTGCCGCTAA 58.294 42.857 4.02 0.00 0.00 3.09
1573 1966 1.103398 GCCGCTAATTGCCTCCACAT 61.103 55.000 0.00 0.00 38.78 3.21
1583 1976 3.369242 TGCCTCCACATGATGAATTGA 57.631 42.857 0.00 0.00 0.00 2.57
1713 2107 5.366482 TGCATCTAAATTGGCACCTACTA 57.634 39.130 0.00 0.00 0.00 1.82
2146 2568 2.366533 CCGACCAGTCTGTTCTAGCTA 58.633 52.381 0.00 0.00 0.00 3.32
2194 2616 1.070445 TGCCAACTGCCATTTCTTTGG 59.930 47.619 0.00 0.00 40.16 3.28
2270 2692 6.916360 ATGCTCTTTCTGGGTTTTTCAATA 57.084 33.333 0.00 0.00 0.00 1.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
234 236 2.012824 TAGGGTTTGGTTGGCCAGCA 62.013 55.000 22.07 12.13 46.91 4.41
303 305 4.779733 GGGGAGAGGGAGGCGACA 62.780 72.222 0.00 0.00 0.00 4.35
400 402 1.449246 GCAGGTCAAGAGCAGCGAT 60.449 57.895 1.02 0.00 32.07 4.58
401 403 2.047844 GCAGGTCAAGAGCAGCGA 60.048 61.111 1.02 0.00 32.07 4.93
421 423 4.651008 GGCCGTCGTCGTTGGTCA 62.651 66.667 0.71 0.00 35.01 4.02
472 475 0.757188 AGAATGGATCTCCTCGCCGT 60.757 55.000 0.00 0.00 30.46 5.68
897 1284 0.538516 AACGGGCAAATGGTGTGCTA 60.539 50.000 0.00 0.00 41.88 3.49
1026 1415 4.388499 GCAAACTCGCGGAGGGGA 62.388 66.667 6.13 0.00 42.39 4.81
1088 1480 3.053826 AGTCTTTGGTCCTTACCCTTGT 58.946 45.455 0.00 0.00 46.16 3.16
1151 1543 1.001268 GCCGAATCAGCGTCAGATCTA 60.001 52.381 0.00 0.00 0.00 1.98
1207 1599 1.804326 CCATGACGACGAACCCGAC 60.804 63.158 0.00 0.00 39.50 4.79
1303 1695 0.558220 AGATGGGATCGGAGGAGACA 59.442 55.000 0.00 0.00 0.00 3.41
1561 1954 4.283337 TCAATTCATCATGTGGAGGCAAT 58.717 39.130 0.00 0.00 0.00 3.56
1573 1966 2.444388 AGCCTATGCCCTCAATTCATCA 59.556 45.455 0.00 0.00 38.69 3.07
1583 1976 1.308216 AGGAACCAGCCTATGCCCT 60.308 57.895 0.00 0.00 36.22 5.19
2146 2568 2.691409 ATCGGACGACCACATGAAAT 57.309 45.000 0.00 0.00 35.59 2.17
2194 2616 6.595716 ACCAAAAGACTATTGACATCAGCTAC 59.404 38.462 0.00 0.00 0.00 3.58
2270 2692 4.050757 AGCAAAAGATAGGGGGAAGAGAT 58.949 43.478 0.00 0.00 0.00 2.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.