Multiple sequence alignment - TraesCS7B01G096700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G096700 chr7B 100.000 2740 0 0 1 2740 111352250 111354989 0 5060
1 TraesCS7B01G096700 chr6B 97.446 2741 66 4 1 2740 258485379 258482642 0 4671
2 TraesCS7B01G096700 chr6B 96.465 2744 67 5 1 2740 616555688 616552971 0 4503
3 TraesCS7B01G096700 chr6B 96.012 2758 87 16 1 2740 526749141 526751893 0 4462
4 TraesCS7B01G096700 chr3B 96.353 2742 91 7 1 2740 9321396 9324130 0 4501
5 TraesCS7B01G096700 chr3B 94.817 2759 95 11 1 2740 730273776 730276505 0 4259
6 TraesCS7B01G096700 chr3B 94.714 2762 96 15 1 2740 709813693 709816426 0 4246
7 TraesCS7B01G096700 chr4B 95.941 2759 87 10 1 2740 327354173 327356925 0 4451
8 TraesCS7B01G096700 chr4B 95.685 2758 93 11 1 2740 500062307 500065056 0 4410
9 TraesCS7B01G096700 chr5B 96.411 2452 79 7 1 2449 450547634 450550079 0 4032
10 TraesCS7B01G096700 chr2B 96.438 2330 75 7 416 2740 50384695 50387021 0 3836
11 TraesCS7B01G096700 chr7A 88.273 2362 231 34 395 2740 484194544 484192213 0 2785


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G096700 chr7B 111352250 111354989 2739 False 5060 5060 100.000 1 2740 1 chr7B.!!$F1 2739
1 TraesCS7B01G096700 chr6B 258482642 258485379 2737 True 4671 4671 97.446 1 2740 1 chr6B.!!$R1 2739
2 TraesCS7B01G096700 chr6B 616552971 616555688 2717 True 4503 4503 96.465 1 2740 1 chr6B.!!$R2 2739
3 TraesCS7B01G096700 chr6B 526749141 526751893 2752 False 4462 4462 96.012 1 2740 1 chr6B.!!$F1 2739
4 TraesCS7B01G096700 chr3B 9321396 9324130 2734 False 4501 4501 96.353 1 2740 1 chr3B.!!$F1 2739
5 TraesCS7B01G096700 chr3B 730273776 730276505 2729 False 4259 4259 94.817 1 2740 1 chr3B.!!$F3 2739
6 TraesCS7B01G096700 chr3B 709813693 709816426 2733 False 4246 4246 94.714 1 2740 1 chr3B.!!$F2 2739
7 TraesCS7B01G096700 chr4B 327354173 327356925 2752 False 4451 4451 95.941 1 2740 1 chr4B.!!$F1 2739
8 TraesCS7B01G096700 chr4B 500062307 500065056 2749 False 4410 4410 95.685 1 2740 1 chr4B.!!$F2 2739
9 TraesCS7B01G096700 chr5B 450547634 450550079 2445 False 4032 4032 96.411 1 2449 1 chr5B.!!$F1 2448
10 TraesCS7B01G096700 chr2B 50384695 50387021 2326 False 3836 3836 96.438 416 2740 1 chr2B.!!$F1 2324
11 TraesCS7B01G096700 chr7A 484192213 484194544 2331 True 2785 2785 88.273 395 2740 1 chr7A.!!$R1 2345

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
35 36 1.204941 ACGAAGCTTACCGCAAGATCT 59.795 47.619 0.0 0.0 42.61 2.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1995 2035 0.469917 ATGCTAGCCGGTGCACTTAT 59.53 50.0 17.98 3.27 42.26 1.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 1.204941 ACGAAGCTTACCGCAAGATCT 59.795 47.619 0.00 0.0 42.61 2.75
137 138 1.656587 TACCATCAGAAGTGCCACCT 58.343 50.000 0.00 0.0 0.00 4.00
220 221 1.668826 TCAGGGCCACTAAGGAACAT 58.331 50.000 6.18 0.0 41.22 2.71
454 458 7.857734 TCCATGTTATGTCGTTTTCATACAT 57.142 32.000 0.00 0.0 37.58 2.29
598 602 4.562789 CGACTACATCAACAATCACATCGT 59.437 41.667 0.00 0.0 0.00 3.73
883 892 2.092291 CGTGCGAACTACGTGGCAT 61.092 57.895 0.00 0.0 44.60 4.40
983 1012 8.239314 GTGTAATCTGCTTTCTCATTCATTCAA 58.761 33.333 0.00 0.0 0.00 2.69
1115 1144 3.438216 TGAGGTGCTTGATTCAATCCA 57.562 42.857 0.00 0.0 0.00 3.41
1398 1429 4.693283 TCATCTGAGTCTTTTTGTCGTGT 58.307 39.130 0.00 0.0 0.00 4.49
1462 1493 1.761174 GAAGGCAGAGTTGTCCCCA 59.239 57.895 0.00 0.0 0.00 4.96
1573 1605 1.137086 GCGAGTTCATGGAGGAAGCTA 59.863 52.381 0.00 0.0 0.00 3.32
1760 1799 1.641677 GTGGTGTGTGAGCGACAAC 59.358 57.895 0.00 0.0 35.91 3.32
2402 2466 6.649436 CAGATTTAGTACACATAACATGGCG 58.351 40.000 0.00 0.0 33.60 5.69
2459 2546 5.819379 CACATGACATGGCAGATTAAGTACT 59.181 40.000 19.39 0.0 33.60 2.73
2531 2664 5.668471 TCTGATGCTCCTCAAGAGTTATTG 58.332 41.667 0.00 0.0 45.21 1.90
2632 2777 3.957535 GCTCATGGATTGCCCGCG 61.958 66.667 0.00 0.0 37.93 6.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
220 221 1.842052 TGATGTCGTACAGCTGGGTA 58.158 50.000 19.93 0.00 35.18 3.69
454 458 3.855255 TGGTTCTGTCCAAACATGAGA 57.145 42.857 0.00 0.00 34.13 3.27
598 602 2.373224 TGATCTTGTTGGCACACACAA 58.627 42.857 3.45 3.45 39.29 3.33
983 1012 6.654582 GGGGAACATTACTTGCATTTCAAAAT 59.345 34.615 0.00 0.00 33.65 1.82
996 1025 3.309121 CCTGGAACATGGGGAACATTACT 60.309 47.826 0.00 0.00 37.84 2.24
1115 1144 2.503356 AGGTCTGAATCAGCTTCCGAAT 59.497 45.455 5.18 0.00 30.13 3.34
1398 1429 2.241160 TGAAAGCCACAGTCCGTACTA 58.759 47.619 0.00 0.00 33.48 1.82
1462 1493 2.671351 CGACCGTTGCAGTTGAGATAGT 60.671 50.000 0.00 0.00 0.00 2.12
1573 1605 7.750229 TGTACTTCTTGCTGATTTTCTTGAT 57.250 32.000 0.00 0.00 0.00 2.57
1909 1949 9.585099 CATGTATGTTAAACTACATTTGCCATT 57.415 29.630 7.95 0.00 39.39 3.16
1995 2035 0.469917 ATGCTAGCCGGTGCACTTAT 59.530 50.000 17.98 3.27 42.26 1.73
2402 2466 8.165239 TCTGCCATGTTATGTGTATTAAATCC 57.835 34.615 0.00 0.00 0.00 3.01
2459 2546 4.463539 AGAAATGCAGTTGCCATGTTATGA 59.536 37.500 3.09 0.00 41.18 2.15
2632 2777 4.028852 ACACAAGAAAACGAAGAAAGGC 57.971 40.909 0.00 0.00 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.