Multiple sequence alignment - TraesCS7B01G117900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G117900 chr7B 100.000 2348 0 0 1 2348 137682032 137684379 0.000000e+00 4337
1 TraesCS7B01G117900 chr7B 98.542 480 6 1 431 909 663105627 663106106 0.000000e+00 846
2 TraesCS7B01G117900 chr7B 98.826 426 5 0 1 426 663104954 663105379 0.000000e+00 760
3 TraesCS7B01G117900 chr1A 98.701 1924 19 3 431 2348 554478298 554480221 0.000000e+00 3410
4 TraesCS7B01G117900 chr1A 99.296 426 3 0 1 426 554477611 554478036 0.000000e+00 771
5 TraesCS7B01G117900 chr1B 98.177 1920 28 5 431 2348 633713026 633714940 0.000000e+00 3345
6 TraesCS7B01G117900 chr1B 94.789 1919 87 9 431 2348 427665323 427663417 0.000000e+00 2977
7 TraesCS7B01G117900 chr1B 98.826 426 5 0 1 426 633712339 633712764 0.000000e+00 760
8 TraesCS7B01G117900 chr6B 97.920 1923 34 4 431 2348 18742226 18740305 0.000000e+00 3325
9 TraesCS7B01G117900 chr6B 98.826 426 5 0 1 426 18742913 18742488 0.000000e+00 760
10 TraesCS7B01G117900 chr4A 96.720 1921 56 6 431 2348 309450341 309448425 0.000000e+00 3192
11 TraesCS7B01G117900 chr4A 97.414 116 3 0 2233 2348 365759891 365760006 5.120000e-47 198
12 TraesCS7B01G117900 chr1D 96.717 1919 54 8 431 2348 51835901 51833991 0.000000e+00 3186
13 TraesCS7B01G117900 chr1D 99.041 417 4 0 10 426 446738265 446738681 0.000000e+00 749
14 TraesCS7B01G117900 chr4D 95.521 1920 74 8 431 2348 206973561 206971652 0.000000e+00 3059
15 TraesCS7B01G117900 chr3A 98.746 1674 20 1 676 2348 105560670 105558997 0.000000e+00 2974
16 TraesCS7B01G117900 chr6D 96.196 1630 50 7 468 2097 210719304 210720921 0.000000e+00 2656
17 TraesCS7B01G117900 chrUn 98.826 426 5 0 1 426 387441124 387440699 0.000000e+00 760
18 TraesCS7B01G117900 chr5D 98.592 426 6 0 1 426 503309044 503309469 0.000000e+00 754
19 TraesCS7B01G117900 chr5D 98.357 426 7 0 1 426 6257731 6257306 0.000000e+00 749
20 TraesCS7B01G117900 chr5D 98.118 425 8 0 1 425 503331660 503332084 0.000000e+00 741
21 TraesCS7B01G117900 chr2A 97.884 189 4 0 2160 2348 626014073 626014261 6.260000e-86 327
22 TraesCS7B01G117900 chr2A 100.000 160 0 0 2077 2236 671025127 671024968 1.760000e-76 296


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G117900 chr7B 137682032 137684379 2347 False 4337.0 4337 100.0000 1 2348 1 chr7B.!!$F1 2347
1 TraesCS7B01G117900 chr7B 663104954 663106106 1152 False 803.0 846 98.6840 1 909 2 chr7B.!!$F2 908
2 TraesCS7B01G117900 chr1A 554477611 554480221 2610 False 2090.5 3410 98.9985 1 2348 2 chr1A.!!$F1 2347
3 TraesCS7B01G117900 chr1B 427663417 427665323 1906 True 2977.0 2977 94.7890 431 2348 1 chr1B.!!$R1 1917
4 TraesCS7B01G117900 chr1B 633712339 633714940 2601 False 2052.5 3345 98.5015 1 2348 2 chr1B.!!$F1 2347
5 TraesCS7B01G117900 chr6B 18740305 18742913 2608 True 2042.5 3325 98.3730 1 2348 2 chr6B.!!$R1 2347
6 TraesCS7B01G117900 chr4A 309448425 309450341 1916 True 3192.0 3192 96.7200 431 2348 1 chr4A.!!$R1 1917
7 TraesCS7B01G117900 chr1D 51833991 51835901 1910 True 3186.0 3186 96.7170 431 2348 1 chr1D.!!$R1 1917
8 TraesCS7B01G117900 chr4D 206971652 206973561 1909 True 3059.0 3059 95.5210 431 2348 1 chr4D.!!$R1 1917
9 TraesCS7B01G117900 chr3A 105558997 105560670 1673 True 2974.0 2974 98.7460 676 2348 1 chr3A.!!$R1 1672
10 TraesCS7B01G117900 chr6D 210719304 210720921 1617 False 2656.0 2656 96.1960 468 2097 1 chr6D.!!$F1 1629

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
245 246 2.540383 TGATAGGACAAGTGCAGGACT 58.46 47.619 0.0 0.0 35.94 3.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2006 2285 0.73315 GACAACGAGCCCTTATTGCC 59.267 55.0 0.0 0.0 0.0 4.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
245 246 2.540383 TGATAGGACAAGTGCAGGACT 58.460 47.619 0.00 0.00 35.94 3.85
426 427 9.231297 TCTCGAATTGGTTTATTCAAGAATTCT 57.769 29.630 0.88 0.88 34.83 2.40
655 916 7.592885 AATGGTCATTATGGAGAAATCCTTG 57.407 36.000 0.00 0.00 0.00 3.61
755 1016 3.889196 ACAAATCTTTGAAGCGCGTTA 57.111 38.095 8.43 0.00 40.55 3.18
1071 1332 3.435186 GCAGGGCGAGCTTTGGAC 61.435 66.667 0.00 0.00 0.00 4.02
1098 1359 9.239002 GAATCGATCTATTATCGGGTAATCTTG 57.761 37.037 0.00 0.00 41.45 3.02
1399 1671 9.706691 ATTAGTTTCTTCAGATTCTGACGTAAA 57.293 29.630 15.90 12.79 40.46 2.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
245 246 6.351881 GCGATCTAACCTATTATGGGGAATCA 60.352 42.308 0.00 0.00 0.00 2.57
655 916 5.359292 ACGTAACTAACCTATCTCCCTTGTC 59.641 44.000 0.00 0.00 0.00 3.18
755 1016 7.094634 CGAGATTCGGGGATAATGAATCAATTT 60.095 37.037 14.44 0.00 46.56 1.82
1071 1332 7.640852 AGATTACCCGATAATAGATCGATTCG 58.359 38.462 4.16 3.47 43.59 3.34
1098 1359 2.496070 GGAAGCCCTTGTTATTCCCAAC 59.504 50.000 0.00 0.00 36.08 3.77
1127 1388 5.314923 TGCTTCAGATATGAAACTTTGGC 57.685 39.130 4.06 3.76 0.00 4.52
2006 2285 0.733150 GACAACGAGCCCTTATTGCC 59.267 55.000 0.00 0.00 0.00 4.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.