Multiple sequence alignment - TraesCS7B01G253900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G253900 chr7B 100.000 2792 0 0 1 2792 468057478 468060269 0.000000e+00 5156.0
1 TraesCS7B01G253900 chr7B 97.297 1036 23 4 1757 2792 426386261 426387291 0.000000e+00 1753.0
2 TraesCS7B01G253900 chr7B 97.008 1036 30 1 1757 2792 687278860 687279894 0.000000e+00 1740.0
3 TraesCS7B01G253900 chr7B 98.849 956 10 1 1 955 112003279 112002324 0.000000e+00 1703.0
4 TraesCS7B01G253900 chr7B 97.614 964 13 3 1 955 707739475 707738513 0.000000e+00 1644.0
5 TraesCS7B01G253900 chr7B 96.356 741 27 0 956 1696 474435322 474434582 0.000000e+00 1219.0
6 TraesCS7B01G253900 chr7B 99.273 550 3 1 410 959 468052172 468052720 0.000000e+00 992.0
7 TraesCS7B01G253900 chr7B 98.364 550 8 1 410 959 112008594 112008046 0.000000e+00 965.0
8 TraesCS7B01G253900 chr7B 98.022 455 7 2 505 959 707743948 707743496 0.000000e+00 789.0
9 TraesCS7B01G253900 chr7B 97.917 96 2 0 410 505 707749878 707749783 1.720000e-37 167.0
10 TraesCS7B01G253900 chr5B 97.201 1036 29 0 1757 2792 487408664 487407629 0.000000e+00 1753.0
11 TraesCS7B01G253900 chr5B 97.008 1036 29 2 1757 2792 535370509 535371542 0.000000e+00 1740.0
12 TraesCS7B01G253900 chr5B 97.600 375 7 2 585 959 673119206 673118834 2.340000e-180 641.0
13 TraesCS7B01G253900 chr5B 83.803 142 13 9 361 497 261189768 261189904 2.920000e-25 126.0
14 TraesCS7B01G253900 chr4B 97.201 1036 29 0 1757 2792 494988733 494989768 0.000000e+00 1753.0
15 TraesCS7B01G253900 chr4B 97.104 1036 30 0 1757 2792 52418508 52419543 0.000000e+00 1748.0
16 TraesCS7B01G253900 chr4B 86.517 178 14 8 4 174 67820050 67819876 1.320000e-43 187.0
17 TraesCS7B01G253900 chr6B 97.107 1037 27 3 1757 2792 51515390 51516424 0.000000e+00 1746.0
18 TraesCS7B01G253900 chr2B 97.008 1036 30 1 1757 2792 382939527 382940561 0.000000e+00 1740.0
19 TraesCS7B01G253900 chr2B 85.955 178 15 8 4 174 776767106 776766932 6.140000e-42 182.0
20 TraesCS7B01G253900 chr2B 83.854 192 27 2 282 472 702718141 702717953 2.210000e-41 180.0
21 TraesCS7B01G253900 chr1B 96.911 1036 32 0 1757 2792 110570148 110569113 0.000000e+00 1736.0
22 TraesCS7B01G253900 chr7D 97.260 803 22 0 956 1758 452140939 452140137 0.000000e+00 1362.0
23 TraesCS7B01G253900 chr7A 94.828 812 33 2 956 1758 545519742 545520553 0.000000e+00 1258.0
24 TraesCS7B01G253900 chr6A 98.113 371 6 1 585 955 599635385 599635016 0.000000e+00 645.0
25 TraesCS7B01G253900 chr6A 97.305 371 8 2 589 959 599641738 599641370 1.830000e-176 628.0
26 TraesCS7B01G253900 chr6A 85.955 178 15 8 4 174 78040025 78039851 6.140000e-42 182.0
27 TraesCS7B01G253900 chr6A 85.955 178 15 9 4 174 617589617 617589791 6.140000e-42 182.0
28 TraesCS7B01G253900 chr1A 81.290 775 113 19 994 1749 482328617 482329378 1.430000e-167 599.0
29 TraesCS7B01G253900 chr1A 97.468 237 6 0 410 646 549713096 549712860 3.350000e-109 405.0
30 TraesCS7B01G253900 chr1D 81.105 778 119 14 998 1758 382218990 382219756 5.150000e-167 597.0
31 TraesCS7B01G253900 chr1D 89.324 281 26 4 681 959 253181819 253181541 1.590000e-92 350.0
32 TraesCS7B01G253900 chr4D 90.260 154 12 2 4 154 12987996 12988149 6.100000e-47 198.0
33 TraesCS7B01G253900 chr2A 86.517 178 14 8 4 174 50044462 50044636 1.320000e-43 187.0
34 TraesCS7B01G253900 chrUn 87.135 171 13 6 4 166 242436432 242436601 4.750000e-43 185.0
35 TraesCS7B01G253900 chr2D 82.468 154 24 1 280 433 583224667 583224517 6.270000e-27 132.0
36 TraesCS7B01G253900 chr2D 80.000 125 14 7 368 484 41915156 41915277 6.410000e-12 82.4
37 TraesCS7B01G253900 chr5A 77.489 231 37 11 280 506 71257446 71257227 1.050000e-24 124.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G253900 chr7B 468057478 468060269 2791 False 5156 5156 100.000 1 2792 1 chr7B.!!$F3 2791
1 TraesCS7B01G253900 chr7B 426386261 426387291 1030 False 1753 1753 97.297 1757 2792 1 chr7B.!!$F1 1035
2 TraesCS7B01G253900 chr7B 687278860 687279894 1034 False 1740 1740 97.008 1757 2792 1 chr7B.!!$F4 1035
3 TraesCS7B01G253900 chr7B 112002324 112003279 955 True 1703 1703 98.849 1 955 1 chr7B.!!$R1 954
4 TraesCS7B01G253900 chr7B 707738513 707739475 962 True 1644 1644 97.614 1 955 1 chr7B.!!$R4 954
5 TraesCS7B01G253900 chr7B 474434582 474435322 740 True 1219 1219 96.356 956 1696 1 chr7B.!!$R3 740
6 TraesCS7B01G253900 chr7B 468052172 468052720 548 False 992 992 99.273 410 959 1 chr7B.!!$F2 549
7 TraesCS7B01G253900 chr7B 112008046 112008594 548 True 965 965 98.364 410 959 1 chr7B.!!$R2 549
8 TraesCS7B01G253900 chr5B 487407629 487408664 1035 True 1753 1753 97.201 1757 2792 1 chr5B.!!$R1 1035
9 TraesCS7B01G253900 chr5B 535370509 535371542 1033 False 1740 1740 97.008 1757 2792 1 chr5B.!!$F2 1035
10 TraesCS7B01G253900 chr4B 494988733 494989768 1035 False 1753 1753 97.201 1757 2792 1 chr4B.!!$F2 1035
11 TraesCS7B01G253900 chr4B 52418508 52419543 1035 False 1748 1748 97.104 1757 2792 1 chr4B.!!$F1 1035
12 TraesCS7B01G253900 chr6B 51515390 51516424 1034 False 1746 1746 97.107 1757 2792 1 chr6B.!!$F1 1035
13 TraesCS7B01G253900 chr2B 382939527 382940561 1034 False 1740 1740 97.008 1757 2792 1 chr2B.!!$F1 1035
14 TraesCS7B01G253900 chr1B 110569113 110570148 1035 True 1736 1736 96.911 1757 2792 1 chr1B.!!$R1 1035
15 TraesCS7B01G253900 chr7D 452140137 452140939 802 True 1362 1362 97.260 956 1758 1 chr7D.!!$R1 802
16 TraesCS7B01G253900 chr7A 545519742 545520553 811 False 1258 1258 94.828 956 1758 1 chr7A.!!$F1 802
17 TraesCS7B01G253900 chr1A 482328617 482329378 761 False 599 599 81.290 994 1749 1 chr1A.!!$F1 755
18 TraesCS7B01G253900 chr1D 382218990 382219756 766 False 597 597 81.105 998 1758 1 chr1D.!!$F1 760

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
598 608 1.066430 GTAACGGCAACAGGGAGATCA 60.066 52.381 0.0 0.0 0.0 2.92 F
1351 1373 2.684104 CCGTCTCCTCCCTCTCCA 59.316 66.667 0.0 0.0 0.0 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1497 1525 1.217244 GTTGACGGGGTGCTCGTAT 59.783 57.895 0.0 0.0 41.22 3.06 R
2277 2315 1.676635 TGCCTTGCCATGAGTCAGC 60.677 57.895 0.0 0.0 0.00 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
598 608 1.066430 GTAACGGCAACAGGGAGATCA 60.066 52.381 0.00 0.00 0.00 2.92
987 1001 5.981915 CACTGAGCTAGATTTCATTCGATCA 59.018 40.000 0.00 0.00 0.00 2.92
1351 1373 2.684104 CCGTCTCCTCCCTCTCCA 59.316 66.667 0.00 0.00 0.00 3.86
1531 1559 3.586892 GTCAACCAGAAGTACTACCAGC 58.413 50.000 0.00 0.00 0.00 4.85
1536 1564 2.691011 CCAGAAGTACTACCAGCCTCTC 59.309 54.545 0.00 0.00 0.00 3.20
1567 1595 1.154197 CTCCGGCGTCATCGACTATA 58.846 55.000 6.01 0.00 43.80 1.31
1900 1937 4.631813 CCCACTTGCACTAGAGTCAATAAC 59.368 45.833 0.00 0.00 0.00 1.89
2147 2184 5.106555 CGGATTAGTGTCAAAGTTTGCATCT 60.107 40.000 10.90 12.72 0.00 2.90
2254 2292 2.355108 CCGTTGTCCTGTGATCCATTCT 60.355 50.000 0.00 0.00 0.00 2.40
2277 2315 2.092914 GGATCACTCTTGTACCCCTTGG 60.093 54.545 0.00 0.00 37.80 3.61
2468 2506 8.627208 TTCTTTGCTGATCTATTTTGAACTCT 57.373 30.769 0.00 0.00 0.00 3.24
2489 2527 6.018180 ACTCTTTCAAAATCTTGTCACGGTAC 60.018 38.462 0.00 0.00 33.94 3.34
2639 2677 7.227314 TCCAGAAATTCTACATCATTTCCGATG 59.773 37.037 0.00 0.00 46.78 3.84
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
598 608 0.399949 TCCTGCCATACTTCCCCGAT 60.400 55.000 0.00 0.0 0.00 4.18
987 1001 1.376424 CGTCATGGCTGGCTCAACT 60.376 57.895 2.00 0.0 0.00 3.16
1265 1287 2.357034 CGGTGTTCTGGACGGTGG 60.357 66.667 0.00 0.0 0.00 4.61
1351 1373 1.209504 CCCGTACTGGTTGATCATGGT 59.790 52.381 0.00 0.0 35.15 3.55
1377 1399 2.598099 TAGTCCACGTCCACGCCA 60.598 61.111 0.00 0.0 44.43 5.69
1497 1525 1.217244 GTTGACGGGGTGCTCGTAT 59.783 57.895 0.00 0.0 41.22 3.06
2254 2292 2.915869 AGGGGTACAAGAGTGATCCAA 58.084 47.619 0.00 0.0 0.00 3.53
2277 2315 1.676635 TGCCTTGCCATGAGTCAGC 60.677 57.895 0.00 0.0 0.00 4.26
2468 2506 4.571580 ACGTACCGTGACAAGATTTTGAAA 59.428 37.500 2.48 0.0 39.18 2.69
2521 2559 9.970395 GAGCATCAAGATCTATAAGGATAGATG 57.030 37.037 11.29 0.0 43.86 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.