Multiple sequence alignment - TraesCS7B01G087700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G087700 chr7B 100.000 2264 0 0 1 2264 102652613 102654876 0 4181
1 TraesCS7B01G087700 chr4B 99.293 2264 16 0 1 2264 649623168 649625431 0 4093
2 TraesCS7B01G087700 chr4B 99.117 2265 19 1 1 2264 655790979 655793243 0 4071
3 TraesCS7B01G087700 chr4A 99.249 2264 16 1 1 2264 735292696 735294958 0 4085
4 TraesCS7B01G087700 chr5B 99.117 2264 19 1 1 2264 281832852 281830590 0 4069
5 TraesCS7B01G087700 chr5B 98.807 2264 27 0 1 2264 351469615 351467352 0 4032
6 TraesCS7B01G087700 chr5B 98.411 2265 34 2 1 2264 433002512 433000249 0 3982
7 TraesCS7B01G087700 chr5B 98.366 2264 36 1 1 2264 471294932 471292670 0 3975
8 TraesCS7B01G087700 chr1B 98.852 2264 26 0 1 2264 302772357 302770094 0 4037
9 TraesCS7B01G087700 chr6B 98.234 2265 33 4 1 2264 381313993 381311735 0 3954


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G087700 chr7B 102652613 102654876 2263 False 4181 4181 100.000 1 2264 1 chr7B.!!$F1 2263
1 TraesCS7B01G087700 chr4B 649623168 649625431 2263 False 4093 4093 99.293 1 2264 1 chr4B.!!$F1 2263
2 TraesCS7B01G087700 chr4B 655790979 655793243 2264 False 4071 4071 99.117 1 2264 1 chr4B.!!$F2 2263
3 TraesCS7B01G087700 chr4A 735292696 735294958 2262 False 4085 4085 99.249 1 2264 1 chr4A.!!$F1 2263
4 TraesCS7B01G087700 chr5B 281830590 281832852 2262 True 4069 4069 99.117 1 2264 1 chr5B.!!$R1 2263
5 TraesCS7B01G087700 chr5B 351467352 351469615 2263 True 4032 4032 98.807 1 2264 1 chr5B.!!$R2 2263
6 TraesCS7B01G087700 chr5B 433000249 433002512 2263 True 3982 3982 98.411 1 2264 1 chr5B.!!$R3 2263
7 TraesCS7B01G087700 chr5B 471292670 471294932 2262 True 3975 3975 98.366 1 2264 1 chr5B.!!$R4 2263
8 TraesCS7B01G087700 chr1B 302770094 302772357 2263 True 4037 4037 98.852 1 2264 1 chr1B.!!$R1 2263
9 TraesCS7B01G087700 chr6B 381311735 381313993 2258 True 3954 3954 98.234 1 2264 1 chr6B.!!$R1 2263

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
487 488 3.003897 TGAAACAATTTGGTAGCGGTCAC 59.996 43.478 0.78 0.0 0.0 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1436 1439 0.469331 CCCCGTGCATAGGACTCCTA 60.469 60.0 7.3 7.3 40.71 2.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
378 379 3.256281 GCCCTCATATTAGGCCAGC 57.744 57.895 5.01 0.0 41.00 4.85
487 488 3.003897 TGAAACAATTTGGTAGCGGTCAC 59.996 43.478 0.78 0.0 0.00 3.67
526 527 3.181434 ACATTATCAACTGTGGGGTGTGT 60.181 43.478 0.00 0.0 33.62 3.72
1745 1748 7.119699 GTGGTCATGAACTATTTCTGTCATTCA 59.880 37.037 12.94 0.0 32.36 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
378 379 0.908198 CTCCACCTTCAGAAGAGGGG 59.092 60.00 12.14 11.97 44.90 4.79
487 488 0.907486 TGTCAGGAGCCTCCATGAAG 59.093 55.00 14.46 0.00 39.61 3.02
526 527 0.112218 CATTGTGTCCCCCTTCACCA 59.888 55.00 0.00 0.00 34.14 4.17
1436 1439 0.469331 CCCCGTGCATAGGACTCCTA 60.469 60.00 7.30 7.30 40.71 2.94
1745 1748 9.236006 AGTTTGCACATAATCTCAAATAGTCTT 57.764 29.63 0.00 0.00 32.07 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.