Multiple sequence alignment - TraesCS7B01G210300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G210300 chr7B 100.000 2450 0 0 1 2450 383862873 383865322 0.000000e+00 4525
1 TraesCS7B01G210300 chr7B 95.061 1721 67 9 733 2450 456122837 456124542 0.000000e+00 2691
2 TraesCS7B01G210300 chr7B 93.582 1745 79 21 733 2450 360406922 360405184 0.000000e+00 2571
3 TraesCS7B01G210300 chr7B 96.859 796 19 6 1 793 242314525 242315317 0.000000e+00 1327
4 TraesCS7B01G210300 chr7B 96.738 797 20 6 1 794 246677902 246677109 0.000000e+00 1323
5 TraesCS7B01G210300 chr7B 96.509 802 22 6 1 799 242306589 242305791 0.000000e+00 1321
6 TraesCS7B01G210300 chr3B 94.306 1721 80 9 733 2450 331025682 331027387 0.000000e+00 2619
7 TraesCS7B01G210300 chr3B 91.826 1725 110 23 733 2449 74829986 74828285 0.000000e+00 2375
8 TraesCS7B01G210300 chr3B 88.208 1730 163 21 733 2450 128994970 128993270 0.000000e+00 2026
9 TraesCS7B01G210300 chr3B 89.212 1205 97 23 1270 2450 361554921 361556116 0.000000e+00 1474
10 TraesCS7B01G210300 chr3B 87.330 1247 117 28 1232 2450 40496448 40497681 0.000000e+00 1389
11 TraesCS7B01G210300 chr3B 87.334 1208 112 27 1270 2450 284885577 284884384 0.000000e+00 1345
12 TraesCS7B01G210300 chr3B 96.859 796 21 4 1 794 51347672 51348465 0.000000e+00 1328
13 TraesCS7B01G210300 chr3B 96.863 797 19 6 1 794 682015705 682014912 0.000000e+00 1328
14 TraesCS7B01G210300 chr3B 87.302 945 85 25 1536 2450 115674057 115673118 0.000000e+00 1048
15 TraesCS7B01G210300 chr5B 93.291 1744 85 22 733 2450 373341204 373342941 0.000000e+00 2543
16 TraesCS7B01G210300 chr5B 93.177 1744 87 22 733 2450 373349303 373351040 0.000000e+00 2532
17 TraesCS7B01G210300 chr5B 92.559 1747 93 26 733 2450 333649143 333650881 0.000000e+00 2471
18 TraesCS7B01G210300 chr5B 94.967 1530 66 8 733 2257 373353841 373355364 0.000000e+00 2388
19 TraesCS7B01G210300 chr5B 98.536 1298 19 0 1 1298 693804920 693803623 0.000000e+00 2292
20 TraesCS7B01G210300 chr5B 96.863 797 19 6 1 794 586880923 586881716 0.000000e+00 1328
21 TraesCS7B01G210300 chr4B 91.420 1725 130 12 733 2450 569592799 569594512 0.000000e+00 2350
22 TraesCS7B01G210300 chr4B 96.863 797 19 6 1 794 78829883 78829090 0.000000e+00 1328
23 TraesCS7B01G210300 chr4B 96.855 795 23 2 1 794 338722563 338721770 0.000000e+00 1328
24 TraesCS7B01G210300 chr4B 96.612 797 21 5 1 794 447261976 447261183 0.000000e+00 1317
25 TraesCS7B01G210300 chr4B 94.486 798 35 9 1 794 567678884 567679676 0.000000e+00 1221
26 TraesCS7B01G210300 chr1B 97.240 797 16 6 1 794 406437623 406438416 0.000000e+00 1345
27 TraesCS7B01G210300 chr1B 96.863 797 19 6 1 794 106887372 106888165 0.000000e+00 1328
28 TraesCS7B01G210300 chr7D 96.478 795 19 7 1 793 290731797 290731010 0.000000e+00 1304
29 TraesCS7B01G210300 chr6D 95.358 797 28 7 1 794 307416094 307415304 0.000000e+00 1258
30 TraesCS7B01G210300 chr6D 93.609 798 43 8 1 794 283635822 283635029 0.000000e+00 1184
31 TraesCS7B01G210300 chr3A 84.252 1270 154 28 1198 2450 388270431 388271671 0.000000e+00 1195
32 TraesCS7B01G210300 chr4D 92.481 798 53 7 1 794 272408124 272408918 0.000000e+00 1134
33 TraesCS7B01G210300 chr2B 87.285 291 22 8 2160 2449 545609926 545609650 3.930000e-83 318
34 TraesCS7B01G210300 chr2B 84.848 231 25 8 2220 2450 465449102 465448882 8.820000e-55 224


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G210300 chr7B 383862873 383865322 2449 False 4525 4525 100.000 1 2450 1 chr7B.!!$F2 2449
1 TraesCS7B01G210300 chr7B 456122837 456124542 1705 False 2691 2691 95.061 733 2450 1 chr7B.!!$F3 1717
2 TraesCS7B01G210300 chr7B 360405184 360406922 1738 True 2571 2571 93.582 733 2450 1 chr7B.!!$R3 1717
3 TraesCS7B01G210300 chr7B 242314525 242315317 792 False 1327 1327 96.859 1 793 1 chr7B.!!$F1 792
4 TraesCS7B01G210300 chr7B 246677109 246677902 793 True 1323 1323 96.738 1 794 1 chr7B.!!$R2 793
5 TraesCS7B01G210300 chr7B 242305791 242306589 798 True 1321 1321 96.509 1 799 1 chr7B.!!$R1 798
6 TraesCS7B01G210300 chr3B 331025682 331027387 1705 False 2619 2619 94.306 733 2450 1 chr3B.!!$F3 1717
7 TraesCS7B01G210300 chr3B 74828285 74829986 1701 True 2375 2375 91.826 733 2449 1 chr3B.!!$R1 1716
8 TraesCS7B01G210300 chr3B 128993270 128994970 1700 True 2026 2026 88.208 733 2450 1 chr3B.!!$R3 1717
9 TraesCS7B01G210300 chr3B 361554921 361556116 1195 False 1474 1474 89.212 1270 2450 1 chr3B.!!$F4 1180
10 TraesCS7B01G210300 chr3B 40496448 40497681 1233 False 1389 1389 87.330 1232 2450 1 chr3B.!!$F1 1218
11 TraesCS7B01G210300 chr3B 284884384 284885577 1193 True 1345 1345 87.334 1270 2450 1 chr3B.!!$R4 1180
12 TraesCS7B01G210300 chr3B 51347672 51348465 793 False 1328 1328 96.859 1 794 1 chr3B.!!$F2 793
13 TraesCS7B01G210300 chr3B 682014912 682015705 793 True 1328 1328 96.863 1 794 1 chr3B.!!$R5 793
14 TraesCS7B01G210300 chr3B 115673118 115674057 939 True 1048 1048 87.302 1536 2450 1 chr3B.!!$R2 914
15 TraesCS7B01G210300 chr5B 373341204 373342941 1737 False 2543 2543 93.291 733 2450 1 chr5B.!!$F2 1717
16 TraesCS7B01G210300 chr5B 333649143 333650881 1738 False 2471 2471 92.559 733 2450 1 chr5B.!!$F1 1717
17 TraesCS7B01G210300 chr5B 373349303 373355364 6061 False 2460 2532 94.072 733 2450 2 chr5B.!!$F4 1717
18 TraesCS7B01G210300 chr5B 693803623 693804920 1297 True 2292 2292 98.536 1 1298 1 chr5B.!!$R1 1297
19 TraesCS7B01G210300 chr5B 586880923 586881716 793 False 1328 1328 96.863 1 794 1 chr5B.!!$F3 793
20 TraesCS7B01G210300 chr4B 569592799 569594512 1713 False 2350 2350 91.420 733 2450 1 chr4B.!!$F2 1717
21 TraesCS7B01G210300 chr4B 78829090 78829883 793 True 1328 1328 96.863 1 794 1 chr4B.!!$R1 793
22 TraesCS7B01G210300 chr4B 338721770 338722563 793 True 1328 1328 96.855 1 794 1 chr4B.!!$R2 793
23 TraesCS7B01G210300 chr4B 447261183 447261976 793 True 1317 1317 96.612 1 794 1 chr4B.!!$R3 793
24 TraesCS7B01G210300 chr4B 567678884 567679676 792 False 1221 1221 94.486 1 794 1 chr4B.!!$F1 793
25 TraesCS7B01G210300 chr1B 406437623 406438416 793 False 1345 1345 97.240 1 794 1 chr1B.!!$F2 793
26 TraesCS7B01G210300 chr1B 106887372 106888165 793 False 1328 1328 96.863 1 794 1 chr1B.!!$F1 793
27 TraesCS7B01G210300 chr7D 290731010 290731797 787 True 1304 1304 96.478 1 793 1 chr7D.!!$R1 792
28 TraesCS7B01G210300 chr6D 307415304 307416094 790 True 1258 1258 95.358 1 794 1 chr6D.!!$R2 793
29 TraesCS7B01G210300 chr6D 283635029 283635822 793 True 1184 1184 93.609 1 794 1 chr6D.!!$R1 793
30 TraesCS7B01G210300 chr3A 388270431 388271671 1240 False 1195 1195 84.252 1198 2450 1 chr3A.!!$F1 1252
31 TraesCS7B01G210300 chr4D 272408124 272408918 794 False 1134 1134 92.481 1 794 1 chr4D.!!$F1 793

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
237 238 0.533491 TTGCAAGCCATCTGCAATCC 59.467 50.0 6.15 0.0 42.65 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1529 1532 1.476891 GCTCGATCACCTCACCAACTA 59.523 52.381 0.0 0.0 0.0 2.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
237 238 0.533491 TTGCAAGCCATCTGCAATCC 59.467 50.000 6.15 0.00 42.65 3.01
440 441 5.887598 CCATTGTAGATCAGATGGAAACCAA 59.112 40.000 9.70 0.00 36.95 3.67
873 875 7.338800 ACAACAAAGTGATCAAGTTGAAGAT 57.661 32.000 25.52 10.38 41.41 2.40
925 927 9.472361 CAAAAGAAGTTGATGTGATTGAAGATT 57.528 29.630 0.00 0.00 0.00 2.40
1114 1116 4.888326 ACATACATTGTTGGTGGCATTT 57.112 36.364 0.00 0.00 33.74 2.32
1260 1262 5.880332 TGCTGATTTCTACCATCCTAAACAC 59.120 40.000 0.00 0.00 0.00 3.32
1529 1532 1.063183 AGCAAAAGGAGAGGAGCTGT 58.937 50.000 0.00 0.00 0.00 4.40
1827 1849 8.311836 TCAAATCCCTAGTACACTAGAAAACTG 58.688 37.037 16.34 8.84 46.80 3.16
2010 2034 9.187996 TGATGATTCCTATTTTTGTGCTTATGA 57.812 29.630 0.00 0.00 0.00 2.15
2205 2234 3.028130 TCCTTTGGGGAGACAAACAAAC 58.972 45.455 0.00 0.00 39.58 2.93
2206 2235 3.031013 CCTTTGGGGAGACAAACAAACT 58.969 45.455 0.00 0.00 35.57 2.66
2207 2236 4.079672 TCCTTTGGGGAGACAAACAAACTA 60.080 41.667 0.00 0.00 39.58 2.24
2270 2310 0.462375 CGGGATCGGTGGTATGTTCA 59.538 55.000 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
440 441 5.221803 CCATGAGGTATTGGATCTGCTACTT 60.222 44.000 0.0 0.0 0.00 2.24
873 875 9.539825 GCTTCTTCAAGAGTAATAGATGATGAA 57.460 33.333 0.0 0.0 34.80 2.57
925 927 3.305064 GGCAAATGCGTTTCTGGTTCTTA 60.305 43.478 0.0 0.0 43.26 2.10
1529 1532 1.476891 GCTCGATCACCTCACCAACTA 59.523 52.381 0.0 0.0 0.00 2.24
1827 1849 6.842163 TCGAGGTAAAAGCAGAAAATGATTC 58.158 36.000 0.0 0.0 36.22 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.