Multiple sequence alignment - TraesCS7B01G246400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G246400 chr7B 100.000 2450 0 0 1 2450 456122105 456124554 0.000000e+00 4525
1 TraesCS7B01G246400 chr7B 96.857 2450 72 2 1 2450 638611652 638609208 0.000000e+00 4093
2 TraesCS7B01G246400 chr7B 92.731 2490 135 27 1 2450 360407655 360405172 0.000000e+00 3554
3 TraesCS7B01G246400 chr3B 95.267 2451 114 2 1 2450 331024950 331027399 0.000000e+00 3882
4 TraesCS7B01G246400 chr3B 92.505 2455 167 13 1 2450 533671479 533669037 0.000000e+00 3498
5 TraesCS7B01G246400 chr3B 90.000 1210 90 22 1270 2450 361554921 361556128 0.000000e+00 1535
6 TraesCS7B01G246400 chr1B 93.188 2481 133 24 1 2450 367658329 367660804 0.000000e+00 3613
7 TraesCS7B01G246400 chr4B 92.724 2474 150 21 1 2450 451467493 451469960 0.000000e+00 3544
8 TraesCS7B01G246400 chr5B 92.410 2490 142 29 1 2450 333648411 333650893 0.000000e+00 3507
9 TraesCS7B01G246400 chr5B 92.053 2479 152 28 1 2441 373340473 373342944 0.000000e+00 3445
10 TraesCS7B01G246400 chr5B 91.966 2477 158 25 1 2441 373348572 373351043 0.000000e+00 3434
11 TraesCS7B01G246400 chr2B 87.114 2491 265 43 1 2450 762706224 762708699 0.000000e+00 2771
12 TraesCS7B01G246400 chr2B 89.777 1301 89 29 1180 2450 405162903 405164189 0.000000e+00 1626
13 TraesCS7B01G246400 chr2B 89.474 285 20 7 2155 2437 545609926 545609650 3.880000e-93 351
14 TraesCS7B01G246400 chr2B 85.950 242 25 7 2209 2450 465449102 465448870 1.450000e-62 250
15 TraesCS7B01G246400 chr2B 90.728 151 8 6 2300 2450 556547133 556547277 1.920000e-46 196


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G246400 chr7B 456122105 456124554 2449 False 4525 4525 100.000 1 2450 1 chr7B.!!$F1 2449
1 TraesCS7B01G246400 chr7B 638609208 638611652 2444 True 4093 4093 96.857 1 2450 1 chr7B.!!$R2 2449
2 TraesCS7B01G246400 chr7B 360405172 360407655 2483 True 3554 3554 92.731 1 2450 1 chr7B.!!$R1 2449
3 TraesCS7B01G246400 chr3B 331024950 331027399 2449 False 3882 3882 95.267 1 2450 1 chr3B.!!$F1 2449
4 TraesCS7B01G246400 chr3B 533669037 533671479 2442 True 3498 3498 92.505 1 2450 1 chr3B.!!$R1 2449
5 TraesCS7B01G246400 chr3B 361554921 361556128 1207 False 1535 1535 90.000 1270 2450 1 chr3B.!!$F2 1180
6 TraesCS7B01G246400 chr1B 367658329 367660804 2475 False 3613 3613 93.188 1 2450 1 chr1B.!!$F1 2449
7 TraesCS7B01G246400 chr4B 451467493 451469960 2467 False 3544 3544 92.724 1 2450 1 chr4B.!!$F1 2449
8 TraesCS7B01G246400 chr5B 333648411 333650893 2482 False 3507 3507 92.410 1 2450 1 chr5B.!!$F1 2449
9 TraesCS7B01G246400 chr5B 373340473 373342944 2471 False 3445 3445 92.053 1 2441 1 chr5B.!!$F2 2440
10 TraesCS7B01G246400 chr5B 373348572 373351043 2471 False 3434 3434 91.966 1 2441 1 chr5B.!!$F3 2440
11 TraesCS7B01G246400 chr2B 762706224 762708699 2475 False 2771 2771 87.114 1 2450 1 chr2B.!!$F3 2449
12 TraesCS7B01G246400 chr2B 405162903 405164189 1286 False 1626 1626 89.777 1180 2450 1 chr2B.!!$F1 1270

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
958 960 1.536766 CGCATTTGCCCATCGTCATAT 59.463 47.619 0.0 0.0 37.91 1.78 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2082 2092 2.954318 GCTACCAGATTTCACATGCCAT 59.046 45.455 0.0 0.0 0.0 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
224 226 3.967326 TCTCATCCTCCCGATTGTTATGT 59.033 43.478 0.00 0.00 0.00 2.29
235 237 4.571984 CCGATTGTTATGTCATGAGCTTCA 59.428 41.667 0.00 0.00 0.00 3.02
407 409 7.944729 ACTATGCTCCACAACAGATTTATTT 57.055 32.000 0.00 0.00 0.00 1.40
588 590 3.244700 CCGAAGATGATCCAATTAGGCCT 60.245 47.826 11.78 11.78 37.29 5.19
757 759 3.383185 GGTTCCAACACCTTCACATTCAA 59.617 43.478 0.00 0.00 33.50 2.69
904 906 9.766277 CATCTATTACTCTTGAAGAAGCAAAAC 57.234 33.333 0.00 0.00 0.00 2.43
932 934 7.664731 AGTTGATGTGATTGAAGATGAAGAACT 59.335 33.333 0.00 0.00 0.00 3.01
958 960 1.536766 CGCATTTGCCCATCGTCATAT 59.463 47.619 0.00 0.00 37.91 1.78
1045 1047 6.316140 TGCTGCTACTTTCCATTGTGTTATAG 59.684 38.462 0.00 0.00 0.00 1.31
1054 1056 9.241317 CTTTCCATTGTGTTATAGCATCAATTC 57.759 33.333 11.70 0.00 0.00 2.17
2004 2014 6.403866 TGATTCCTGTTTTTGTGCTTATGT 57.596 33.333 0.00 0.00 0.00 2.29
2082 2092 1.567357 TGTCATGTTCCCTGGATCGA 58.433 50.000 0.00 0.00 0.00 3.59
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
74 75 5.339282 GGCCTATCCTCAAAAACTACCTCTT 60.339 44.000 0.00 0.0 0.00 2.85
182 183 3.064207 GAGTAACCACGCTGACATTCAA 58.936 45.455 0.00 0.0 0.00 2.69
224 226 0.325933 CTGTGGGGTGAAGCTCATGA 59.674 55.000 0.00 0.0 0.00 3.07
235 237 0.031111 TATGAGCTAGGCTGTGGGGT 60.031 55.000 0.00 0.0 39.88 4.95
407 409 6.715718 GTGTTGAGGTATATGAGTAGGAGCTA 59.284 42.308 0.00 0.0 0.00 3.32
588 590 8.595362 TCTTCTTCATTTCCTCTAGTATCACA 57.405 34.615 0.00 0.0 0.00 3.58
757 759 2.357637 GACTCTCGCTATCTTGCTCAGT 59.642 50.000 0.00 0.0 0.00 3.41
904 906 7.813645 TCTTCATCTTCAATCACATCAACTTG 58.186 34.615 0.00 0.0 0.00 3.16
932 934 1.400142 CGATGGGCAAATGCGTTTCTA 59.600 47.619 0.00 0.0 43.26 2.10
958 960 5.927281 AAACCTACTAAATCACGCTCCTA 57.073 39.130 0.00 0.0 0.00 2.94
1054 1056 7.588512 AGCAAATACTTTTTCAAGTCTAGCTG 58.411 34.615 0.00 0.0 42.66 4.24
1564 1568 1.468914 GAAACATCTCACCGGGCTTTC 59.531 52.381 6.32 0.0 0.00 2.62
2082 2092 2.954318 GCTACCAGATTTCACATGCCAT 59.046 45.455 0.00 0.0 0.00 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.