Multiple sequence alignment - TraesCS7B01G177000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G177000 chr7B 100.000 3176 0 0 1 3176 252388845 252385670 0.000000e+00 5866.0
1 TraesCS7B01G177000 chr3A 98.683 3189 29 3 1 3176 24109706 24106518 0.000000e+00 5644.0
2 TraesCS7B01G177000 chr3A 96.590 2082 58 2 1 2071 37970056 37972135 0.000000e+00 3439.0
3 TraesCS7B01G177000 chr3A 96.503 772 25 2 2117 2887 37972397 37973167 0.000000e+00 1275.0
4 TraesCS7B01G177000 chr3D 94.928 3194 113 16 1 3176 77343702 77346864 0.000000e+00 4955.0
5 TraesCS7B01G177000 chr3D 95.926 2013 61 5 1 2001 604384013 604382010 0.000000e+00 3243.0
6 TraesCS7B01G177000 chr3D 95.850 988 26 4 2190 3176 604381672 604380699 0.000000e+00 1583.0
7 TraesCS7B01G177000 chr2B 94.728 2333 94 10 851 3176 742548288 742545978 0.000000e+00 3600.0
8 TraesCS7B01G177000 chr2B 94.573 866 35 6 1 855 742553922 742553058 0.000000e+00 1328.0
9 TraesCS7B01G177000 chr7D 93.020 2106 110 19 1 2083 540632538 540634629 0.000000e+00 3040.0
10 TraesCS7B01G177000 chr6D 95.684 1645 57 4 1 1633 458416618 458414976 0.000000e+00 2632.0
11 TraesCS7B01G177000 chr6D 95.502 1645 60 4 1 1633 458426359 458424717 0.000000e+00 2615.0
12 TraesCS7B01G177000 chr6D 94.463 1481 67 13 1702 3176 458414976 458413505 0.000000e+00 2266.0
13 TraesCS7B01G177000 chr6D 96.844 697 21 1 2481 3176 458423586 458422890 0.000000e+00 1164.0
14 TraesCS7B01G177000 chr6D 95.960 396 15 1 1702 2097 458424717 458424323 2.670000e-180 641.0
15 TraesCS7B01G177000 chr4B 90.909 924 74 4 2253 3174 133361787 133362702 0.000000e+00 1232.0
16 TraesCS7B01G177000 chr4B 85.872 545 61 10 1593 2132 133360847 133361380 1.650000e-157 566.0
17 TraesCS7B01G177000 chr2D 89.633 926 69 9 2253 3176 615215477 615216377 0.000000e+00 1153.0
18 TraesCS7B01G177000 chr2D 86.660 982 86 17 1176 2132 615213990 615214951 0.000000e+00 1046.0
19 TraesCS7B01G177000 chr2D 85.915 781 63 17 1 745 615213236 615214005 0.000000e+00 789.0
20 TraesCS7B01G177000 chr6A 87.325 931 101 11 2253 3176 113085659 113086579 0.000000e+00 1050.0
21 TraesCS7B01G177000 chr6A 84.530 808 76 22 1225 2009 113071035 113071816 0.000000e+00 754.0
22 TraesCS7B01G177000 chr5D 85.938 320 39 4 745 1063 218946921 218946607 1.410000e-88 337.0
23 TraesCS7B01G177000 chr4D 84.365 307 35 8 758 1063 470110655 470110361 4.010000e-74 289.0
24 TraesCS7B01G177000 chr2A 79.562 137 20 7 2297 2430 579524035 579524166 1.210000e-14 91.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G177000 chr7B 252385670 252388845 3175 True 5866.000000 5866 100.000000 1 3176 1 chr7B.!!$R1 3175
1 TraesCS7B01G177000 chr3A 24106518 24109706 3188 True 5644.000000 5644 98.683000 1 3176 1 chr3A.!!$R1 3175
2 TraesCS7B01G177000 chr3A 37970056 37973167 3111 False 2357.000000 3439 96.546500 1 2887 2 chr3A.!!$F1 2886
3 TraesCS7B01G177000 chr3D 77343702 77346864 3162 False 4955.000000 4955 94.928000 1 3176 1 chr3D.!!$F1 3175
4 TraesCS7B01G177000 chr3D 604380699 604384013 3314 True 2413.000000 3243 95.888000 1 3176 2 chr3D.!!$R1 3175
5 TraesCS7B01G177000 chr2B 742545978 742548288 2310 True 3600.000000 3600 94.728000 851 3176 1 chr2B.!!$R1 2325
6 TraesCS7B01G177000 chr2B 742553058 742553922 864 True 1328.000000 1328 94.573000 1 855 1 chr2B.!!$R2 854
7 TraesCS7B01G177000 chr7D 540632538 540634629 2091 False 3040.000000 3040 93.020000 1 2083 1 chr7D.!!$F1 2082
8 TraesCS7B01G177000 chr6D 458413505 458416618 3113 True 2449.000000 2632 95.073500 1 3176 2 chr6D.!!$R1 3175
9 TraesCS7B01G177000 chr6D 458422890 458426359 3469 True 1473.333333 2615 96.102000 1 3176 3 chr6D.!!$R2 3175
10 TraesCS7B01G177000 chr4B 133360847 133362702 1855 False 899.000000 1232 88.390500 1593 3174 2 chr4B.!!$F1 1581
11 TraesCS7B01G177000 chr2D 615213236 615216377 3141 False 996.000000 1153 87.402667 1 3176 3 chr2D.!!$F1 3175
12 TraesCS7B01G177000 chr6A 113085659 113086579 920 False 1050.000000 1050 87.325000 2253 3176 1 chr6A.!!$F2 923
13 TraesCS7B01G177000 chr6A 113071035 113071816 781 False 754.000000 754 84.530000 1225 2009 1 chr6A.!!$F1 784

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
19 20 0.391661 CTTGTACCTGCATCCACGCT 60.392 55.000 0.0 0.0 0.0 5.07 F
1785 1882 1.341209 GAGAAGCCCAAACAAACCTGG 59.659 52.381 0.0 0.0 0.0 4.45 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1834 1933 2.037902 TGTACCACAAGCGGAGATTCAA 59.962 45.455 0.0 0.0 27.8 2.69 R
2723 3495 1.996191 GCAGAAAGGAGAGTAACAGCG 59.004 52.381 0.0 0.0 0.0 5.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 20 0.391661 CTTGTACCTGCATCCACGCT 60.392 55.000 0.00 0.0 0.00 5.07
620 659 2.746362 CCAGGAGCATTCTGACAAGTTC 59.254 50.000 3.08 0.0 0.00 3.01
1785 1882 1.341209 GAGAAGCCCAAACAAACCTGG 59.659 52.381 0.00 0.0 0.00 4.45
1834 1933 1.351017 ACGTCTGGGGATCAACACATT 59.649 47.619 0.00 0.0 0.00 2.71
1994 2095 8.599774 GTCTTCTTGTTTACTAATCAGAGCATC 58.400 37.037 0.00 0.0 0.00 3.91
2043 2144 4.645535 CATTCCTTCAAGGTTGAGTCAGA 58.354 43.478 2.50 0.0 38.61 3.27
2723 3495 8.948853 TGATCAAAAGTATTTGTCGAATGTTC 57.051 30.769 0.00 0.0 45.02 3.18
2818 3591 6.389906 ACATTTTGTTGCTCTATTAACCTGC 58.610 36.000 0.00 0.0 0.00 4.85
2823 3596 7.753309 TTGTTGCTCTATTAACCTGCTTTTA 57.247 32.000 0.00 0.0 0.00 1.52
3058 3831 3.303593 GGATCATGTTCTATGCAACGCTG 60.304 47.826 3.86 0.0 0.00 5.18
3082 3855 9.270576 CTGCACAATCGAATTAATATATGAAGC 57.729 33.333 0.00 0.0 0.00 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
19 20 2.391724 GAACTCAAGACCGTGGGGCA 62.392 60.000 0.00 0.0 36.48 5.36
27 28 4.799428 GCGTACAATAGAGAACTCAAGACC 59.201 45.833 4.64 0.0 0.00 3.85
620 659 6.533723 TCATTAGAATTTGTACGCAGTGGTAG 59.466 38.462 0.00 0.0 45.73 3.18
1162 1235 4.164030 TGCTAAGTTTGGCATGAGATCCTA 59.836 41.667 0.00 0.0 39.85 2.94
1484 1558 5.712152 CAAGAACTGCTCCCAAACTAATT 57.288 39.130 0.00 0.0 0.00 1.40
1834 1933 2.037902 TGTACCACAAGCGGAGATTCAA 59.962 45.455 0.00 0.0 27.80 2.69
1994 2095 7.406031 TGGTCTAATTAGTACAGACAAGAGG 57.594 40.000 12.19 0.0 40.38 3.69
2723 3495 1.996191 GCAGAAAGGAGAGTAACAGCG 59.004 52.381 0.00 0.0 0.00 5.18
2818 3591 9.798994 ACATGAGTAACTTACGGTAGATAAAAG 57.201 33.333 0.00 0.0 0.00 2.27
2845 3618 9.899226 CTTGGAAATCTAGAGAAACGAAAAATT 57.101 29.630 0.00 0.0 0.00 1.82
3058 3831 9.270576 CTGCTTCATATATTAATTCGATTGTGC 57.729 33.333 0.00 0.0 0.00 4.57
3082 3855 6.530019 AGGAGCCACAATAAAATAAACCTG 57.470 37.500 0.00 0.0 0.00 4.00


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.