Multiple sequence alignment - TraesCS7B01G105100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G105100 chr7B 100.000 1871 0 0 1 1871 121241550 121243420 0.000000e+00 3456.0
1 TraesCS7B01G105100 chr7B 98.026 1874 29 7 1 1871 121319793 121321661 0.000000e+00 3249.0
2 TraesCS7B01G105100 chr7B 88.540 1754 119 44 133 1844 121052646 121054359 0.000000e+00 2050.0
3 TraesCS7B01G105100 chr7B 95.545 1010 23 11 873 1871 121166748 121167746 0.000000e+00 1596.0
4 TraesCS7B01G105100 chr7B 95.441 1009 25 10 873 1871 121115422 121116419 0.000000e+00 1589.0
5 TraesCS7B01G105100 chr7B 87.905 1141 95 27 565 1682 121495600 121496720 0.000000e+00 1303.0
6 TraesCS7B01G105100 chr7B 97.932 677 13 1 1 676 121385447 121386123 0.000000e+00 1171.0
7 TraesCS7B01G105100 chr7B 95.268 634 13 7 1229 1851 121386488 121387115 0.000000e+00 989.0
8 TraesCS7B01G105100 chr7B 100.000 327 0 0 2199 2525 121243748 121244074 2.780000e-169 604.0
9 TraesCS7B01G105100 chr7B 96.541 318 11 0 2208 2525 121321915 121322232 6.190000e-146 527.0
10 TraesCS7B01G105100 chr7B 94.495 327 16 1 2199 2525 121387476 121387800 1.040000e-138 503.0
11 TraesCS7B01G105100 chr7B 93.791 306 17 1 2199 2504 121116458 121116761 2.290000e-125 459.0
12 TraesCS7B01G105100 chr7B 93.791 306 17 1 2199 2504 121167785 121168088 2.290000e-125 459.0
13 TraesCS7B01G105100 chr7B 80.305 655 88 20 133 769 121113269 121113900 8.230000e-125 457.0
14 TraesCS7B01G105100 chr7B 80.000 655 90 20 133 769 121164625 121165256 1.780000e-121 446.0
15 TraesCS7B01G105100 chr7B 89.362 329 30 5 2199 2525 121054660 121054985 2.340000e-110 409.0
16 TraesCS7B01G105100 chr7B 97.630 211 2 3 675 885 121386282 121386489 2.390000e-95 359.0
17 TraesCS7B01G105100 chr7B 76.648 364 67 8 66 428 121494298 121494644 4.290000e-43 185.0
18 TraesCS7B01G105100 chr7A 89.239 1366 67 33 338 1661 161279223 161280550 0.000000e+00 1635.0
19 TraesCS7B01G105100 chr7A 88.087 1150 87 32 565 1682 161650189 161651320 0.000000e+00 1319.0
20 TraesCS7B01G105100 chr7A 77.650 349 61 4 66 413 161648340 161648672 1.980000e-46 196.0
21 TraesCS7B01G105100 chr7D 86.568 1556 118 39 177 1680 160486868 160488384 0.000000e+00 1631.0
22 TraesCS7B01G105100 chr7D 88.215 1137 94 25 565 1679 160533721 160534839 0.000000e+00 1321.0
23 TraesCS7B01G105100 chr7D 87.915 331 35 5 2199 2525 160488630 160488959 3.940000e-103 385.0
24 TraesCS7B01G105100 chr7D 76.791 349 62 6 82 428 160532978 160533309 7.180000e-41 178.0
25 TraesCS7B01G105100 chr7D 85.366 123 8 6 1702 1815 160488371 160488492 4.410000e-23 119.0
26 TraesCS7B01G105100 chr7D 91.304 46 4 0 1806 1851 160488513 160488558 2.100000e-06 63.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G105100 chr7B 121241550 121244074 2524 False 2030.000000 3456 100.000000 1 2525 2 chr7B.!!$F4 2524
1 TraesCS7B01G105100 chr7B 121319793 121322232 2439 False 1888.000000 3249 97.283500 1 2525 2 chr7B.!!$F5 2524
2 TraesCS7B01G105100 chr7B 121052646 121054985 2339 False 1229.500000 2050 88.951000 133 2525 2 chr7B.!!$F1 2392
3 TraesCS7B01G105100 chr7B 121113269 121116761 3492 False 835.000000 1589 89.845667 133 2504 3 chr7B.!!$F2 2371
4 TraesCS7B01G105100 chr7B 121164625 121168088 3463 False 833.666667 1596 89.778667 133 2504 3 chr7B.!!$F3 2371
5 TraesCS7B01G105100 chr7B 121385447 121387800 2353 False 755.500000 1171 96.331250 1 2525 4 chr7B.!!$F6 2524
6 TraesCS7B01G105100 chr7B 121494298 121496720 2422 False 744.000000 1303 82.276500 66 1682 2 chr7B.!!$F7 1616
7 TraesCS7B01G105100 chr7A 161279223 161280550 1327 False 1635.000000 1635 89.239000 338 1661 1 chr7A.!!$F1 1323
8 TraesCS7B01G105100 chr7A 161648340 161651320 2980 False 757.500000 1319 82.868500 66 1682 2 chr7A.!!$F2 1616
9 TraesCS7B01G105100 chr7D 160532978 160534839 1861 False 749.500000 1321 82.503000 82 1679 2 chr7D.!!$F2 1597
10 TraesCS7B01G105100 chr7D 160486868 160488959 2091 False 549.725000 1631 87.788250 177 2525 4 chr7D.!!$F1 2348

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
562 2510 1.071699 GAGAACCACCAACCAGTAGCA 59.928 52.381 0.0 0.0 0.0 3.49 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2481 6108 1.953686 GCAAAGCCACAGTAAGAACCA 59.046 47.619 0.0 0.0 0.0 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 4.828939 ACATCAAGAGGAGCATCACAAAAA 59.171 37.500 0.00 0.00 36.25 1.94
198 200 2.104530 TTGCGTTGGTCGTCGTGA 59.895 55.556 0.00 0.00 42.13 4.35
562 2510 1.071699 GAGAACCACCAACCAGTAGCA 59.928 52.381 0.00 0.00 0.00 3.49
881 4421 8.093307 TCTTGCTAGCATCCTTGAAATAGATAG 58.907 37.037 20.13 6.91 0.00 2.08
1682 5250 2.597305 GTGGAGCGTGTAAGTGTAATCG 59.403 50.000 0.00 0.00 0.00 3.34
1686 5254 4.201561 GGAGCGTGTAAGTGTAATCGTTTC 60.202 45.833 0.00 0.00 0.00 2.78
1689 5257 5.464389 AGCGTGTAAGTGTAATCGTTTCTTT 59.536 36.000 0.00 0.00 0.00 2.52
1742 5313 2.226437 ACACGTCCATGCAAATGTCTTC 59.774 45.455 0.00 0.00 0.00 2.87
1750 5321 3.110447 TGCAAATGTCTTCCCTTTTGC 57.890 42.857 11.21 11.21 46.97 3.68
1757 5328 5.876651 ATGTCTTCCCTTTTGCTTTCTTT 57.123 34.783 0.00 0.00 0.00 2.52
1807 5385 8.289618 CGATAACAATAATATTGTGAACCCCTG 58.710 37.037 18.15 1.97 32.22 4.45
2276 5898 7.611213 AAAAATGTCAGAGGTATAACGAAGG 57.389 36.000 0.00 0.00 0.00 3.46
2307 5929 3.243839 TGGGGACTTGAACACGTTACTAC 60.244 47.826 0.00 0.00 0.00 2.73
2317 5939 7.218228 TGAACACGTTACTACCAGAGAAATA 57.782 36.000 0.00 0.00 0.00 1.40
2493 6120 2.949644 GTTTGGCACTGGTTCTTACTGT 59.050 45.455 0.00 0.00 0.00 3.55
2518 6145 7.435784 GTGGCTTTGCTAGAGTAGAAACTATAC 59.564 40.741 0.00 0.00 35.56 1.47
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
31 32 4.022603 TGCATGCATGGTATTAGTGGTTT 58.977 39.130 27.34 0.00 0.00 3.27
37 38 7.401860 GTTACGATATGCATGCATGGTATTAG 58.598 38.462 37.43 23.04 37.82 1.73
164 165 1.915141 CAACCCTGATGAAAGTGGCT 58.085 50.000 0.00 0.00 0.00 4.75
198 200 1.605738 CCAGCCTTGGCAAGAGCTT 60.606 57.895 28.89 17.47 41.70 3.74
288 290 7.161773 TGTAAGCTATCTACCGTAACACTTT 57.838 36.000 0.00 0.00 0.00 2.66
1689 5257 9.953697 ATTACACTTACACGCATTTTAGAAAAA 57.046 25.926 0.00 0.00 0.00 1.94
1697 5266 9.320352 TGTATATGATTACACTTACACGCATTT 57.680 29.630 0.00 0.00 0.00 2.32
1725 5294 2.450476 AGGGAAGACATTTGCATGGAC 58.550 47.619 0.00 0.00 34.27 4.02
1742 5313 7.558161 AGATTTGAAAAAGAAAGCAAAAGGG 57.442 32.000 0.00 0.00 34.38 3.95
1757 5328 9.973450 TCGTCATTTATTTTCCAAGATTTGAAA 57.027 25.926 0.00 0.00 0.00 2.69
2276 5898 2.489722 GTTCAAGTCCCCAGATCTTTGC 59.510 50.000 0.00 0.00 0.00 3.68
2317 5939 2.320781 ACTGGTGCACAAGAGAGTACT 58.679 47.619 28.22 0.00 0.00 2.73
2357 5981 6.420604 ACAAACTTGTGTCTTTCTGTTGTTTG 59.579 34.615 0.00 0.00 43.86 2.93
2480 6107 2.030805 GCAAAGCCACAGTAAGAACCAG 60.031 50.000 0.00 0.00 0.00 4.00
2481 6108 1.953686 GCAAAGCCACAGTAAGAACCA 59.046 47.619 0.00 0.00 0.00 3.67
2493 6120 4.891992 AGTTTCTACTCTAGCAAAGCCA 57.108 40.909 0.00 0.00 0.00 4.75


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.