Multiple sequence alignment - TraesCS7B01G298000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G298000 chr7B 100.000 2264 0 0 1 2264 535437151 535434888 0.000000e+00 4181.0
1 TraesCS7B01G298000 chr7B 96.766 1917 37 14 1 1911 666615841 666617738 0.000000e+00 3173.0
2 TraesCS7B01G298000 chr7B 97.544 1588 33 5 1 1584 664951470 664949885 0.000000e+00 2712.0
3 TraesCS7B01G298000 chr7B 99.148 352 3 0 1913 2264 664946554 664946203 3.170000e-178 634.0
4 TraesCS7B01G298000 chr7B 99.148 352 3 0 1913 2264 666621807 666622158 3.170000e-178 634.0
5 TraesCS7B01G298000 chr7B 98.011 352 7 0 1913 2264 379917266 379917617 1.490000e-171 612.0
6 TraesCS7B01G298000 chr7B 82.632 190 15 14 1674 1861 692398611 692398784 3.890000e-33 152.0
7 TraesCS7B01G298000 chr5B 98.170 1913 32 2 1 1911 123786973 123788884 0.000000e+00 3336.0
8 TraesCS7B01G298000 chr5B 97.334 1763 39 5 4 1759 353930733 353928972 0.000000e+00 2988.0
9 TraesCS7B01G298000 chr5B 97.052 1764 45 4 1 1759 18184111 18185872 0.000000e+00 2963.0
10 TraesCS7B01G298000 chr5B 99.148 352 3 0 1913 2264 18189834 18190185 3.170000e-178 634.0
11 TraesCS7B01G298000 chr5B 98.864 352 4 0 1913 2264 353925013 353924662 1.480000e-176 628.0
12 TraesCS7B01G298000 chr5B 98.011 352 7 0 1913 2264 123792784 123793135 1.490000e-171 612.0
13 TraesCS7B01G298000 chr5B 94.118 102 6 0 1810 1911 18185869 18185970 3.010000e-34 156.0
14 TraesCS7B01G298000 chr5B 94.118 102 6 0 1810 1911 353928975 353928874 3.010000e-34 156.0
15 TraesCS7B01G298000 chr5B 86.957 115 10 4 1709 1821 514052335 514052446 8.490000e-25 124.0
16 TraesCS7B01G298000 chr3B 97.334 1763 43 2 1 1759 734227366 734225604 0.000000e+00 2992.0
17 TraesCS7B01G298000 chr3B 91.430 1867 130 20 1 1861 21644986 21646828 0.000000e+00 2534.0
18 TraesCS7B01G298000 chr3B 98.295 352 6 0 1913 2264 734221345 734220994 3.190000e-173 617.0
19 TraesCS7B01G298000 chr3B 94.118 102 6 0 1810 1911 734225607 734225506 3.010000e-34 156.0
20 TraesCS7B01G298000 chr3B 89.474 57 4 1 1755 1811 21646664 21646718 1.120000e-08 71.3
21 TraesCS7B01G298000 chr3D 94.650 1869 74 19 1 1861 581472628 581474478 0.000000e+00 2874.0
22 TraesCS7B01G298000 chr6B 91.342 1871 130 19 1 1861 715471837 715469989 0.000000e+00 2529.0
23 TraesCS7B01G298000 chr4B 96.563 1251 23 6 681 1911 522404483 522405733 0.000000e+00 2054.0
24 TraesCS7B01G298000 chr4B 98.547 344 5 0 1913 2256 522409589 522409932 1.920000e-170 608.0
25 TraesCS7B01G298000 chr4A 94.800 1173 24 20 690 1861 692376407 692375271 0.000000e+00 1794.0
26 TraesCS7B01G298000 chr1B 99.148 352 3 0 1913 2264 643573930 643574281 3.170000e-178 634.0
27 TraesCS7B01G298000 chr2B 99.048 210 2 0 1444 1653 799685038 799685247 5.900000e-101 377.0
28 TraesCS7B01G298000 chr2B 89.474 57 4 1 1755 1811 799685280 799685334 1.120000e-08 71.3


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G298000 chr7B 535434888 535437151 2263 True 4181.000000 4181 100.000000 1 2264 1 chr7B.!!$R1 2263
1 TraesCS7B01G298000 chr7B 666615841 666617738 1897 False 3173.000000 3173 96.766000 1 1911 1 chr7B.!!$F2 1910
2 TraesCS7B01G298000 chr7B 664946203 664951470 5267 True 1673.000000 2712 98.346000 1 2264 2 chr7B.!!$R2 2263
3 TraesCS7B01G298000 chr5B 123786973 123793135 6162 False 1974.000000 3336 98.090500 1 2264 2 chr5B.!!$F3 2263
4 TraesCS7B01G298000 chr5B 353924662 353930733 6071 True 1257.333333 2988 96.772000 4 2264 3 chr5B.!!$R1 2260
5 TraesCS7B01G298000 chr5B 18184111 18190185 6074 False 1251.000000 2963 96.772667 1 2264 3 chr5B.!!$F2 2263
6 TraesCS7B01G298000 chr3B 734225506 734227366 1860 True 1574.000000 2992 95.726000 1 1911 2 chr3B.!!$R2 1910
7 TraesCS7B01G298000 chr3B 21644986 21646828 1842 False 1302.650000 2534 90.452000 1 1861 2 chr3B.!!$F1 1860
8 TraesCS7B01G298000 chr3D 581472628 581474478 1850 False 2874.000000 2874 94.650000 1 1861 1 chr3D.!!$F1 1860
9 TraesCS7B01G298000 chr6B 715469989 715471837 1848 True 2529.000000 2529 91.342000 1 1861 1 chr6B.!!$R1 1860
10 TraesCS7B01G298000 chr4B 522404483 522409932 5449 False 1331.000000 2054 97.555000 681 2256 2 chr4B.!!$F1 1575
11 TraesCS7B01G298000 chr4A 692375271 692376407 1136 True 1794.000000 1794 94.800000 690 1861 1 chr4A.!!$R1 1171

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
553 559 1.689273 GAGCCTCCGGACACTATCAAT 59.311 52.381 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1915 6046 1.429148 GCTAATTGGCGAGACCGTGG 61.429 60.0 0.0 0.0 43.94 4.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
113 115 4.755266 AGGCTATTCAACACCTACGATT 57.245 40.909 0.00 0.0 0.00 3.34
118 120 5.350365 GCTATTCAACACCTACGATTTGACA 59.650 40.000 0.00 0.0 0.00 3.58
135 137 2.094442 TGACATACCAAATCGACGAGCA 60.094 45.455 3.01 0.0 0.00 4.26
307 309 1.825641 TCTGATGGGACAACCGTGAGA 60.826 52.381 0.00 0.0 44.88 3.27
553 559 1.689273 GAGCCTCCGGACACTATCAAT 59.311 52.381 0.00 0.0 0.00 2.57
696 709 4.585216 AGGGGGTTCCGGTGGTCA 62.585 66.667 0.00 0.0 41.52 4.02
1193 1212 5.051153 GTGGACGGAAGGAAGAAGATATTC 58.949 45.833 0.00 0.0 0.00 1.75
1672 1696 7.056006 TGTGCTATTTGAGGATTGTATCATGT 58.944 34.615 0.00 0.0 0.00 3.21
1715 1739 6.487668 TCATGGACCTATTGTGCTATTTGATG 59.512 38.462 0.00 0.0 36.06 3.07
1728 1752 7.282224 TGTGCTATTTGATGGGAACTATGTAAC 59.718 37.037 0.00 0.0 0.00 2.50
1890 2045 0.990374 AGAAATGCTCTGGTCTGCCT 59.010 50.000 0.00 0.0 31.12 4.75
1896 2051 1.118838 GCTCTGGTCTGCCTAGATGT 58.881 55.000 0.00 0.0 34.94 3.06
1897 2052 1.068434 GCTCTGGTCTGCCTAGATGTC 59.932 57.143 0.00 0.0 34.94 3.06
1920 6051 0.036388 AATGCTCTGTACCACCACGG 60.036 55.000 0.00 0.0 42.50 4.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
113 115 2.927477 GCTCGTCGATTTGGTATGTCAA 59.073 45.455 0.00 0.00 0.00 3.18
118 120 2.158957 ACCATGCTCGTCGATTTGGTAT 60.159 45.455 17.45 0.69 35.77 2.73
135 137 2.291153 CCATCTCTTGTTGTCCCACCAT 60.291 50.000 0.00 0.00 0.00 3.55
307 309 4.201891 GCTTCAAGATCGAACTCATGCATT 60.202 41.667 0.00 0.00 0.00 3.56
553 559 2.687425 CTGGTTGTCACATTGACCACAA 59.313 45.455 11.39 1.22 46.40 3.33
571 577 2.154462 GTTCTCACATTGTGTCCCTGG 58.846 52.381 16.06 0.00 34.79 4.45
573 579 3.415212 CATGTTCTCACATTGTGTCCCT 58.585 45.455 16.06 0.00 41.16 4.20
1193 1212 1.806542 GTGCATAGTTGGGACACACAG 59.193 52.381 0.00 0.00 39.29 3.66
1672 1696 7.498900 GGTCCATGACATAGTTCATCACAAATA 59.501 37.037 0.00 0.00 33.74 1.40
1715 1739 5.970592 ACTTAGGTTCGTTACATAGTTCCC 58.029 41.667 0.00 0.00 0.00 3.97
1728 1752 7.359264 CCGATCAAATAGCATAACTTAGGTTCG 60.359 40.741 0.00 0.00 36.92 3.95
1915 6046 1.429148 GCTAATTGGCGAGACCGTGG 61.429 60.000 0.00 0.00 43.94 4.94
1920 6051 2.281762 CGTAAGTGCTAATTGGCGAGAC 59.718 50.000 9.40 2.06 34.52 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.