Multiple sequence alignment - TraesCS7B01G118000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G118000 chr7B 100.000 2711 0 0 1 2711 137682778 137685488 0 5007
1 TraesCS7B01G118000 chr7B 96.414 1004 35 1 1708 2711 529799676 529800678 0 1653
2 TraesCS7B01G118000 chr3A 98.834 1715 19 1 1 1714 105560599 105558885 0 3055
3 TraesCS7B01G118000 chr1A 98.778 1719 16 2 1 1714 554478615 554480333 0 3053
4 TraesCS7B01G118000 chr1B 98.134 1715 26 4 1 1714 633713343 633715052 0 2985
5 TraesCS7B01G118000 chr1B 93.994 1715 89 10 1 1714 427665007 427663306 0 2584
6 TraesCS7B01G118000 chr1B 96.315 1004 36 1 1708 2711 329664456 329665458 0 1648
7 TraesCS7B01G118000 chr1B 96.315 1004 35 2 1708 2711 423533909 423534910 0 1648
8 TraesCS7B01G118000 chr6B 97.788 1718 33 3 1 1714 18741909 18740193 0 2957
9 TraesCS7B01G118000 chr6B 96.318 1005 35 2 1708 2711 542610320 542609317 0 1650
10 TraesCS7B01G118000 chr1D 96.674 1714 50 5 1 1714 51835585 51833879 0 2843
11 TraesCS7B01G118000 chr4A 96.214 1717 58 6 1 1714 309450025 309448313 0 2804
12 TraesCS7B01G118000 chrUn 98.977 1564 16 0 80 1643 388893553 388895116 0 2800
13 TraesCS7B01G118000 chr4D 95.553 1709 65 7 7 1714 206973238 206971540 0 2724
14 TraesCS7B01G118000 chr5B 96.912 1004 30 1 1708 2711 177703967 177702965 0 1681
15 TraesCS7B01G118000 chr5B 96.816 1005 30 2 1708 2711 512872325 512871322 0 1677
16 TraesCS7B01G118000 chr5B 96.800 1000 32 0 1712 2711 71889618 71890617 0 1670
17 TraesCS7B01G118000 chr4B 96.614 1004 33 1 1708 2711 174969629 174968627 0 1664
18 TraesCS7B01G118000 chr3B 96.614 1004 33 1 1708 2711 172371375 172372377 0 1664


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G118000 chr7B 137682778 137685488 2710 False 5007 5007 100.000 1 2711 1 chr7B.!!$F1 2710
1 TraesCS7B01G118000 chr7B 529799676 529800678 1002 False 1653 1653 96.414 1708 2711 1 chr7B.!!$F2 1003
2 TraesCS7B01G118000 chr3A 105558885 105560599 1714 True 3055 3055 98.834 1 1714 1 chr3A.!!$R1 1713
3 TraesCS7B01G118000 chr1A 554478615 554480333 1718 False 3053 3053 98.778 1 1714 1 chr1A.!!$F1 1713
4 TraesCS7B01G118000 chr1B 633713343 633715052 1709 False 2985 2985 98.134 1 1714 1 chr1B.!!$F3 1713
5 TraesCS7B01G118000 chr1B 427663306 427665007 1701 True 2584 2584 93.994 1 1714 1 chr1B.!!$R1 1713
6 TraesCS7B01G118000 chr1B 329664456 329665458 1002 False 1648 1648 96.315 1708 2711 1 chr1B.!!$F1 1003
7 TraesCS7B01G118000 chr1B 423533909 423534910 1001 False 1648 1648 96.315 1708 2711 1 chr1B.!!$F2 1003
8 TraesCS7B01G118000 chr6B 18740193 18741909 1716 True 2957 2957 97.788 1 1714 1 chr6B.!!$R1 1713
9 TraesCS7B01G118000 chr6B 542609317 542610320 1003 True 1650 1650 96.318 1708 2711 1 chr6B.!!$R2 1003
10 TraesCS7B01G118000 chr1D 51833879 51835585 1706 True 2843 2843 96.674 1 1714 1 chr1D.!!$R1 1713
11 TraesCS7B01G118000 chr4A 309448313 309450025 1712 True 2804 2804 96.214 1 1714 1 chr4A.!!$R1 1713
12 TraesCS7B01G118000 chrUn 388893553 388895116 1563 False 2800 2800 98.977 80 1643 1 chrUn.!!$F1 1563
13 TraesCS7B01G118000 chr4D 206971540 206973238 1698 True 2724 2724 95.553 7 1714 1 chr4D.!!$R1 1707
14 TraesCS7B01G118000 chr5B 177702965 177703967 1002 True 1681 1681 96.912 1708 2711 1 chr5B.!!$R1 1003
15 TraesCS7B01G118000 chr5B 512871322 512872325 1003 True 1677 1677 96.816 1708 2711 1 chr5B.!!$R2 1003
16 TraesCS7B01G118000 chr5B 71889618 71890617 999 False 1670 1670 96.800 1712 2711 1 chr5B.!!$F1 999
17 TraesCS7B01G118000 chr4B 174968627 174969629 1002 True 1664 1664 96.614 1708 2711 1 chr4B.!!$R1 1003
18 TraesCS7B01G118000 chr3B 172371375 172372377 1002 False 1664 1664 96.614 1708 2711 1 chr3B.!!$F1 1003

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
325 326 3.435186 GCAGGGCGAGCTTTGGAC 61.435 66.667 0.0 0.0 0.00 4.02 F
352 353 9.239002 GAATCGATCTATTATCGGGTAATCTTG 57.761 37.037 0.0 0.0 41.45 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1260 1281 0.733150 GACAACGAGCCCTTATTGCC 59.267 55.000 0.0 0.0 0.00 4.52 R
1997 2020 1.754803 CCACTAGACTGCGGGTGATAA 59.245 52.381 0.0 0.0 32.12 1.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
325 326 3.435186 GCAGGGCGAGCTTTGGAC 61.435 66.667 0.00 0.00 0.00 4.02
352 353 9.239002 GAATCGATCTATTATCGGGTAATCTTG 57.761 37.037 0.00 0.00 41.45 3.02
653 665 9.706691 ATTAGTTTCTTCAGATTCTGACGTAAA 57.293 29.630 15.90 12.79 40.46 2.01
1846 1868 4.737855 TTCCAACTAGTAGTGCTGATCC 57.262 45.455 2.90 0.00 0.00 3.36
1963 1986 2.742053 GTGCTTTCCGTAAGATGCTTGA 59.258 45.455 0.00 0.00 43.02 3.02
1997 2020 7.083062 TGTTAATCATAGGATTGCATCTCCT 57.917 36.000 19.15 19.15 43.47 3.69
2018 2041 0.324368 ATCACCCGCAGTCTAGTGGA 60.324 55.000 0.00 0.00 41.75 4.02
2136 2160 4.256920 GTGGGCCTATAGAACTGCATATG 58.743 47.826 4.53 0.00 0.00 1.78
2342 2366 9.489393 GAAAATGCCAAGTTGTTTAAAGAAAAG 57.511 29.630 0.00 0.00 0.00 2.27
2377 2401 5.229423 GCATGACAAAAGGATACAAAAGCA 58.771 37.500 0.00 0.00 41.41 3.91
2387 2411 9.476202 AAAAGGATACAAAAGCATGAGTTTAAC 57.524 29.630 0.00 0.00 41.41 2.01
2642 2666 6.602009 CGGAGGAATAAATAAGGGACACTTTT 59.398 38.462 0.00 0.00 40.64 2.27
2655 2679 4.340950 GGGACACTTTTCAGAATGTTCCAA 59.659 41.667 7.59 0.00 40.08 3.53
2695 2719 5.716703 AGGTATGTGGTACGGTAAGTAAACT 59.283 40.000 0.00 0.00 37.02 2.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
9 10 7.094634 CGAGATTCGGGGATAATGAATCAATTT 60.095 37.037 14.44 0.00 46.56 1.82
325 326 7.640852 AGATTACCCGATAATAGATCGATTCG 58.359 38.462 4.16 3.47 43.59 3.34
352 353 2.496070 GGAAGCCCTTGTTATTCCCAAC 59.504 50.000 0.00 0.00 36.08 3.77
381 382 5.314923 TGCTTCAGATATGAAACTTTGGC 57.685 39.130 4.06 3.76 0.00 4.52
1260 1281 0.733150 GACAACGAGCCCTTATTGCC 59.267 55.000 0.00 0.00 0.00 4.52
1885 1908 3.491766 ATCTAGGGACTCCAAACCTCA 57.508 47.619 0.00 0.00 41.75 3.86
1997 2020 1.754803 CCACTAGACTGCGGGTGATAA 59.245 52.381 0.00 0.00 32.12 1.75
2018 2041 6.685116 GCTCTCTATTGCTCAATTCTACCTGT 60.685 42.308 0.00 0.00 32.50 4.00
2051 2074 7.147976 ACCTATTGACAGTCTTTTGCAAAATC 58.852 34.615 24.06 17.96 0.00 2.17
2114 2138 2.938956 ATGCAGTTCTATAGGCCCAC 57.061 50.000 0.00 0.00 0.00 4.61
2136 2160 5.221661 ACGGAGACATACCCATAGGATTTTC 60.222 44.000 0.00 0.00 36.73 2.29
2285 2309 4.018141 TGGGTTCTCCATTCATCAAGTGAT 60.018 41.667 0.00 0.00 41.46 3.06
2342 2366 5.639082 CCTTTTGTCATGCCATCTTTTAACC 59.361 40.000 0.00 0.00 0.00 2.85
2387 2411 9.634163 TTGTATAGCAATACATAATCACCTACG 57.366 33.333 0.00 0.00 45.67 3.51
2627 2651 7.039714 GGAACATTCTGAAAAGTGTCCCTTATT 60.040 37.037 0.00 0.00 31.48 1.40
2642 2666 3.762407 TCGGAGTTTGGAACATTCTGA 57.238 42.857 0.00 0.00 39.30 3.27
2655 2679 6.113411 CACATACCTATTCCTTTTCGGAGTT 58.887 40.000 0.00 0.00 44.28 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.