Multiple sequence alignment - TraesCS7B01G230900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G230900 chr7B 100.000 3074 0 0 1 3074 433492484 433495557 0 5677
1 TraesCS7B01G230900 chr7B 98.276 3074 53 0 1 3074 584381634 584378561 0 5384
2 TraesCS7B01G230900 chr1B 98.439 3074 48 0 1 3074 100183840 100180767 0 5411
3 TraesCS7B01G230900 chr2B 98.406 3074 48 1 1 3074 354910236 354913308 0 5404
4 TraesCS7B01G230900 chr2B 98.016 3074 61 0 1 3074 97179867 97176794 0 5339
5 TraesCS7B01G230900 chr4B 98.243 3074 54 0 1 3074 168180472 168177399 0 5378
6 TraesCS7B01G230900 chr7A 98.146 3074 57 0 1 3074 558127145 558124072 0 5361
7 TraesCS7B01G230900 chr7A 97.983 3074 62 0 1 3074 306360520 306363593 0 5334
8 TraesCS7B01G230900 chr3A 98.079 3072 57 1 3 3074 583867320 583864251 0 5345
9 TraesCS7B01G230900 chr3A 98.016 3074 59 1 1 3074 719226195 719229266 0 5337


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G230900 chr7B 433492484 433495557 3073 False 5677 5677 100.000 1 3074 1 chr7B.!!$F1 3073
1 TraesCS7B01G230900 chr7B 584378561 584381634 3073 True 5384 5384 98.276 1 3074 1 chr7B.!!$R1 3073
2 TraesCS7B01G230900 chr1B 100180767 100183840 3073 True 5411 5411 98.439 1 3074 1 chr1B.!!$R1 3073
3 TraesCS7B01G230900 chr2B 354910236 354913308 3072 False 5404 5404 98.406 1 3074 1 chr2B.!!$F1 3073
4 TraesCS7B01G230900 chr2B 97176794 97179867 3073 True 5339 5339 98.016 1 3074 1 chr2B.!!$R1 3073
5 TraesCS7B01G230900 chr4B 168177399 168180472 3073 True 5378 5378 98.243 1 3074 1 chr4B.!!$R1 3073
6 TraesCS7B01G230900 chr7A 558124072 558127145 3073 True 5361 5361 98.146 1 3074 1 chr7A.!!$R1 3073
7 TraesCS7B01G230900 chr7A 306360520 306363593 3073 False 5334 5334 97.983 1 3074 1 chr7A.!!$F1 3073
8 TraesCS7B01G230900 chr3A 583864251 583867320 3069 True 5345 5345 98.079 3 3074 1 chr3A.!!$R1 3071
9 TraesCS7B01G230900 chr3A 719226195 719229266 3071 False 5337 5337 98.016 1 3074 1 chr3A.!!$F1 3073

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
326 327 1.000496 GTCTTCGTGGTCGAGTCCTTT 60.0 52.381 0.0 0.0 46.81 3.11 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2269 2272 0.034283 GTGGTACGACCTCCTCCTCT 60.034 60.0 0.0 0.0 39.58 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
326 327 1.000496 GTCTTCGTGGTCGAGTCCTTT 60.000 52.381 0.00 0.00 46.81 3.11
796 797 4.445545 CCGCTTTCTTCGCCACGC 62.446 66.667 0.00 0.00 0.00 5.34
1359 1362 1.878953 CGCAACTCCACCACTTTACT 58.121 50.000 0.00 0.00 0.00 2.24
1631 1634 1.959985 CTACTGCCAGGATCAGTCGAT 59.040 52.381 3.12 0.00 43.13 3.59
1668 1671 3.773119 GTGGACTCCCTCAGTTTACCATA 59.227 47.826 0.00 0.00 34.41 2.74
2134 2137 1.105167 CGATGCCCAATGGAGCACAT 61.105 55.000 15.71 7.08 42.84 3.21
2269 2272 2.628178 TGCTGAAGACGAGGAAGAAGAA 59.372 45.455 0.00 0.00 0.00 2.52
2672 2675 5.444176 ACCAGGTACTATACTCTTAACGCT 58.556 41.667 0.00 0.00 36.02 5.07
2715 2718 9.874205 CTTATGATCTCTAATCCTGATTCTTCC 57.126 37.037 0.00 0.00 32.50 3.46
2717 2720 5.545723 TGATCTCTAATCCTGATTCTTCCCC 59.454 44.000 0.00 0.00 32.50 4.81
2747 2750 4.766891 CCACCCAATGTTGTTATCACTCTT 59.233 41.667 0.00 0.00 0.00 2.85
2930 2933 2.596851 GCAGCCCTCCCTCTTCACA 61.597 63.158 0.00 0.00 0.00 3.58
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
165 166 5.586155 TGTCCCTTAAACCCTTCATTACA 57.414 39.130 0.00 0.0 0.00 2.41
326 327 2.040012 AGGGACTCACTCGACTGACTTA 59.960 50.000 0.00 0.0 0.00 2.24
796 797 0.464373 ACAGTTATGCAGGCGGGATG 60.464 55.000 1.26 0.0 0.00 3.51
915 918 1.134848 CGAAGGGAGCAGAGAAAGAGG 60.135 57.143 0.00 0.0 0.00 3.69
1359 1362 4.618460 GCAAGATAGGCGATAGAATTCGGA 60.618 45.833 0.00 0.0 39.49 4.55
1668 1671 1.122019 AGGGCTTGTTCACTCGGTCT 61.122 55.000 0.00 0.0 0.00 3.85
2269 2272 0.034283 GTGGTACGACCTCCTCCTCT 60.034 60.000 0.00 0.0 39.58 3.69
2715 2718 1.153168 CATTGGGTGGAGCTACGGG 60.153 63.158 0.00 0.0 0.00 5.28
2717 2720 1.086696 CAACATTGGGTGGAGCTACG 58.913 55.000 0.00 0.0 0.00 3.51
2747 2750 5.152934 TCCTCATCTTCATCATCATCAGGA 58.847 41.667 0.00 0.0 0.00 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.