Multiple sequence alignment - TraesCS7B01G250900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G250900 chr7B 100.000 2507 0 0 1 2507 463193355 463190849 0 4630
1 TraesCS7B01G250900 chr7B 96.443 731 18 2 1778 2507 641774620 641775343 0 1199
2 TraesCS7B01G250900 chr7B 96.164 730 19 4 1778 2507 524000482 524001202 0 1184
3 TraesCS7B01G250900 chr3B 96.614 2510 70 9 2 2507 31751054 31753552 0 4150
4 TraesCS7B01G250900 chr6B 95.984 2515 83 8 1 2507 690200147 690197643 0 4069
5 TraesCS7B01G250900 chr6B 95.645 2388 76 8 1 2387 456798767 456801127 0 3808
6 TraesCS7B01G250900 chr5B 95.905 2515 82 10 1 2507 192447632 192450133 0 4054
7 TraesCS7B01G250900 chr5B 96.281 2124 65 8 1 2121 57469164 57467052 0 3472
8 TraesCS7B01G250900 chr5B 96.357 796 17 3 1713 2507 342384168 342384952 0 1299
9 TraesCS7B01G250900 chr2B 95.866 2516 79 15 1 2507 143026812 143024313 0 4047
10 TraesCS7B01G250900 chr2B 95.590 2517 81 16 1 2507 138500325 138502821 0 4006
11 TraesCS7B01G250900 chr4B 95.503 2513 93 9 4 2507 311864797 311862296 0 3997
12 TraesCS7B01G250900 chr4B 96.534 2337 70 11 1 2334 439641631 439643959 0 3856
13 TraesCS7B01G250900 chr1A 95.181 2490 82 13 3 2481 257591377 257588915 0 3899
14 TraesCS7B01G250900 chr7A 94.515 2516 88 16 1 2507 452019733 452022207 0 3836


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G250900 chr7B 463190849 463193355 2506 True 4630 4630 100.000 1 2507 1 chr7B.!!$R1 2506
1 TraesCS7B01G250900 chr7B 641774620 641775343 723 False 1199 1199 96.443 1778 2507 1 chr7B.!!$F2 729
2 TraesCS7B01G250900 chr7B 524000482 524001202 720 False 1184 1184 96.164 1778 2507 1 chr7B.!!$F1 729
3 TraesCS7B01G250900 chr3B 31751054 31753552 2498 False 4150 4150 96.614 2 2507 1 chr3B.!!$F1 2505
4 TraesCS7B01G250900 chr6B 690197643 690200147 2504 True 4069 4069 95.984 1 2507 1 chr6B.!!$R1 2506
5 TraesCS7B01G250900 chr6B 456798767 456801127 2360 False 3808 3808 95.645 1 2387 1 chr6B.!!$F1 2386
6 TraesCS7B01G250900 chr5B 192447632 192450133 2501 False 4054 4054 95.905 1 2507 1 chr5B.!!$F1 2506
7 TraesCS7B01G250900 chr5B 57467052 57469164 2112 True 3472 3472 96.281 1 2121 1 chr5B.!!$R1 2120
8 TraesCS7B01G250900 chr5B 342384168 342384952 784 False 1299 1299 96.357 1713 2507 1 chr5B.!!$F2 794
9 TraesCS7B01G250900 chr2B 143024313 143026812 2499 True 4047 4047 95.866 1 2507 1 chr2B.!!$R1 2506
10 TraesCS7B01G250900 chr2B 138500325 138502821 2496 False 4006 4006 95.590 1 2507 1 chr2B.!!$F1 2506
11 TraesCS7B01G250900 chr4B 311862296 311864797 2501 True 3997 3997 95.503 4 2507 1 chr4B.!!$R1 2503
12 TraesCS7B01G250900 chr4B 439641631 439643959 2328 False 3856 3856 96.534 1 2334 1 chr4B.!!$F1 2333
13 TraesCS7B01G250900 chr1A 257588915 257591377 2462 True 3899 3899 95.181 3 2481 1 chr1A.!!$R1 2478
14 TraesCS7B01G250900 chr7A 452019733 452022207 2474 False 3836 3836 94.515 1 2507 1 chr7A.!!$F1 2506

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
940 957 0.250295 CTGTTTCTTCCACTCGGGCA 60.25 55.0 0.0 0.0 36.21 5.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2337 2382 2.606108 GCTAATTGGCGTGGGAAAAAG 58.394 47.619 0.0 0.0 0.0 2.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
206 211 8.704668 TCTGAAAATGTTCATAGGTGATAGCTA 58.295 33.333 0.00 0.00 42.85 3.32
207 212 9.499479 CTGAAAATGTTCATAGGTGATAGCTAT 57.501 33.333 5.76 5.76 42.85 2.97
533 548 2.914941 ACCCTAATAACCCCGTTGACTT 59.085 45.455 0.00 0.00 0.00 3.01
600 615 0.824109 CCGTCAGATCCTACCAAGCA 59.176 55.000 0.00 0.00 0.00 3.91
909 926 5.337169 CCATCTTCTCGTTCTTCTTCCTCTT 60.337 44.000 0.00 0.00 0.00 2.85
932 949 2.439507 AGCAACTCCTCTGTTTCTTCCA 59.560 45.455 0.00 0.00 0.00 3.53
940 957 0.250295 CTGTTTCTTCCACTCGGGCA 60.250 55.000 0.00 0.00 36.21 5.36
1365 1384 1.684734 AGCACGTCCGGAATACCCT 60.685 57.895 5.23 0.00 0.00 4.34
1392 1417 4.682860 GTGTTCGAACTGAAGACGGAATTA 59.317 41.667 27.32 0.52 40.53 1.40
1533 1559 1.961793 TGTCTACTGTTGTTGCCACC 58.038 50.000 0.00 0.00 0.00 4.61
1566 1592 7.636150 ATCCAAGTCTGTTTATCTCAAATGG 57.364 36.000 0.00 0.00 0.00 3.16
1635 1661 5.151632 TGTTAAGTTTCGACACTTTCAGC 57.848 39.130 21.08 7.98 38.07 4.26
1857 1885 2.966732 TTCGCGGGCCCAAAGAGAT 61.967 57.895 24.92 0.00 0.00 2.75
2100 2145 3.697619 AGGAAAAAGAGGTCTAACCCG 57.302 47.619 0.00 0.00 39.75 5.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
533 548 0.326595 TTTCTGCGGGGTTATGAGCA 59.673 50.000 0.00 0.00 38.03 4.26
600 615 0.762418 TCTGACGGGTGGTGTTTGAT 59.238 50.000 0.00 0.00 0.00 2.57
909 926 3.495100 GGAAGAAACAGAGGAGTTGCTCA 60.495 47.826 3.47 0.00 36.35 4.26
932 949 0.104304 GGTCGACATATTGCCCGAGT 59.896 55.000 18.91 0.00 0.00 4.18
1365 1384 2.602933 CGTCTTCAGTTCGAACACCGTA 60.603 50.000 28.78 9.52 39.75 4.02
1392 1417 7.557719 TCCTTGAAGTTCTTGTTCATCTTCTTT 59.442 33.333 4.17 0.00 36.49 2.52
1501 1527 7.497595 ACAACAGTAGACAAACATCTCTAACA 58.502 34.615 0.00 0.00 0.00 2.41
1533 1559 4.749245 AACAGACTTGGATTGCTAAACG 57.251 40.909 0.00 0.00 0.00 3.60
1566 1592 4.318121 CGACAGTTGCACTAAACAGAGTTC 60.318 45.833 0.00 0.00 32.21 3.01
1635 1661 4.097892 ACTGGTAGTTGTTTTCTGCCAAAG 59.902 41.667 4.56 0.00 44.42 2.77
1832 1860 4.091939 GGGCCCGCGAACTAGGTT 62.092 66.667 5.69 0.00 0.00 3.50
2337 2382 2.606108 GCTAATTGGCGTGGGAAAAAG 58.394 47.619 0.00 0.00 0.00 2.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.