Multiple sequence alignment - TraesCS7B01G121000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G121000 chr7B 100.000 5174 0 0 1 5174 141076150 141070977 0.000000e+00 9555.0
1 TraesCS7B01G121000 chr7B 87.738 367 32 8 4503 4857 305467401 305467766 2.880000e-112 416.0
2 TraesCS7B01G121000 chr7B 90.351 114 10 1 3175 3288 141072908 141072796 1.160000e-31 148.0
3 TraesCS7B01G121000 chr7B 90.351 114 10 1 3243 3355 141072976 141072863 1.160000e-31 148.0
4 TraesCS7B01G121000 chr3B 99.690 3866 11 1 1 3865 378724137 378720272 0.000000e+00 7071.0
5 TraesCS7B01G121000 chr3B 99.294 708 4 1 3857 4564 378720120 378719414 0.000000e+00 1279.0
6 TraesCS7B01G121000 chr3B 96.727 611 20 0 4564 5174 382289927 382289317 0.000000e+00 1018.0
7 TraesCS7B01G121000 chr3B 96.727 611 20 0 4564 5174 570307915 570307305 0.000000e+00 1018.0
8 TraesCS7B01G121000 chr3B 87.675 714 76 9 343 1052 286887835 286887130 0.000000e+00 821.0
9 TraesCS7B01G121000 chr3B 90.136 588 45 10 1955 2534 662981051 662981633 0.000000e+00 752.0
10 TraesCS7B01G121000 chr3B 89.744 585 50 8 1955 2534 512421147 512421726 0.000000e+00 739.0
11 TraesCS7B01G121000 chr3B 89.418 567 51 7 1958 2520 512419412 512419973 0.000000e+00 706.0
12 TraesCS7B01G121000 chr3B 84.181 531 49 18 3562 4063 277659002 277659526 2.800000e-132 483.0
13 TraesCS7B01G121000 chr3B 79.454 696 100 29 4503 5174 608373946 608374622 2.200000e-123 453.0
14 TraesCS7B01G121000 chr3B 85.897 390 45 7 1562 1942 101254620 101254232 1.730000e-109 407.0
15 TraesCS7B01G121000 chr3B 85.233 386 50 6 1563 1942 393843325 393843709 1.750000e-104 390.0
16 TraesCS7B01G121000 chr3B 83.938 386 55 6 1563 1942 324237147 324236763 3.810000e-96 363.0
17 TraesCS7B01G121000 chr3B 89.057 265 26 3 4504 4766 545859948 545860211 5.000000e-85 326.0
18 TraesCS7B01G121000 chr3B 81.515 330 46 5 1157 1471 665342545 665342216 1.850000e-64 257.0
19 TraesCS7B01G121000 chr3B 78.827 392 54 15 4060 4428 277659699 277660084 2.410000e-58 237.0
20 TraesCS7B01G121000 chr3B 90.351 114 10 1 3175 3288 378720895 378720783 1.160000e-31 148.0
21 TraesCS7B01G121000 chr3B 90.351 114 10 1 3243 3355 378720963 378720850 1.160000e-31 148.0
22 TraesCS7B01G121000 chr3B 88.506 87 10 0 2536 2622 512420093 512420179 7.090000e-19 106.0
23 TraesCS7B01G121000 chr3B 94.737 38 2 0 1904 1941 674395242 674395205 5.600000e-05 60.2
24 TraesCS7B01G121000 chr1B 97.381 611 15 1 4564 5174 277175477 277174868 0.000000e+00 1038.0
25 TraesCS7B01G121000 chr1B 97.054 611 18 0 4564 5174 273593055 273593665 0.000000e+00 1029.0
26 TraesCS7B01G121000 chr1B 96.711 608 20 0 4564 5171 330354483 330355090 0.000000e+00 1013.0
27 TraesCS7B01G121000 chr1B 88.766 632 59 9 3353 3978 192689986 192689361 0.000000e+00 763.0
28 TraesCS7B01G121000 chr1B 88.818 626 61 6 3353 3976 117569949 117570567 0.000000e+00 760.0
29 TraesCS7B01G121000 chr1B 79.480 692 108 28 4503 5172 399295252 399294573 1.310000e-125 460.0
30 TraesCS7B01G121000 chr1B 88.108 370 32 6 1552 1909 117568784 117569153 3.700000e-116 429.0
31 TraesCS7B01G121000 chr1B 77.586 696 111 33 4503 5172 447844195 447844871 3.780000e-101 379.0
32 TraesCS7B01G121000 chr1B 86.926 283 35 2 4484 4765 527002607 527002888 3.010000e-82 316.0
33 TraesCS7B01G121000 chr1B 79.124 388 45 17 4066 4428 192689087 192688711 8.660000e-58 235.0
34 TraesCS7B01G121000 chr1B 82.721 272 27 8 1286 1538 538916176 538916446 1.870000e-54 224.0
35 TraesCS7B01G121000 chr1B 80.515 272 33 8 1286 1538 117568380 117568650 1.900000e-44 191.0
36 TraesCS7B01G121000 chr1B 92.941 85 6 0 3980 4064 192689332 192689248 1.960000e-24 124.0
37 TraesCS7B01G121000 chr6B 97.039 608 18 0 4564 5171 548153966 548154573 0.000000e+00 1024.0
38 TraesCS7B01G121000 chr6B 85.802 810 94 13 343 1147 328339459 328340252 0.000000e+00 839.0
39 TraesCS7B01G121000 chr6B 89.189 629 59 6 3353 3978 393761541 393762163 0.000000e+00 776.0
40 TraesCS7B01G121000 chr6B 88.871 629 59 8 3353 3978 207720675 207720055 0.000000e+00 763.0
41 TraesCS7B01G121000 chr6B 81.818 275 30 8 1286 1541 207735339 207735066 4.060000e-51 213.0
42 TraesCS7B01G121000 chr6B 92.941 85 6 0 3980 4064 393762192 393762276 1.960000e-24 124.0
43 TraesCS7B01G121000 chr6B 91.011 89 7 1 3977 4064 207720030 207719942 9.100000e-23 119.0
44 TraesCS7B01G121000 chr5B 96.890 611 19 0 4564 5174 179210316 179209706 0.000000e+00 1024.0
45 TraesCS7B01G121000 chr5B 96.711 608 20 0 4564 5171 216871600 216872207 0.000000e+00 1013.0
46 TraesCS7B01G121000 chr5B 84.011 369 53 5 1563 1925 208767713 208767345 2.960000e-92 350.0
47 TraesCS7B01G121000 chr4B 96.875 608 19 0 4564 5171 431011653 431012260 0.000000e+00 1018.0
48 TraesCS7B01G121000 chr4B 87.082 658 68 8 493 1147 421859149 421858506 0.000000e+00 728.0
49 TraesCS7B01G121000 chr4B 85.195 743 68 25 3353 4064 414452771 414452040 0.000000e+00 725.0
50 TraesCS7B01G121000 chr4B 86.792 212 19 8 4503 4709 491005853 491005646 1.450000e-55 228.0
51 TraesCS7B01G121000 chr4B 82.329 249 24 8 1312 1541 421858338 421858091 1.140000e-46 198.0
52 TraesCS7B01G121000 chr1A 88.243 808 77 9 343 1147 176409926 176410718 0.000000e+00 950.0
53 TraesCS7B01G121000 chr1A 84.770 348 39 11 4503 4843 424763464 424763804 2.310000e-88 337.0
54 TraesCS7B01G121000 chr1A 81.784 269 27 10 1290 1538 176410856 176411122 6.790000e-49 206.0
55 TraesCS7B01G121000 chr1A 97.368 38 1 0 4104 4141 336001558 336001595 1.200000e-06 65.8
56 TraesCS7B01G121000 chr3A 88.119 808 78 7 343 1147 296899701 296900493 0.000000e+00 944.0
57 TraesCS7B01G121000 chr3A 78.211 693 125 21 4503 5174 244425174 244424487 2.230000e-113 420.0
58 TraesCS7B01G121000 chr3A 87.923 207 20 3 1550 1752 442906601 442906396 6.700000e-59 239.0
59 TraesCS7B01G121000 chr3A 81.250 272 31 8 1286 1538 296900627 296900897 8.780000e-48 202.0
60 TraesCS7B01G121000 chr6D 88.265 784 78 8 343 1118 16117269 16118046 0.000000e+00 926.0
61 TraesCS7B01G121000 chr6D 89.491 609 54 7 3353 3959 16119766 16120366 0.000000e+00 761.0
62 TraesCS7B01G121000 chr6D 82.864 391 44 11 4060 4428 16120564 16120953 3.860000e-86 329.0
63 TraesCS7B01G121000 chr6D 83.088 272 26 8 1286 1538 16118199 16118469 4.030000e-56 230.0
64 TraesCS7B01G121000 chr7A 87.407 810 82 10 343 1147 629779580 629778786 0.000000e+00 913.0
65 TraesCS7B01G121000 chr7A 87.671 730 65 9 3353 4064 308455312 308456034 0.000000e+00 826.0
66 TraesCS7B01G121000 chr7A 85.714 742 65 24 3353 4064 629776898 629776168 0.000000e+00 745.0
67 TraesCS7B01G121000 chr7A 84.709 412 43 9 1149 1541 629778729 629778319 1.350000e-105 394.0
68 TraesCS7B01G121000 chr7A 86.466 133 13 3 4287 4419 221745010 221744883 1.940000e-29 141.0
69 TraesCS7B01G121000 chr5D 89.633 627 56 6 3355 3978 249151133 249150513 0.000000e+00 789.0
70 TraesCS7B01G121000 chr5D 80.856 397 50 13 4060 4434 249150230 249149838 6.560000e-74 289.0
71 TraesCS7B01G121000 chr5D 92.941 85 6 0 3980 4064 249150484 249150400 1.960000e-24 124.0
72 TraesCS7B01G121000 chr3D 88.871 629 60 7 3353 3978 256145202 256144581 0.000000e+00 765.0
73 TraesCS7B01G121000 chr3D 80.925 346 48 8 1144 1471 503994951 503994606 1.850000e-64 257.0
74 TraesCS7B01G121000 chr3D 92.941 85 6 0 3980 4064 256144552 256144468 1.960000e-24 124.0
75 TraesCS7B01G121000 chr3D 100.000 39 0 0 1903 1941 503994076 503994038 7.190000e-09 73.1
76 TraesCS7B01G121000 chr3D 92.157 51 4 0 2732 2782 590285463 590285413 7.190000e-09 73.1
77 TraesCS7B01G121000 chrUn 88.172 372 40 3 748 1118 286669929 286670297 1.710000e-119 440.0
78 TraesCS7B01G121000 chr2B 83.938 386 55 6 1563 1942 357882134 357882518 3.810000e-96 363.0
79 TraesCS7B01G121000 chr2B 88.000 275 29 2 1550 1821 711218075 711217802 6.460000e-84 322.0
80 TraesCS7B01G121000 chr2B 77.919 394 47 20 4060 4428 220362637 220363015 5.250000e-50 209.0
81 TraesCS7B01G121000 chr2D 82.921 404 46 11 1551 1942 117193747 117193355 4.960000e-90 342.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G121000 chr7B 141070977 141076150 5173 True 3283.666667 9555 93.567333 1 5174 3 chr7B.!!$R1 5173
1 TraesCS7B01G121000 chr3B 378719414 378724137 4723 True 2161.500000 7071 94.921500 1 4564 4 chr3B.!!$R8 4563
2 TraesCS7B01G121000 chr3B 382289317 382289927 610 True 1018.000000 1018 96.727000 4564 5174 1 chr3B.!!$R4 610
3 TraesCS7B01G121000 chr3B 570307305 570307915 610 True 1018.000000 1018 96.727000 4564 5174 1 chr3B.!!$R5 610
4 TraesCS7B01G121000 chr3B 286887130 286887835 705 True 821.000000 821 87.675000 343 1052 1 chr3B.!!$R2 709
5 TraesCS7B01G121000 chr3B 662981051 662981633 582 False 752.000000 752 90.136000 1955 2534 1 chr3B.!!$F4 579
6 TraesCS7B01G121000 chr3B 512419412 512421726 2314 False 517.000000 739 89.222667 1955 2622 3 chr3B.!!$F6 667
7 TraesCS7B01G121000 chr3B 608373946 608374622 676 False 453.000000 453 79.454000 4503 5174 1 chr3B.!!$F3 671
8 TraesCS7B01G121000 chr3B 277659002 277660084 1082 False 360.000000 483 81.504000 3562 4428 2 chr3B.!!$F5 866
9 TraesCS7B01G121000 chr1B 277174868 277175477 609 True 1038.000000 1038 97.381000 4564 5174 1 chr1B.!!$R1 610
10 TraesCS7B01G121000 chr1B 273593055 273593665 610 False 1029.000000 1029 97.054000 4564 5174 1 chr1B.!!$F1 610
11 TraesCS7B01G121000 chr1B 330354483 330355090 607 False 1013.000000 1013 96.711000 4564 5171 1 chr1B.!!$F2 607
12 TraesCS7B01G121000 chr1B 117568380 117570567 2187 False 460.000000 760 85.813667 1286 3976 3 chr1B.!!$F6 2690
13 TraesCS7B01G121000 chr1B 399294573 399295252 679 True 460.000000 460 79.480000 4503 5172 1 chr1B.!!$R2 669
14 TraesCS7B01G121000 chr1B 447844195 447844871 676 False 379.000000 379 77.586000 4503 5172 1 chr1B.!!$F3 669
15 TraesCS7B01G121000 chr1B 192688711 192689986 1275 True 374.000000 763 86.943667 3353 4428 3 chr1B.!!$R3 1075
16 TraesCS7B01G121000 chr6B 548153966 548154573 607 False 1024.000000 1024 97.039000 4564 5171 1 chr6B.!!$F2 607
17 TraesCS7B01G121000 chr6B 328339459 328340252 793 False 839.000000 839 85.802000 343 1147 1 chr6B.!!$F1 804
18 TraesCS7B01G121000 chr6B 393761541 393762276 735 False 450.000000 776 91.065000 3353 4064 2 chr6B.!!$F3 711
19 TraesCS7B01G121000 chr6B 207719942 207720675 733 True 441.000000 763 89.941000 3353 4064 2 chr6B.!!$R2 711
20 TraesCS7B01G121000 chr5B 179209706 179210316 610 True 1024.000000 1024 96.890000 4564 5174 1 chr5B.!!$R1 610
21 TraesCS7B01G121000 chr5B 216871600 216872207 607 False 1013.000000 1013 96.711000 4564 5171 1 chr5B.!!$F1 607
22 TraesCS7B01G121000 chr4B 431011653 431012260 607 False 1018.000000 1018 96.875000 4564 5171 1 chr4B.!!$F1 607
23 TraesCS7B01G121000 chr4B 414452040 414452771 731 True 725.000000 725 85.195000 3353 4064 1 chr4B.!!$R1 711
24 TraesCS7B01G121000 chr4B 421858091 421859149 1058 True 463.000000 728 84.705500 493 1541 2 chr4B.!!$R3 1048
25 TraesCS7B01G121000 chr1A 176409926 176411122 1196 False 578.000000 950 85.013500 343 1538 2 chr1A.!!$F3 1195
26 TraesCS7B01G121000 chr3A 296899701 296900897 1196 False 573.000000 944 84.684500 343 1538 2 chr3A.!!$F1 1195
27 TraesCS7B01G121000 chr3A 244424487 244425174 687 True 420.000000 420 78.211000 4503 5174 1 chr3A.!!$R1 671
28 TraesCS7B01G121000 chr6D 16117269 16120953 3684 False 561.500000 926 85.927000 343 4428 4 chr6D.!!$F1 4085
29 TraesCS7B01G121000 chr7A 308455312 308456034 722 False 826.000000 826 87.671000 3353 4064 1 chr7A.!!$F1 711
30 TraesCS7B01G121000 chr7A 629776168 629779580 3412 True 684.000000 913 85.943333 343 4064 3 chr7A.!!$R2 3721
31 TraesCS7B01G121000 chr5D 249149838 249151133 1295 True 400.666667 789 87.810000 3355 4434 3 chr5D.!!$R1 1079
32 TraesCS7B01G121000 chr3D 256144468 256145202 734 True 444.500000 765 90.906000 3353 4064 2 chr3D.!!$R2 711

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
716 727 7.831691 TTTGAGGTTGTTTGAATCCATTAGA 57.168 32.0 0.00 0.0 0.00 2.10 F
2040 4287 0.240145 ACGAAGTCGAGACGCATTCA 59.760 50.0 7.87 0.0 29.74 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3830 6239 1.207329 GCCCACTGATCCGAGTAAACT 59.793 52.381 0.0 0.0 0.0 2.66 R
4758 7566 0.036765 TCACACTTCCGCATGTACCC 60.037 55.000 0.0 0.0 0.0 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
716 727 7.831691 TTTGAGGTTGTTTGAATCCATTAGA 57.168 32.000 0.00 0.00 0.00 2.10
2040 4287 0.240145 ACGAAGTCGAGACGCATTCA 59.760 50.000 7.87 0.00 29.74 2.57
2561 4809 9.598517 GAAGATATGTCAAGTTCTCTGAATCTT 57.401 33.333 0.00 0.00 33.81 2.40
3830 6239 6.698008 TCTCTTTTCAACATTGAAGAAGCA 57.302 33.333 16.31 8.72 46.68 3.91
4155 6946 4.104383 TGCCTCCATCAGAGAAGTTTTT 57.896 40.909 0.00 0.00 46.50 1.94
4277 7082 0.459585 TAGTGCGCGCTTTTCCTAGG 60.460 55.000 33.29 0.82 0.00 3.02
4512 7318 7.830940 AATAATGCATTTTCTTTTCATCGCA 57.169 28.000 18.75 0.00 0.00 5.10
4897 7744 3.056250 TGTGCAAACAAGCTTTCAAAGGA 60.056 39.130 0.00 0.00 34.99 3.36
4973 7828 0.107312 TAGACGGAGGAAGGAGACGG 60.107 60.000 0.00 0.00 0.00 4.79
5105 7976 4.030913 AGGACTTGGTCGATGATAAAGGA 58.969 43.478 0.00 0.00 32.65 3.36
5142 8013 5.419542 GGCTTGAGTTTGTCCTTTTTCTTT 58.580 37.500 0.00 0.00 0.00 2.52
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
716 727 7.554118 CCTAGATGATGGTTAGAACATTGTGTT 59.446 37.037 0.00 0.00 44.37 3.32
3830 6239 1.207329 GCCCACTGATCCGAGTAAACT 59.793 52.381 0.00 0.00 0.00 2.66
4649 7456 1.068127 GTTCGGCTAGGCGATAAAGGA 59.932 52.381 37.48 21.55 0.00 3.36
4758 7566 0.036765 TCACACTTCCGCATGTACCC 60.037 55.000 0.00 0.00 0.00 3.69
4897 7744 4.901785 TCTCCCTCCTTTCCTACTACAT 57.098 45.455 0.00 0.00 0.00 2.29
4973 7828 0.318275 CTAGCGCCGGATTCTGAGTC 60.318 60.000 5.05 0.00 0.00 3.36
5114 7985 2.031870 AGGACAAACTCAAGCCCAAAC 58.968 47.619 0.00 0.00 0.00 2.93
5142 8013 0.966875 TAGTTCTACGCCTGCCGGAA 60.967 55.000 5.05 0.00 42.52 4.30


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.