Multiple sequence alignment - TraesCS7B01G200500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G200500 chr7B 100.000 2455 0 0 1 2455 364047962 364045508 0.000000e+00 4534
1 TraesCS7B01G200500 chr7B 85.341 1187 131 24 741 1901 484921948 484923117 0.000000e+00 1188
2 TraesCS7B01G200500 chr7B 84.763 1201 133 29 741 1914 484916676 484917853 0.000000e+00 1158
3 TraesCS7B01G200500 chr7B 87.967 482 48 7 2 480 484906251 484906725 5.930000e-156 560
4 TraesCS7B01G200500 chr6B 98.395 1246 16 1 1 1242 157562841 157561596 0.000000e+00 2187
5 TraesCS7B01G200500 chr6B 98.710 1163 14 1 1280 2442 157561598 157560437 0.000000e+00 2063
6 TraesCS7B01G200500 chr6B 85.097 879 111 13 996 1863 650659432 650660301 0.000000e+00 880
7 TraesCS7B01G200500 chr1A 88.831 1737 105 36 741 2453 583931884 583930213 0.000000e+00 2050
8 TraesCS7B01G200500 chr1A 93.412 425 24 3 40 460 583932934 583932510 5.760000e-176 627
9 TraesCS7B01G200500 chr1A 90.794 315 20 5 436 748 583932319 583932012 1.760000e-111 412
10 TraesCS7B01G200500 chr4B 90.694 1354 104 11 741 2077 248909443 248910791 0.000000e+00 1783
11 TraesCS7B01G200500 chr4B 84.833 1200 132 26 741 1914 546667497 546668672 0.000000e+00 1162
12 TraesCS7B01G200500 chr4B 92.400 750 48 7 3 748 248908571 248909315 0.000000e+00 1061
13 TraesCS7B01G200500 chr4B 89.027 483 42 6 2 480 546665807 546666282 2.720000e-164 588
14 TraesCS7B01G200500 chr4B 89.275 345 30 4 2113 2455 249012597 249012936 2.260000e-115 425
15 TraesCS7B01G200500 chr2B 90.944 1049 74 9 835 1866 426777431 426778475 0.000000e+00 1391
16 TraesCS7B01G200500 chr2B 91.322 749 54 8 1 745 426775702 426776443 0.000000e+00 1013
17 TraesCS7B01G200500 chr2B 89.349 338 28 5 2121 2455 426778787 426779119 3.780000e-113 418
18 TraesCS7B01G200500 chr2B 89.732 224 19 3 1865 2085 426778558 426778780 1.440000e-72 283
19 TraesCS7B01G200500 chr2A 84.836 1187 137 24 741 1901 655659397 655660566 0.000000e+00 1155
20 TraesCS7B01G200500 chr2A 87.967 482 48 7 2 480 655657437 655657911 5.930000e-156 560
21 TraesCS7B01G200500 chr4A 94.000 750 41 4 2 748 225312036 225312784 0.000000e+00 1133
22 TraesCS7B01G200500 chr4A 89.421 605 43 8 1853 2455 225314711 225315296 0.000000e+00 743
23 TraesCS7B01G200500 chr6D 82.620 1191 139 28 1291 2455 395359410 395358262 0.000000e+00 990
24 TraesCS7B01G200500 chr6D 82.049 1181 150 22 1297 2455 395345284 395344144 0.000000e+00 950
25 TraesCS7B01G200500 chr6D 81.626 1181 155 23 1297 2455 395338283 395337143 0.000000e+00 922
26 TraesCS7B01G200500 chr6D 81.626 1181 153 24 1297 2455 395348966 395347828 0.000000e+00 920
27 TraesCS7B01G200500 chr6D 81.485 1172 156 21 1297 2447 395347124 395345993 0.000000e+00 905
28 TraesCS7B01G200500 chr6D 81.929 985 116 22 1493 2455 395341778 395340834 0.000000e+00 776
29 TraesCS7B01G200500 chr6D 89.081 577 51 9 2 573 395368720 395368151 0.000000e+00 706
30 TraesCS7B01G200500 chr6D 81.465 437 56 12 2032 2455 395339408 395338984 3.910000e-88 335
31 TraesCS7B01G200500 chr1B 84.539 802 97 20 741 1526 286976578 286977368 0.000000e+00 769
32 TraesCS7B01G200500 chr6A 88.048 251 22 4 2093 2342 169502159 169502402 8.590000e-75 291
33 TraesCS7B01G200500 chr6A 93.388 121 7 1 2335 2455 169503313 169503432 6.980000e-41 178
34 TraesCS7B01G200500 chr3A 91.163 215 16 2 1864 2076 149424954 149424741 3.090000e-74 289


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G200500 chr7B 364045508 364047962 2454 True 4534.000000 4534 100.000000 1 2455 1 chr7B.!!$R1 2454
1 TraesCS7B01G200500 chr7B 484921948 484923117 1169 False 1188.000000 1188 85.341000 741 1901 1 chr7B.!!$F3 1160
2 TraesCS7B01G200500 chr7B 484916676 484917853 1177 False 1158.000000 1158 84.763000 741 1914 1 chr7B.!!$F2 1173
3 TraesCS7B01G200500 chr6B 157560437 157562841 2404 True 2125.000000 2187 98.552500 1 2442 2 chr6B.!!$R1 2441
4 TraesCS7B01G200500 chr6B 650659432 650660301 869 False 880.000000 880 85.097000 996 1863 1 chr6B.!!$F1 867
5 TraesCS7B01G200500 chr1A 583930213 583932934 2721 True 1029.666667 2050 91.012333 40 2453 3 chr1A.!!$R1 2413
6 TraesCS7B01G200500 chr4B 248908571 248910791 2220 False 1422.000000 1783 91.547000 3 2077 2 chr4B.!!$F2 2074
7 TraesCS7B01G200500 chr4B 546665807 546668672 2865 False 875.000000 1162 86.930000 2 1914 2 chr4B.!!$F3 1912
8 TraesCS7B01G200500 chr2B 426775702 426779119 3417 False 776.250000 1391 90.336750 1 2455 4 chr2B.!!$F1 2454
9 TraesCS7B01G200500 chr2A 655657437 655660566 3129 False 857.500000 1155 86.401500 2 1901 2 chr2A.!!$F1 1899
10 TraesCS7B01G200500 chr4A 225312036 225315296 3260 False 938.000000 1133 91.710500 2 2455 2 chr4A.!!$F1 2453
11 TraesCS7B01G200500 chr6D 395358262 395359410 1148 True 990.000000 990 82.620000 1291 2455 1 chr6D.!!$R1 1164
12 TraesCS7B01G200500 chr6D 395337143 395348966 11823 True 801.333333 950 81.696667 1297 2455 6 chr6D.!!$R3 1158
13 TraesCS7B01G200500 chr6D 395368151 395368720 569 True 706.000000 706 89.081000 2 573 1 chr6D.!!$R2 571
14 TraesCS7B01G200500 chr1B 286976578 286977368 790 False 769.000000 769 84.539000 741 1526 1 chr1B.!!$F1 785
15 TraesCS7B01G200500 chr6A 169502159 169503432 1273 False 234.500000 291 90.718000 2093 2455 2 chr6A.!!$F1 362

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
703 2154 1.735571 GCGGAGAACGGCTCATTTTTA 59.264 47.619 9.35 0.0 45.81 1.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2370 15323 1.282738 TCTCTTGATCAATGCCTGGCA 59.717 47.619 25.65 25.65 44.86 4.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
479 707 7.707893 GCATTTTGTATTCAGAACCATATGCTT 59.292 33.333 16.05 0.0 0.00 3.91
703 2154 1.735571 GCGGAGAACGGCTCATTTTTA 59.264 47.619 9.35 0.0 45.81 1.52
705 2156 3.181500 GCGGAGAACGGCTCATTTTTAAT 60.181 43.478 9.35 0.0 45.81 1.40
1065 3451 4.261614 GGACTGACCCTCATTTTTCACAAC 60.262 45.833 0.00 0.0 0.00 3.32
1198 3589 6.069994 AGATTGCTGATCTGAGAGACATAGA 58.930 40.000 3.42 0.0 43.52 1.98
1270 3661 2.747686 GAGGTGGTCGAAAGCCCA 59.252 61.111 0.00 0.0 0.00 5.36
1733 4398 5.589855 TGAGTTCAAGAGAAAGTGCATGAAA 59.410 36.000 0.00 0.0 35.08 2.69
2370 15323 4.672251 CCTGCATGGCCTAGCTTT 57.328 55.556 18.54 0.0 0.00 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
703 2154 4.710865 TGATATGTGTCACAATTGGGCATT 59.289 37.500 10.28 3.69 0.00 3.56
705 2156 3.694926 TGATATGTGTCACAATTGGGCA 58.305 40.909 10.28 5.56 0.00 5.36
1065 3451 4.148348 CAGACAGGAGAAAAGTTCGTTACG 59.852 45.833 0.00 0.00 34.02 3.18
1270 3661 0.618680 TGCTAGGACCATGTGGAGCT 60.619 55.000 5.96 0.00 38.94 4.09
1733 4398 6.260714 GCAACTCAAAAAGATTGGGATGTTTT 59.739 34.615 0.00 0.00 39.58 2.43
2370 15323 1.282738 TCTCTTGATCAATGCCTGGCA 59.717 47.619 25.65 25.65 44.86 4.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.