Multiple sequence alignment - TraesCS7B01G198700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G198700 chr7B 100.000 3259 0 0 1 3259 355801816 355805074 0.000000e+00 6019
1 TraesCS7B01G198700 chr4A 99.204 3267 18 2 1 3259 241658963 241655697 0.000000e+00 5882
2 TraesCS7B01G198700 chr4A 95.620 548 24 0 943 1490 477957868 477958415 0.000000e+00 880
3 TraesCS7B01G198700 chr1D 97.430 3268 54 6 1 3259 92970633 92973879 0.000000e+00 5542
4 TraesCS7B01G198700 chr5B 97.245 3267 72 7 1 3259 46617989 46621245 0.000000e+00 5518
5 TraesCS7B01G198700 chr3B 96.480 3267 80 5 1 3259 96749034 96752273 0.000000e+00 5363
6 TraesCS7B01G198700 chr3D 96.906 2327 50 6 941 3259 229368470 229370782 0.000000e+00 3879
7 TraesCS7B01G198700 chr3D 97.614 922 21 1 1 922 229367561 229368481 0.000000e+00 1580
8 TraesCS7B01G198700 chr7A 97.872 2068 22 7 1204 3259 473899097 473901154 0.000000e+00 3555
9 TraesCS7B01G198700 chr2A 97.912 1772 26 5 1498 3259 608786368 608788138 0.000000e+00 3057
10 TraesCS7B01G198700 chr2A 96.746 1506 24 7 1 1506 608783145 608784625 0.000000e+00 2486
11 TraesCS7B01G198700 chr6D 95.760 1415 49 9 1 1407 41331307 41332718 0.000000e+00 2270
12 TraesCS7B01G198700 chr6D 90.306 588 55 2 1683 2268 41332783 41333370 0.000000e+00 769
13 TraesCS7B01G198700 chr4D 95.690 1369 55 3 1 1368 308695467 308696832 0.000000e+00 2198
14 TraesCS7B01G198700 chr4D 90.083 968 72 12 1441 2407 308696928 308697872 0.000000e+00 1234
15 TraesCS7B01G198700 chr4D 87.956 548 40 4 2719 3259 308742093 308742621 9.930000e-175 623
16 TraesCS7B01G198700 chr4D 94.654 318 16 1 2403 2720 308741624 308741940 2.920000e-135 492
17 TraesCS7B01G198700 chr2B 92.751 1407 89 6 1 1407 324902495 324901102 0.000000e+00 2021
18 TraesCS7B01G198700 chr7D 93.613 548 27 3 2719 3259 199078727 199078181 0.000000e+00 811
19 TraesCS7B01G198700 chr7D 95.473 243 11 0 2478 2720 199078997 199078755 3.940000e-104 388
20 TraesCS7B01G198700 chr1A 88.203 551 35 9 2719 3259 100684259 100684789 5.930000e-177 630


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G198700 chr7B 355801816 355805074 3258 False 6019.0 6019 100.0000 1 3259 1 chr7B.!!$F1 3258
1 TraesCS7B01G198700 chr4A 241655697 241658963 3266 True 5882.0 5882 99.2040 1 3259 1 chr4A.!!$R1 3258
2 TraesCS7B01G198700 chr4A 477957868 477958415 547 False 880.0 880 95.6200 943 1490 1 chr4A.!!$F1 547
3 TraesCS7B01G198700 chr1D 92970633 92973879 3246 False 5542.0 5542 97.4300 1 3259 1 chr1D.!!$F1 3258
4 TraesCS7B01G198700 chr5B 46617989 46621245 3256 False 5518.0 5518 97.2450 1 3259 1 chr5B.!!$F1 3258
5 TraesCS7B01G198700 chr3B 96749034 96752273 3239 False 5363.0 5363 96.4800 1 3259 1 chr3B.!!$F1 3258
6 TraesCS7B01G198700 chr3D 229367561 229370782 3221 False 2729.5 3879 97.2600 1 3259 2 chr3D.!!$F1 3258
7 TraesCS7B01G198700 chr7A 473899097 473901154 2057 False 3555.0 3555 97.8720 1204 3259 1 chr7A.!!$F1 2055
8 TraesCS7B01G198700 chr2A 608783145 608788138 4993 False 2771.5 3057 97.3290 1 3259 2 chr2A.!!$F1 3258
9 TraesCS7B01G198700 chr6D 41331307 41333370 2063 False 1519.5 2270 93.0330 1 2268 2 chr6D.!!$F1 2267
10 TraesCS7B01G198700 chr4D 308695467 308697872 2405 False 1716.0 2198 92.8865 1 2407 2 chr4D.!!$F1 2406
11 TraesCS7B01G198700 chr4D 308741624 308742621 997 False 557.5 623 91.3050 2403 3259 2 chr4D.!!$F2 856
12 TraesCS7B01G198700 chr2B 324901102 324902495 1393 True 2021.0 2021 92.7510 1 1407 1 chr2B.!!$R1 1406
13 TraesCS7B01G198700 chr7D 199078181 199078997 816 True 599.5 811 94.5430 2478 3259 2 chr7D.!!$R1 781
14 TraesCS7B01G198700 chr1A 100684259 100684789 530 False 630.0 630 88.2030 2719 3259 1 chr1A.!!$F1 540

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
355 356 2.751837 CCGGGCTTCTTTGCTCCC 60.752 66.667 0.0 0.0 35.42 4.30 F
1399 1453 9.582431 ACAAGATTCATTTTCATCATTCATGTC 57.418 29.630 0.0 0.0 33.66 3.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1958 3843 0.541998 TCCTCTTCTGTTCCTCGCCA 60.542 55.0 0.0 0.0 0.00 5.69 R
3096 5143 6.515272 TTAGCACCATCCAAGAAAGATTTC 57.485 37.5 0.0 0.0 37.45 2.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
355 356 2.751837 CCGGGCTTCTTTGCTCCC 60.752 66.667 0.0 0.0 35.42 4.30
1399 1453 9.582431 ACAAGATTCATTTTCATCATTCATGTC 57.418 29.630 0.0 0.0 33.66 3.06
1958 3843 2.034558 CGCAACATCTTCAACCCAAACT 59.965 45.455 0.0 0.0 0.00 2.66
2444 4329 6.759497 ACTTACCTATTTCCATGTTTGAGC 57.241 37.500 0.0 0.0 0.00 4.26
3096 5143 5.360144 AGAAATGAAGATCCTTGAGCAATGG 59.640 40.000 0.0 0.0 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
181 182 4.272748 GTGGAACTCTAAAAGCGTCTTGTT 59.727 41.667 0.00 0.0 0.00 2.83
390 391 4.323569 TGTGGGTTATTTCCATTAGCCA 57.676 40.909 0.00 0.0 37.27 4.75
524 526 3.244078 TGTGATACCTGATTCCGTATGCC 60.244 47.826 0.00 0.0 0.00 4.40
600 603 5.417894 ACGGATCTGCGAGATGGTATTATTA 59.582 40.000 0.00 0.0 34.53 0.98
1399 1453 7.006210 GCATGTTTTCGAATAAACTACTTGACG 59.994 37.037 12.58 0.0 38.52 4.35
1958 3843 0.541998 TCCTCTTCTGTTCCTCGCCA 60.542 55.000 0.00 0.0 0.00 5.69
3096 5143 6.515272 TTAGCACCATCCAAGAAAGATTTC 57.485 37.500 0.00 0.0 37.45 2.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.