Multiple sequence alignment - TraesCS7B01G178200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G178200 chr7B 100.000 2414 0 0 1 2414 256183124 256180711 0.000000e+00 4458.0
1 TraesCS7B01G178200 chr5A 97.899 1523 21 4 901 2414 578115451 578113931 0.000000e+00 2625.0
2 TraesCS7B01G178200 chr5A 91.712 736 42 8 1695 2414 181420662 181419930 0.000000e+00 1003.0
3 TraesCS7B01G178200 chr5A 89.231 325 33 2 1433 1757 181420990 181420668 2.890000e-109 405.0
4 TraesCS7B01G178200 chr5A 95.690 232 9 1 684 914 578118634 578118403 2.930000e-99 372.0
5 TraesCS7B01G178200 chr5D 93.399 818 38 5 1611 2414 543489389 543488574 0.000000e+00 1197.0
6 TraesCS7B01G178200 chr5D 93.468 444 28 1 886 1328 543490827 543490384 0.000000e+00 658.0
7 TraesCS7B01G178200 chr5D 93.839 211 13 0 48 258 224424638 224424848 3.870000e-83 318.0
8 TraesCS7B01G178200 chr5D 93.617 188 9 2 1366 1550 543489578 543489391 6.570000e-71 278.0
9 TraesCS7B01G178200 chr5D 81.538 130 7 7 2084 2198 138989781 138989654 9.190000e-15 91.6
10 TraesCS7B01G178200 chr6B 98.430 637 9 1 48 684 185992674 185993309 0.000000e+00 1120.0
11 TraesCS7B01G178200 chr6B 95.652 46 2 0 1 46 185992597 185992642 9.260000e-10 75.0
12 TraesCS7B01G178200 chr5B 95.016 642 30 2 48 688 633875747 633876387 0.000000e+00 1007.0
13 TraesCS7B01G178200 chr5B 97.826 46 1 0 1 46 633875670 633875715 1.990000e-11 80.5
14 TraesCS7B01G178200 chr3A 94.712 643 31 3 48 688 385451171 385451812 0.000000e+00 996.0
15 TraesCS7B01G178200 chr4D 90.533 750 51 11 1361 2095 71381751 71381007 0.000000e+00 974.0
16 TraesCS7B01G178200 chr4D 92.947 638 43 2 48 684 146753882 146753246 0.000000e+00 928.0
17 TraesCS7B01G178200 chr4D 92.212 642 43 5 48 688 147362008 147362643 0.000000e+00 902.0
18 TraesCS7B01G178200 chr4D 85.474 654 69 8 698 1328 71382661 71382011 0.000000e+00 658.0
19 TraesCS7B01G178200 chr4D 93.051 331 14 1 2093 2414 71380917 71380587 2.170000e-130 475.0
20 TraesCS7B01G178200 chr4D 97.826 46 1 0 1 46 147361931 147361976 1.990000e-11 80.5
21 TraesCS7B01G178200 chr2B 88.903 802 49 11 1649 2414 106494449 106493652 0.000000e+00 952.0
22 TraesCS7B01G178200 chr2B 90.610 639 36 9 1785 2414 560435641 560436264 0.000000e+00 826.0
23 TraesCS7B01G178200 chr2B 83.173 624 61 13 685 1281 560434846 560435452 4.570000e-147 531.0
24 TraesCS7B01G178200 chr2B 82.367 414 42 5 884 1281 106494842 106494444 4.970000e-87 331.0
25 TraesCS7B01G178200 chr2B 80.903 288 34 12 1963 2239 89557312 89557589 8.750000e-50 207.0
26 TraesCS7B01G178200 chr2B 77.966 236 42 7 430 658 659841469 659841237 3.240000e-29 139.0
27 TraesCS7B01G178200 chr3D 85.457 667 72 7 685 1328 600656661 600657325 0.000000e+00 671.0
28 TraesCS7B01G178200 chr3D 90.585 393 30 2 1361 1748 600657585 600657975 4.600000e-142 514.0
29 TraesCS7B01G178200 chr3D 92.749 331 14 2 2093 2414 600658265 600658594 1.010000e-128 470.0
30 TraesCS7B01G178200 chr3D 91.279 172 12 2 1924 2095 600657974 600658142 5.190000e-57 231.0
31 TraesCS7B01G178200 chr7A 91.549 213 16 2 48 258 623813519 623813731 2.350000e-75 292.0
32 TraesCS7B01G178200 chr7A 93.333 45 3 0 684 728 644542028 644542072 1.550000e-07 67.6
33 TraesCS7B01G178200 chr2D 80.678 295 31 11 1963 2239 56583006 56583292 3.150000e-49 206.0
34 TraesCS7B01G178200 chr6D 81.143 175 19 7 2098 2260 332313310 332313482 7.010000e-26 128.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G178200 chr7B 256180711 256183124 2413 True 4458.000000 4458 100.000000 1 2414 1 chr7B.!!$R1 2413
1 TraesCS7B01G178200 chr5A 578113931 578118634 4703 True 1498.500000 2625 96.794500 684 2414 2 chr5A.!!$R2 1730
2 TraesCS7B01G178200 chr5A 181419930 181420990 1060 True 704.000000 1003 90.471500 1433 2414 2 chr5A.!!$R1 981
3 TraesCS7B01G178200 chr5D 543488574 543490827 2253 True 711.000000 1197 93.494667 886 2414 3 chr5D.!!$R2 1528
4 TraesCS7B01G178200 chr6B 185992597 185993309 712 False 597.500000 1120 97.041000 1 684 2 chr6B.!!$F1 683
5 TraesCS7B01G178200 chr5B 633875670 633876387 717 False 543.750000 1007 96.421000 1 688 2 chr5B.!!$F1 687
6 TraesCS7B01G178200 chr3A 385451171 385451812 641 False 996.000000 996 94.712000 48 688 1 chr3A.!!$F1 640
7 TraesCS7B01G178200 chr4D 146753246 146753882 636 True 928.000000 928 92.947000 48 684 1 chr4D.!!$R1 636
8 TraesCS7B01G178200 chr4D 71380587 71382661 2074 True 702.333333 974 89.686000 698 2414 3 chr4D.!!$R2 1716
9 TraesCS7B01G178200 chr4D 147361931 147362643 712 False 491.250000 902 95.019000 1 688 2 chr4D.!!$F1 687
10 TraesCS7B01G178200 chr2B 560434846 560436264 1418 False 678.500000 826 86.891500 685 2414 2 chr2B.!!$F2 1729
11 TraesCS7B01G178200 chr2B 106493652 106494842 1190 True 641.500000 952 85.635000 884 2414 2 chr2B.!!$R2 1530
12 TraesCS7B01G178200 chr3D 600656661 600658594 1933 False 471.500000 671 90.017500 685 2414 4 chr3D.!!$F1 1729

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
773 810 0.527817 GTGAGGTCGCCGGTATTCAG 60.528 60.0 1.9 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2037 6001 2.032681 AGCAGGCGGAGACAAACC 59.967 61.111 0.0 0.0 39.87 3.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
46 47 2.863704 GCTCCAAACTGCATGTTGAACC 60.864 50.000 10.31 0.0 39.13 3.62
151 182 6.990798 TCCAAAATGCATTTCTGAACACATA 58.009 32.000 24.28 0.0 0.00 2.29
529 566 2.752358 CTTGCAGGCCTCAGTGGA 59.248 61.111 0.00 0.0 38.35 4.02
758 795 3.565482 CCGTTCATTTGGGGATATGTGAG 59.435 47.826 0.00 0.0 0.00 3.51
772 809 1.252215 TGTGAGGTCGCCGGTATTCA 61.252 55.000 1.90 0.0 0.00 2.57
773 810 0.527817 GTGAGGTCGCCGGTATTCAG 60.528 60.000 1.90 0.0 0.00 3.02
853 900 0.534203 GACGTCCAAGCCAGGTTTCA 60.534 55.000 3.51 0.0 0.00 2.69
891 938 3.364549 CATTTAACCCAGCCCATCTTCA 58.635 45.455 0.00 0.0 0.00 3.02
1152 4179 5.786401 TTTGGATGTTTTTCGTTGGTTTG 57.214 34.783 0.00 0.0 0.00 2.93
1166 4193 6.626302 TCGTTGGTTTGTTCTTCTTGATTTT 58.374 32.000 0.00 0.0 0.00 1.82
1918 5878 8.956426 TCGGTAAATTTGCTCTCTGAAATTTAT 58.044 29.630 6.23 0.0 42.05 1.40
2029 5993 2.242043 CACTGCTGGAAGGAAACCAAT 58.758 47.619 0.00 0.0 36.95 3.16
2037 6001 3.014623 GGAAGGAAACCAATAACGGGAG 58.985 50.000 0.00 0.0 0.00 4.30
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
151 182 3.865446 TGAATGCAGATCGTGACAAGAT 58.135 40.909 3.34 3.34 0.00 2.40
742 779 2.487265 GCGACCTCACATATCCCCAAAT 60.487 50.000 0.00 0.00 0.00 2.32
758 795 1.227176 GTCCTGAATACCGGCGACC 60.227 63.158 9.30 0.00 0.00 4.79
891 938 1.482593 GGATCGAATGAGGACCACACT 59.517 52.381 0.00 0.00 0.00 3.55
1086 4113 1.444119 GGCACTTGTGGAAACGCTCA 61.444 55.000 2.81 0.00 42.82 4.26
1166 4193 7.284034 GGAAAGCTATGGAATGAGAAATTGAGA 59.716 37.037 0.00 0.00 0.00 3.27
2037 6001 2.032681 AGCAGGCGGAGACAAACC 59.967 61.111 0.00 0.00 39.87 3.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.