Multiple sequence alignment - TraesCS7B01G255200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G255200 chr7B 100.000 4187 0 0 1 4187 472398050 472393864 0.000000e+00 7733.0
1 TraesCS7B01G255200 chr7B 99.528 3178 10 3 1014 4187 472330168 472326992 0.000000e+00 5781.0
2 TraesCS7B01G255200 chr7B 95.164 2109 64 7 1493 3597 651341432 651339358 0.000000e+00 3295.0
3 TraesCS7B01G255200 chr7B 98.925 1023 11 0 1 1023 472332569 472331547 0.000000e+00 1829.0
4 TraesCS7B01G255200 chr7B 81.068 1442 234 25 1676 3097 651408917 651410339 0.000000e+00 1114.0
5 TraesCS7B01G255200 chr7B 95.840 649 25 2 2156 2803 651443712 651444359 0.000000e+00 1048.0
6 TraesCS7B01G255200 chr7B 79.574 1503 248 27 1542 3010 651454045 651452568 0.000000e+00 1020.0
7 TraesCS7B01G255200 chr7B 79.172 1498 250 27 1542 3005 651336460 651337929 0.000000e+00 981.0
8 TraesCS7B01G255200 chr7B 98.099 526 9 1 3663 4187 651450505 651451030 0.000000e+00 915.0
9 TraesCS7B01G255200 chr7B 94.824 541 17 3 2799 3336 651445085 651445617 0.000000e+00 833.0
10 TraesCS7B01G255200 chr7B 94.589 499 17 3 969 1464 651341920 651341429 0.000000e+00 763.0
11 TraesCS7B01G255200 chr7B 75.460 1251 263 33 1791 3007 651403716 651402476 1.690000e-158 569.0
12 TraesCS7B01G255200 chr7B 94.311 334 16 2 3331 3664 651450089 651450419 3.730000e-140 508.0
13 TraesCS7B01G255200 chr7B 89.200 250 12 4 3663 3899 651339242 651338995 8.800000e-77 298.0
14 TraesCS7B01G255200 chr7B 92.529 174 10 1 3928 4101 651338618 651338448 3.230000e-61 246.0
15 TraesCS7B01G255200 chr7D 95.637 1398 50 3 2269 3663 583986488 583985099 0.000000e+00 2233.0
16 TraesCS7B01G255200 chr7D 86.137 2063 257 14 967 3011 583479239 583477188 0.000000e+00 2198.0
17 TraesCS7B01G255200 chr7D 90.457 744 67 3 2249 2989 583965477 583964735 0.000000e+00 977.0
18 TraesCS7B01G255200 chr7D 80.763 1206 195 22 1916 3102 583994676 583993489 0.000000e+00 907.0
19 TraesCS7B01G255200 chr7D 96.970 528 10 4 3663 4187 583985013 583984489 0.000000e+00 881.0
20 TraesCS7B01G255200 chr7D 82.555 728 97 12 1583 2292 583973408 583974123 7.690000e-172 614.0
21 TraesCS7B01G255200 chr7D 87.647 340 25 9 3664 3999 583870699 583870373 3.060000e-101 379.0
22 TraesCS7B01G255200 chr7D 94.578 166 8 1 1084 1249 583989673 583989509 5.370000e-64 255.0
23 TraesCS7B01G255200 chr7A 86.115 2067 255 12 967 3011 675115604 675113548 0.000000e+00 2198.0
24 TraesCS7B01G255200 chr7A 98.182 55 1 0 3663 3717 124795692 124795746 3.450000e-16 97.1
25 TraesCS7B01G255200 chr4B 92.857 644 43 3 1 642 434476989 434476347 0.000000e+00 931.0
26 TraesCS7B01G255200 chr4B 88.341 446 36 7 447 880 605161269 605161710 4.800000e-144 521.0
27 TraesCS7B01G255200 chr6A 79.495 1268 223 17 1759 3010 146501916 146500670 0.000000e+00 867.0
28 TraesCS7B01G255200 chr6A 84.418 661 54 21 1024 1645 146502656 146502006 4.630000e-169 604.0
29 TraesCS7B01G255200 chr6A 85.230 501 39 19 3163 3663 146497156 146497621 2.260000e-132 483.0
30 TraesCS7B01G255200 chr6A 87.088 364 26 3 2774 3133 146496821 146497167 3.920000e-105 392.0
31 TraesCS7B01G255200 chr6A 90.747 281 15 8 3902 4179 146497887 146498159 8.550000e-97 364.0
32 TraesCS7B01G255200 chr6A 87.817 197 19 5 3663 3856 146497685 146497879 4.210000e-55 226.0
33 TraesCS7B01G255200 chrUn 100.000 390 0 0 3783 4172 479953204 479953593 0.000000e+00 721.0
34 TraesCS7B01G255200 chr6D 87.778 90 11 0 492 581 94771545 94771456 5.730000e-19 106.0
35 TraesCS7B01G255200 chr6D 85.057 87 12 1 489 575 460480902 460480987 2.070000e-13 87.9
36 TraesCS7B01G255200 chr6B 87.778 90 11 0 492 581 178014375 178014464 5.730000e-19 106.0
37 TraesCS7B01G255200 chr2D 95.238 63 2 1 3662 3723 35210496 35210434 9.580000e-17 99.0
38 TraesCS7B01G255200 chr2D 94.340 53 3 0 529 581 435328207 435328155 9.650000e-12 82.4
39 TraesCS7B01G255200 chr4D 93.548 62 3 1 3663 3723 370369298 370369237 1.600000e-14 91.6
40 TraesCS7B01G255200 chr3B 84.211 95 14 1 487 581 327861323 327861416 1.600000e-14 91.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G255200 chr7B 472393864 472398050 4186 True 7733.00 7733 100.0000 1 4187 1 chr7B.!!$R1 4186
1 TraesCS7B01G255200 chr7B 472326992 472332569 5577 True 3805.00 5781 99.2265 1 4187 2 chr7B.!!$R4 4186
2 TraesCS7B01G255200 chr7B 651338448 651341920 3472 True 1150.50 3295 92.8705 969 4101 4 chr7B.!!$R5 3132
3 TraesCS7B01G255200 chr7B 651408917 651410339 1422 False 1114.00 1114 81.0680 1676 3097 1 chr7B.!!$F2 1421
4 TraesCS7B01G255200 chr7B 651452568 651454045 1477 True 1020.00 1020 79.5740 1542 3010 1 chr7B.!!$R3 1468
5 TraesCS7B01G255200 chr7B 651336460 651337929 1469 False 981.00 981 79.1720 1542 3005 1 chr7B.!!$F1 1463
6 TraesCS7B01G255200 chr7B 651443712 651445617 1905 False 940.50 1048 95.3320 2156 3336 2 chr7B.!!$F3 1180
7 TraesCS7B01G255200 chr7B 651450089 651451030 941 False 711.50 915 96.2050 3331 4187 2 chr7B.!!$F4 856
8 TraesCS7B01G255200 chr7B 651402476 651403716 1240 True 569.00 569 75.4600 1791 3007 1 chr7B.!!$R2 1216
9 TraesCS7B01G255200 chr7D 583477188 583479239 2051 True 2198.00 2198 86.1370 967 3011 1 chr7D.!!$R1 2044
10 TraesCS7B01G255200 chr7D 583984489 583994676 10187 True 1069.00 2233 91.9870 1084 4187 4 chr7D.!!$R4 3103
11 TraesCS7B01G255200 chr7D 583964735 583965477 742 True 977.00 977 90.4570 2249 2989 1 chr7D.!!$R3 740
12 TraesCS7B01G255200 chr7D 583973408 583974123 715 False 614.00 614 82.5550 1583 2292 1 chr7D.!!$F1 709
13 TraesCS7B01G255200 chr7A 675113548 675115604 2056 True 2198.00 2198 86.1150 967 3011 1 chr7A.!!$R1 2044
14 TraesCS7B01G255200 chr4B 434476347 434476989 642 True 931.00 931 92.8570 1 642 1 chr4B.!!$R1 641
15 TraesCS7B01G255200 chr6A 146500670 146502656 1986 True 735.50 867 81.9565 1024 3010 2 chr6A.!!$R1 1986
16 TraesCS7B01G255200 chr6A 146496821 146498159 1338 False 366.25 483 87.7205 2774 4179 4 chr6A.!!$F1 1405

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
845 848 1.689813 TGCCTACGTGGAGACAAGAAA 59.310 47.619 0.0 0.0 46.06 2.52 F
2161 6469 3.559597 CGGATCTCGTCCTCTATAACCCT 60.560 52.174 0.0 0.0 45.46 4.34 F
2252 6566 4.675029 AAGGGAACGTCGTGGGCG 62.675 66.667 0.0 0.0 39.92 6.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2161 6469 4.595538 AGCGACGCCGTGGTGAAA 62.596 61.111 17.79 0.00 38.24 2.69 R
3107 9951 0.657368 GCAACGCGTTCTTGGAACAG 60.657 55.000 23.92 8.71 42.39 3.16 R
3781 10716 9.269453 GTTGGTATCTTTGTAGAAAGTAAGTGT 57.731 33.333 11.74 0.00 39.79 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
743 746 3.398353 GAACGAGACGCGAGGGAGG 62.398 68.421 15.93 0.0 44.57 4.30
845 848 1.689813 TGCCTACGTGGAGACAAGAAA 59.310 47.619 0.00 0.0 46.06 2.52
2161 6469 3.559597 CGGATCTCGTCCTCTATAACCCT 60.560 52.174 0.00 0.0 45.46 4.34
2252 6566 4.675029 AAGGGAACGTCGTGGGCG 62.675 66.667 0.00 0.0 39.92 6.13
3107 9951 4.870363 TCTAAATTCTGTTTGCAGTTGCC 58.130 39.130 1.06 0.0 43.05 4.52
3781 10716 3.193056 TCATGCCATTTTCGAGCATCAAA 59.807 39.130 6.14 0.0 45.16 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
584 587 1.382522 CAAGGTGTCATTCCATCCCG 58.617 55.000 0.00 0.00 0.00 5.14
706 709 0.960861 CTTTTCTTCCCCCGACTGGC 60.961 60.000 0.00 0.00 0.00 4.85
743 746 2.059541 GCTGTCGTCCTACACAACTTC 58.940 52.381 0.00 0.00 0.00 3.01
2161 6469 4.595538 AGCGACGCCGTGGTGAAA 62.596 61.111 17.79 0.00 38.24 2.69
2252 6566 5.283247 CACTCTCGTAACAACTGTAACGATC 59.717 44.000 0.00 0.00 42.77 3.69
3107 9951 0.657368 GCAACGCGTTCTTGGAACAG 60.657 55.000 23.92 8.71 42.39 3.16
3781 10716 9.269453 GTTGGTATCTTTGTAGAAAGTAAGTGT 57.731 33.333 11.74 0.00 39.79 3.55


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.