Multiple sequence alignment - TraesCS7B01G185000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G185000 chr7B 100.000 3433 0 0 1 3433 300041538 300044970 0 6340
1 TraesCS7B01G185000 chr2B 97.322 3435 83 6 1 3433 317055741 317052314 0 5825
2 TraesCS7B01G185000 chr6B 97.060 3435 93 6 1 3433 85662847 85666275 0 5777
3 TraesCS7B01G185000 chr3B 96.509 3437 113 6 1 3433 151826081 151822648 0 5675
4 TraesCS7B01G185000 chr3B 96.450 3437 108 14 1 3433 545972549 545969123 0 5659
5 TraesCS7B01G185000 chr3A 95.784 3439 127 14 1 3433 662010401 662006975 0 5531
6 TraesCS7B01G185000 chr2A 95.726 3439 128 15 1 3433 384174883 384171458 0 5518
7 TraesCS7B01G185000 chr2A 95.584 3442 130 17 1 3433 685104315 685100887 0 5494
8 TraesCS7B01G185000 chr2A 95.233 3440 145 16 1 3433 284799917 284803344 0 5426
9 TraesCS7B01G185000 chr5A 95.651 3426 128 16 14 3433 465654136 465657546 0 5481


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G185000 chr7B 300041538 300044970 3432 False 6340 6340 100.000 1 3433 1 chr7B.!!$F1 3432
1 TraesCS7B01G185000 chr2B 317052314 317055741 3427 True 5825 5825 97.322 1 3433 1 chr2B.!!$R1 3432
2 TraesCS7B01G185000 chr6B 85662847 85666275 3428 False 5777 5777 97.060 1 3433 1 chr6B.!!$F1 3432
3 TraesCS7B01G185000 chr3B 151822648 151826081 3433 True 5675 5675 96.509 1 3433 1 chr3B.!!$R1 3432
4 TraesCS7B01G185000 chr3B 545969123 545972549 3426 True 5659 5659 96.450 1 3433 1 chr3B.!!$R2 3432
5 TraesCS7B01G185000 chr3A 662006975 662010401 3426 True 5531 5531 95.784 1 3433 1 chr3A.!!$R1 3432
6 TraesCS7B01G185000 chr2A 384171458 384174883 3425 True 5518 5518 95.726 1 3433 1 chr2A.!!$R1 3432
7 TraesCS7B01G185000 chr2A 685100887 685104315 3428 True 5494 5494 95.584 1 3433 1 chr2A.!!$R2 3432
8 TraesCS7B01G185000 chr2A 284799917 284803344 3427 False 5426 5426 95.233 1 3433 1 chr2A.!!$F1 3432
9 TraesCS7B01G185000 chr5A 465654136 465657546 3410 False 5481 5481 95.651 14 3433 1 chr5A.!!$F1 3419

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
647 654 0.034186 AATGCCATCATCACCACCGT 60.034 50.000 0.0 0.0 31.27 4.83 F
1212 1220 1.073897 GCTGTGGAGGAAGCTTGGT 59.926 57.895 2.1 0.0 36.47 3.67 F
1735 1744 2.486548 GGACTTGGTGAAGCACTGGTTA 60.487 50.000 0.0 0.0 34.40 2.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2372 2384 0.804989 CCCGCTCTTTCGCAAATTCT 59.195 50.000 0.0 0.0 0.0 2.40 R
2406 2418 1.301954 GGCAATAGGGGTGGTCGTT 59.698 57.895 0.0 0.0 0.0 3.85 R
3215 3234 2.563179 GCTCACCAGTCAAACTCCTCTA 59.437 50.000 0.0 0.0 0.0 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
228 230 7.996098 AAGGCATAGTAATAACAAACACACT 57.004 32.000 0.00 0.0 0.00 3.55
285 287 0.250209 AAGATATGCCTGCTCCTGCG 60.250 55.000 0.00 0.0 43.34 5.18
495 502 2.347452 CGCTGGTAATTGGTACGTTCAG 59.653 50.000 0.00 0.0 33.01 3.02
530 537 3.442625 CACCAGTCCGAGTATGACAGTAA 59.557 47.826 0.00 0.0 35.15 2.24
647 654 0.034186 AATGCCATCATCACCACCGT 60.034 50.000 0.00 0.0 31.27 4.83
742 749 8.582433 AACCATTTAAATTGAACGGTTAGTTG 57.418 30.769 14.90 0.0 44.35 3.16
1212 1220 1.073897 GCTGTGGAGGAAGCTTGGT 59.926 57.895 2.10 0.0 36.47 3.67
1385 1393 5.366186 TCATTTGCCCTGCATATGGTTTATT 59.634 36.000 15.99 0.0 44.12 1.40
1735 1744 2.486548 GGACTTGGTGAAGCACTGGTTA 60.487 50.000 0.00 0.0 34.40 2.85
2199 2211 3.141398 GACTCCTTGACTGATGTTGCAA 58.859 45.455 0.00 0.0 0.00 4.08
2372 2384 3.761752 TCGACTACATCACAGATGGTTCA 59.238 43.478 11.29 0.0 0.00 3.18
2406 2418 0.321298 GCGGGAGGCTAACAACTTCA 60.321 55.000 0.00 0.0 39.11 3.02
2461 2473 2.877097 TACATCAAAGCCTGCCTTCA 57.123 45.000 0.00 0.0 31.99 3.02
2506 2518 8.140677 TGCCTTTTATCTTGTTGTTTCAAATG 57.859 30.769 0.00 0.0 0.00 2.32
3137 3156 2.353803 GCGAATCCCTAGTAATCCGCAT 60.354 50.000 0.00 0.0 40.88 4.73
3144 3163 3.585862 CCTAGTAATCCGCATAACGCAT 58.414 45.455 0.00 0.0 42.60 4.73
3215 3234 2.256117 AAGCGCTCAGGTAAGTGTTT 57.744 45.000 12.06 0.0 0.00 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
285 287 6.644347 TGATAGTCTTTCTGAATTGGGACTC 58.356 40.000 14.37 7.06 35.90 3.36
495 502 3.432252 CGGACTGGTGATTGAAGTGTAAC 59.568 47.826 0.00 0.00 0.00 2.50
647 654 1.557099 ATCCCACTTGCACGTCTCTA 58.443 50.000 0.00 0.00 0.00 2.43
731 738 0.854705 GCGTCGAACAACTAACCGTT 59.145 50.000 0.00 0.00 35.88 4.44
779 786 1.815840 TTTTGCAGTGCGTCGTGGA 60.816 52.632 11.20 0.00 0.00 4.02
1212 1220 0.174845 CGATCCTACGAAACCTGCCA 59.825 55.000 0.00 0.00 35.09 4.92
1638 1647 6.650807 TCACTACATCAAGTTCAGAAACATCC 59.349 38.462 0.00 0.00 37.88 3.51
1735 1744 8.650143 ACTTTTGTTGGAATAGGATAACACAT 57.350 30.769 0.00 0.00 33.25 3.21
2199 2211 1.852157 AATGGGTGGATGACGCTGGT 61.852 55.000 0.00 0.00 38.35 4.00
2287 2299 2.353889 GCGTACTCGATGAGGTTGTCTA 59.646 50.000 0.00 0.00 39.71 2.59
2372 2384 0.804989 CCCGCTCTTTCGCAAATTCT 59.195 50.000 0.00 0.00 0.00 2.40
2406 2418 1.301954 GGCAATAGGGGTGGTCGTT 59.698 57.895 0.00 0.00 0.00 3.85
2449 2461 3.511540 GGAAGTAAAATGAAGGCAGGCTT 59.488 43.478 9.44 9.44 0.00 4.35
2506 2518 2.952310 ACCCAACAAGAGCAAACTTCTC 59.048 45.455 0.00 0.00 0.00 2.87
3061 3080 4.020617 CCTGCGCCTGACCTTGGA 62.021 66.667 4.18 0.00 0.00 3.53
3137 3156 3.761140 TCGGCGGGTCATGCGTTA 61.761 61.111 7.21 0.00 0.00 3.18
3215 3234 2.563179 GCTCACCAGTCAAACTCCTCTA 59.437 50.000 0.00 0.00 0.00 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.