Multiple sequence alignment - TraesCS7B01G115100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G115100 chr7B 100.000 2456 0 0 1 2456 133703932 133706387 0.000000e+00 4536
1 TraesCS7B01G115100 chr7B 99.235 1568 12 0 889 2456 720550067 720551634 0.000000e+00 2830
2 TraesCS7B01G115100 chr7B 99.307 1443 10 0 1014 2456 616407636 616406194 0.000000e+00 2610
3 TraesCS7B01G115100 chr6A 99.410 2203 13 0 254 2456 3633991 3636193 0.000000e+00 3997
4 TraesCS7B01G115100 chr5A 99.487 2144 10 1 313 2456 513705477 513703335 0.000000e+00 3897
5 TraesCS7B01G115100 chr5A 99.283 1814 13 0 643 2456 335710918 335712731 0.000000e+00 3278
6 TraesCS7B01G115100 chr4B 99.383 2108 13 0 349 2456 668870833 668872940 0.000000e+00 3821
7 TraesCS7B01G115100 chr3A 99.428 1923 11 0 534 2456 12635322 12637244 0.000000e+00 3491
8 TraesCS7B01G115100 chr4A 99.283 1673 12 0 784 2456 741026543 741028215 0.000000e+00 3024
9 TraesCS7B01G115100 chr2A 99.395 1322 8 0 1135 2456 750960501 750961822 0.000000e+00 2398
10 TraesCS7B01G115100 chr6B 88.137 1669 153 18 1 1657 674922648 674924283 0.000000e+00 1943
11 TraesCS7B01G115100 chrUn 88.077 1669 154 18 1 1657 315538283 315536648 0.000000e+00 1938
12 TraesCS7B01G115100 chrUn 100.000 581 0 0 1 581 396392211 396391631 0.000000e+00 1074
13 TraesCS7B01G115100 chr7A 88.017 1669 154 19 1 1657 18100605 18098971 0.000000e+00 1932
14 TraesCS7B01G115100 chr5B 89.860 1499 131 8 1 1486 528557619 528559109 0.000000e+00 1906
15 TraesCS7B01G115100 chr1A 91.259 286 25 0 1 286 576245484 576245769 8.230000e-105 390


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G115100 chr7B 133703932 133706387 2455 False 4536 4536 100.000 1 2456 1 chr7B.!!$F1 2455
1 TraesCS7B01G115100 chr7B 720550067 720551634 1567 False 2830 2830 99.235 889 2456 1 chr7B.!!$F2 1567
2 TraesCS7B01G115100 chr7B 616406194 616407636 1442 True 2610 2610 99.307 1014 2456 1 chr7B.!!$R1 1442
3 TraesCS7B01G115100 chr6A 3633991 3636193 2202 False 3997 3997 99.410 254 2456 1 chr6A.!!$F1 2202
4 TraesCS7B01G115100 chr5A 513703335 513705477 2142 True 3897 3897 99.487 313 2456 1 chr5A.!!$R1 2143
5 TraesCS7B01G115100 chr5A 335710918 335712731 1813 False 3278 3278 99.283 643 2456 1 chr5A.!!$F1 1813
6 TraesCS7B01G115100 chr4B 668870833 668872940 2107 False 3821 3821 99.383 349 2456 1 chr4B.!!$F1 2107
7 TraesCS7B01G115100 chr3A 12635322 12637244 1922 False 3491 3491 99.428 534 2456 1 chr3A.!!$F1 1922
8 TraesCS7B01G115100 chr4A 741026543 741028215 1672 False 3024 3024 99.283 784 2456 1 chr4A.!!$F1 1672
9 TraesCS7B01G115100 chr2A 750960501 750961822 1321 False 2398 2398 99.395 1135 2456 1 chr2A.!!$F1 1321
10 TraesCS7B01G115100 chr6B 674922648 674924283 1635 False 1943 1943 88.137 1 1657 1 chr6B.!!$F1 1656
11 TraesCS7B01G115100 chrUn 315536648 315538283 1635 True 1938 1938 88.077 1 1657 1 chrUn.!!$R1 1656
12 TraesCS7B01G115100 chrUn 396391631 396392211 580 True 1074 1074 100.000 1 581 1 chrUn.!!$R2 580
13 TraesCS7B01G115100 chr7A 18098971 18100605 1634 True 1932 1932 88.017 1 1657 1 chr7A.!!$R1 1656
14 TraesCS7B01G115100 chr5B 528557619 528559109 1490 False 1906 1906 89.860 1 1486 1 chr5B.!!$F1 1485

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
593 594 7.806487 GCCAAGTAAGTTATGGTGTTTTAGTTC 59.194 37.037 4.78 0.0 36.57 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1889 1904 7.398332 ACATCCAAAAGCTTCTTGATATCCTTT 59.602 33.333 17.53 0.0 0.0 3.11 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
593 594 7.806487 GCCAAGTAAGTTATGGTGTTTTAGTTC 59.194 37.037 4.78 0.0 36.57 3.01
964 973 8.365060 TGAAGAAGATCAAGAGAAAGAGAGAT 57.635 34.615 0.00 0.0 0.00 2.75
1352 1361 4.572389 GCAACTTGAAGAAGAGACACAAGA 59.428 41.667 0.00 0.0 39.84 3.02
1889 1904 1.236616 CCAGAAATGGCACGTGAGCA 61.237 55.000 22.23 0.0 35.83 4.26
2162 2178 9.840427 GCAATTTTATAACTAATGTGTGTCTGT 57.160 29.630 0.00 0.0 0.00 3.41
2425 2441 3.670627 GCAATTTCGTCCGAGATTTTGCT 60.671 43.478 9.80 0.0 36.40 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
593 594 8.992073 CAAACCAAAAGGAAATGGAAATTCTAG 58.008 33.333 0.00 0.0 39.12 2.43
1352 1361 2.430694 GGTGCCTCCTTTTGAACTTGTT 59.569 45.455 0.00 0.0 0.00 2.83
1889 1904 7.398332 ACATCCAAAAGCTTCTTGATATCCTTT 59.602 33.333 17.53 0.0 0.00 3.11


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.