Multiple sequence alignment - TraesCS7B01G292600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G292600 chr7B 100.000 2504 0 0 1 2504 528912470 528909967 0 4625
1 TraesCS7B01G292600 chr7B 98.603 2506 28 7 1 2504 68109799 68107299 0 4427
2 TraesCS7B01G292600 chr2A 99.321 2504 15 2 1 2504 719466164 719463663 0 4529
3 TraesCS7B01G292600 chr2A 98.843 2507 20 7 1 2504 43392666 43390166 0 4460
4 TraesCS7B01G292600 chr5B 99.200 2501 16 4 1 2501 179239830 179237334 0 4505
5 TraesCS7B01G292600 chr5B 98.842 2505 24 4 1 2504 406858245 406860745 0 4460
6 TraesCS7B01G292600 chr6B 98.923 2506 20 6 1 2504 408674335 408671835 0 4471
7 TraesCS7B01G292600 chr6B 98.842 2505 25 4 1 2504 704838304 704840805 0 4462
8 TraesCS7B01G292600 chr7A 98.802 2505 27 3 1 2504 171431009 171428507 0 4457
9 TraesCS7B01G292600 chr3B 98.760 2499 26 5 4 2501 552490503 552488009 0 4438


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G292600 chr7B 528909967 528912470 2503 True 4625 4625 100.000 1 2504 1 chr7B.!!$R2 2503
1 TraesCS7B01G292600 chr7B 68107299 68109799 2500 True 4427 4427 98.603 1 2504 1 chr7B.!!$R1 2503
2 TraesCS7B01G292600 chr2A 719463663 719466164 2501 True 4529 4529 99.321 1 2504 1 chr2A.!!$R2 2503
3 TraesCS7B01G292600 chr2A 43390166 43392666 2500 True 4460 4460 98.843 1 2504 1 chr2A.!!$R1 2503
4 TraesCS7B01G292600 chr5B 179237334 179239830 2496 True 4505 4505 99.200 1 2501 1 chr5B.!!$R1 2500
5 TraesCS7B01G292600 chr5B 406858245 406860745 2500 False 4460 4460 98.842 1 2504 1 chr5B.!!$F1 2503
6 TraesCS7B01G292600 chr6B 408671835 408674335 2500 True 4471 4471 98.923 1 2504 1 chr6B.!!$R1 2503
7 TraesCS7B01G292600 chr6B 704838304 704840805 2501 False 4462 4462 98.842 1 2504 1 chr6B.!!$F1 2503
8 TraesCS7B01G292600 chr7A 171428507 171431009 2502 True 4457 4457 98.802 1 2504 1 chr7A.!!$R1 2503
9 TraesCS7B01G292600 chr3B 552488009 552490503 2494 True 4438 4438 98.760 4 2501 1 chr3B.!!$R1 2497

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
579 582 8.465201 GTTTATCTTCATTTCTCAGGCTCAAAT 58.535 33.333 0.0 0.0 0.0 2.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2301 2309 1.470098 CCAAGTCAAGCACTATGGCAC 59.53 52.381 0.0 0.0 32.3 5.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
579 582 8.465201 GTTTATCTTCATTTCTCAGGCTCAAAT 58.535 33.333 0.0 0.0 0.00 2.32
1636 1640 2.380064 TGAACCAATTCCCAGCTTGT 57.620 45.000 0.0 0.0 33.49 3.16
1662 1666 4.298332 CAAGGGTTTCAGTTTGGAATTCG 58.702 43.478 0.0 0.0 0.00 3.34
1855 1859 9.836076 GAATTATAAGGTCCAAACAAGTACAAC 57.164 33.333 0.0 0.0 0.00 3.32
1856 1860 8.927675 ATTATAAGGTCCAAACAAGTACAACA 57.072 30.769 0.0 0.0 0.00 3.33
1950 1957 1.039068 CAAGTCCAACACATTGCCCA 58.961 50.000 0.0 0.0 34.17 5.36
2301 2309 9.617523 ATGATAAGGAAATTTAGGCAAAAATGG 57.382 29.630 0.0 0.0 0.00 3.16
2413 2421 5.277974 GCAGTTAAATCAAAGCACTCTCACA 60.278 40.000 0.0 0.0 0.00 3.58
2459 2467 0.467844 TGTTGTCAAGCCAGTGCCAT 60.468 50.000 0.0 0.0 38.69 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
579 582 1.764134 ACCCAACTAACGGTTCACTGA 59.236 47.619 0.00 0.00 35.74 3.41
1636 1640 4.252570 TCCAAACTGAAACCCTTGGTAA 57.747 40.909 0.00 0.00 39.51 2.85
1662 1666 6.319658 TCTTGATAACTCTTGCCATCAAATCC 59.680 38.462 0.00 0.00 37.06 3.01
1950 1957 9.003658 GCTACTGTCCAATATACAAATTGCTAT 57.996 33.333 0.00 0.00 35.85 2.97
2244 2252 4.473196 TGGGGTTTCTAGCATGTAGAATCA 59.527 41.667 14.48 10.07 34.02 2.57
2301 2309 1.470098 CCAAGTCAAGCACTATGGCAC 59.530 52.381 0.00 0.00 32.30 5.01
2307 2315 3.818773 GCTTTAACCCAAGTCAAGCACTA 59.181 43.478 0.00 0.00 39.98 2.74


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.