Multiple sequence alignment - TraesCS7B01G141800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G141800 chr7B 100.000 5729 0 0 1 5729 180028234 180022506 0.000000e+00 10580
1 TraesCS7B01G141800 chr7B 98.274 4868 65 15 878 5729 693174898 693179762 0.000000e+00 8506
2 TraesCS7B01G141800 chr4B 98.294 4866 67 12 878 5729 608661412 608656549 0.000000e+00 8512
3 TraesCS7B01G141800 chr4B 93.934 2473 107 22 3273 5729 603287760 603285315 0.000000e+00 3696
4 TraesCS7B01G141800 chr4B 96.857 859 25 2 30 886 608662353 608661495 0.000000e+00 1435
5 TraesCS7B01G141800 chr4B 95.571 858 32 6 30 886 603291329 603290477 0.000000e+00 1369
6 TraesCS7B01G141800 chr3B 98.233 4868 69 5 878 5729 754459785 754464651 0.000000e+00 8497
7 TraesCS7B01G141800 chr3B 95.394 4885 168 32 878 5729 39619680 39624540 0.000000e+00 7721
8 TraesCS7B01G141800 chr3B 98.083 887 16 1 1 886 754458816 754459702 0.000000e+00 1543
9 TraesCS7B01G141800 chr2B 98.233 4867 67 14 878 5729 658223778 658218916 0.000000e+00 8493
10 TraesCS7B01G141800 chr2B 96.476 4455 118 18 878 5302 512425381 512420936 0.000000e+00 7321
11 TraesCS7B01G141800 chr2B 95.324 3593 123 26 2153 5729 19854200 19857763 0.000000e+00 5662
12 TraesCS7B01G141800 chr2B 93.492 1383 68 8 4271 5641 670331542 670332914 0.000000e+00 2036
13 TraesCS7B01G141800 chr2B 97.329 861 19 4 30 886 658224721 658223861 0.000000e+00 1459
14 TraesCS7B01G141800 chr2B 96.270 858 25 7 30 886 19851929 19852780 0.000000e+00 1400
15 TraesCS7B01G141800 chr2B 96.266 857 26 6 30 886 512426314 512425464 0.000000e+00 1400
16 TraesCS7B01G141800 chr2B 92.878 337 16 3 5394 5729 512420646 512420317 3.100000e-132 483
17 TraesCS7B01G141800 chr2B 90.208 337 14 6 5394 5729 790123897 790123579 6.860000e-114 422
18 TraesCS7B01G141800 chrUn 96.345 4870 128 30 878 5729 76240144 76244981 0.000000e+00 7962
19 TraesCS7B01G141800 chrUn 96.154 858 28 5 30 886 76239208 76240061 0.000000e+00 1397
20 TraesCS7B01G141800 chr6B 95.517 3591 111 25 2153 5729 353550025 353546471 0.000000e+00 5694
21 TraesCS7B01G141800 chr6B 97.040 1284 31 7 878 2159 319458216 319459494 0.000000e+00 2154
22 TraesCS7B01G141800 chr6B 95.688 858 30 7 30 886 319457282 319458133 0.000000e+00 1373
23 TraesCS7B01G141800 chr4A 96.942 2485 71 5 2153 4637 713790268 713787789 0.000000e+00 4163
24 TraesCS7B01G141800 chr4A 97.274 1284 29 6 878 2159 713791606 713790327 0.000000e+00 2172
25 TraesCS7B01G141800 chr4A 95.227 859 32 9 30 886 713792540 713791689 0.000000e+00 1351


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G141800 chr7B 180022506 180028234 5728 True 10580.0 10580 100.000000 1 5729 1 chr7B.!!$R1 5728
1 TraesCS7B01G141800 chr7B 693174898 693179762 4864 False 8506.0 8506 98.274000 878 5729 1 chr7B.!!$F1 4851
2 TraesCS7B01G141800 chr4B 608656549 608662353 5804 True 4973.5 8512 97.575500 30 5729 2 chr4B.!!$R2 5699
3 TraesCS7B01G141800 chr4B 603285315 603291329 6014 True 2532.5 3696 94.752500 30 5729 2 chr4B.!!$R1 5699
4 TraesCS7B01G141800 chr3B 39619680 39624540 4860 False 7721.0 7721 95.394000 878 5729 1 chr3B.!!$F1 4851
5 TraesCS7B01G141800 chr3B 754458816 754464651 5835 False 5020.0 8497 98.158000 1 5729 2 chr3B.!!$F2 5728
6 TraesCS7B01G141800 chr2B 658218916 658224721 5805 True 4976.0 8493 97.781000 30 5729 2 chr2B.!!$R3 5699
7 TraesCS7B01G141800 chr2B 19851929 19857763 5834 False 3531.0 5662 95.797000 30 5729 2 chr2B.!!$F2 5699
8 TraesCS7B01G141800 chr2B 512420317 512426314 5997 True 3068.0 7321 95.206667 30 5729 3 chr2B.!!$R2 5699
9 TraesCS7B01G141800 chr2B 670331542 670332914 1372 False 2036.0 2036 93.492000 4271 5641 1 chr2B.!!$F1 1370
10 TraesCS7B01G141800 chrUn 76239208 76244981 5773 False 4679.5 7962 96.249500 30 5729 2 chrUn.!!$F1 5699
11 TraesCS7B01G141800 chr6B 353546471 353550025 3554 True 5694.0 5694 95.517000 2153 5729 1 chr6B.!!$R1 3576
12 TraesCS7B01G141800 chr6B 319457282 319459494 2212 False 1763.5 2154 96.364000 30 2159 2 chr6B.!!$F1 2129
13 TraesCS7B01G141800 chr4A 713787789 713792540 4751 True 2562.0 4163 96.481000 30 4637 3 chr4A.!!$R1 4607

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
880 980 3.445450 TGTTGTTTGCTTGCCTGAGTTTA 59.555 39.130 0.00 0.00 0.0 2.01 F
1271 1372 1.897423 CTGCAGGTGATACCGGTGA 59.103 57.895 19.93 1.17 44.9 4.02 F
3063 3244 5.474578 TGATGAAGTATGAGGCTATGACC 57.525 43.478 0.00 0.00 0.0 4.02 F
4124 4527 0.872021 CGATCTAGTTCTGCACCGCC 60.872 60.000 0.00 0.00 0.0 6.13 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2705 2886 0.035152 TGACTGCCCATGCCTGTTAG 60.035 55.0 0.00 0.00 36.33 2.34 R
3162 3343 0.038166 GGACAGCATTGAACCCCTCA 59.962 55.0 0.00 0.00 0.00 3.86 R
4486 4890 2.661840 TAGGTTGTGTTTGCCGCGGA 62.662 55.0 33.48 11.82 0.00 5.54 R
5533 6140 0.396695 AGCAAATGGATGGGAGGCAG 60.397 55.0 0.00 0.00 0.00 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
84 85 6.991938 TGTTTCCATTATTCCTTGGTTTCAG 58.008 36.000 0.00 0.00 34.48 3.02
295 299 7.975616 CCAACAAGAAAATCCATATACCAACAG 59.024 37.037 0.00 0.00 0.00 3.16
600 605 5.163364 TGCTTGCTTTCCCAAAAATCAACTA 60.163 36.000 0.00 0.00 0.00 2.24
880 980 3.445450 TGTTGTTTGCTTGCCTGAGTTTA 59.555 39.130 0.00 0.00 0.00 2.01
1271 1372 1.897423 CTGCAGGTGATACCGGTGA 59.103 57.895 19.93 1.17 44.90 4.02
1451 1552 7.461749 AGTTCAAGGAAGGATATGAAAACTGA 58.538 34.615 0.00 0.00 33.93 3.41
3063 3244 5.474578 TGATGAAGTATGAGGCTATGACC 57.525 43.478 0.00 0.00 0.00 4.02
4124 4527 0.872021 CGATCTAGTTCTGCACCGCC 60.872 60.000 0.00 0.00 0.00 6.13
4165 4568 4.537751 ACTAGCTGGCAACTCTATGAGTA 58.462 43.478 0.00 0.00 42.59 2.59
4236 4639 1.432024 ACTGTACCACTACCCAGGAGT 59.568 52.381 0.00 0.00 0.00 3.85
5367 5961 3.501445 CCAAAGAGTTCAGAAAGGAGCAG 59.499 47.826 0.00 0.00 0.00 4.24
5472 6079 0.753479 ATTGGCGTTGTCAACCCACA 60.753 50.000 19.58 10.23 33.40 4.17
5560 6167 1.331756 CCATCCATTTGCTAGCGTCAC 59.668 52.381 10.77 0.00 0.00 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 8.059461 TCTTTCTCTAGTTTTCCCCTTCTTTTT 58.941 33.333 0.00 0.00 0.00 1.94
308 312 5.741510 CAGTATGTTTTGAAGCAACGTTTCA 59.258 36.000 0.00 0.00 33.00 2.69
585 590 5.124776 CGCAGGTAATAGTTGATTTTTGGGA 59.875 40.000 0.00 0.00 0.00 4.37
880 980 1.060163 ACACCTACCCCAAGCACACT 61.060 55.000 0.00 0.00 0.00 3.55
1271 1372 2.962421 CCCAAACCATTACCAACAGTGT 59.038 45.455 0.00 0.00 0.00 3.55
1451 1552 7.404671 ACAAACTGTTGTTTTATCAACTCCT 57.595 32.000 10.18 0.00 46.01 3.69
2705 2886 0.035152 TGACTGCCCATGCCTGTTAG 60.035 55.000 0.00 0.00 36.33 2.34
3162 3343 0.038166 GGACAGCATTGAACCCCTCA 59.962 55.000 0.00 0.00 0.00 3.86
3608 3970 6.294010 CCATCTTCTAAGTATGTACTGCGCTA 60.294 42.308 9.73 0.00 36.50 4.26
4026 4429 4.344102 TCACTAGTTGCCTGAGTGTTACTT 59.656 41.667 0.00 0.00 41.14 2.24
4165 4568 2.958355 CTGTTTGTTGGTGTCCATCCTT 59.042 45.455 0.00 0.00 31.53 3.36
4486 4890 2.661840 TAGGTTGTGTTTGCCGCGGA 62.662 55.000 33.48 11.82 0.00 5.54
5367 5961 7.062605 CCATGTAAATGCATGTCTTGTTTTCTC 59.937 37.037 0.00 0.00 43.33 2.87
5472 6079 6.942576 AGCATAAGGAAACAGTTGACTAATGT 59.057 34.615 0.00 0.00 0.00 2.71
5533 6140 0.396695 AGCAAATGGATGGGAGGCAG 60.397 55.000 0.00 0.00 0.00 4.85
5560 6167 4.219033 GTTCGACTATGGTGTTTTTGCTG 58.781 43.478 0.00 0.00 0.00 4.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.