Multiple sequence alignment - TraesCS7B01G084200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G084200 chr7B 100.000 2264 0 0 1 2264 95041974 95039711 0.000000e+00 4181
1 TraesCS7B01G084200 chr7B 98.064 1653 26 3 618 2264 713543514 713541862 0.000000e+00 2870
2 TraesCS7B01G084200 chr7B 97.413 1662 37 3 609 2264 687041229 687042890 0.000000e+00 2826
3 TraesCS7B01G084200 chr2A 90.223 2291 158 29 1 2264 728933688 728935939 0.000000e+00 2929
4 TraesCS7B01G084200 chr1B 96.693 1663 35 5 609 2264 38183998 38185647 0.000000e+00 2748
5 TraesCS7B01G084200 chr1B 92.610 839 32 23 1 824 357902228 357901405 0.000000e+00 1179
6 TraesCS7B01G084200 chr1B 90.141 355 35 0 1909 2263 357900217 357899863 1.580000e-126 462
7 TraesCS7B01G084200 chr3B 93.948 1669 80 16 609 2264 28617532 28619192 0.000000e+00 2503
8 TraesCS7B01G084200 chr3B 96.176 1360 22 6 609 1938 16123830 16122471 0.000000e+00 2196
9 TraesCS7B01G084200 chr3B 92.857 322 22 1 1943 2264 16122502 16122182 1.220000e-127 466
10 TraesCS7B01G084200 chr7A 90.701 1882 128 28 1 1846 699323002 699321132 0.000000e+00 2462
11 TraesCS7B01G084200 chr7A 83.042 572 55 17 1732 2264 16006710 16007278 4.370000e-132 481
12 TraesCS7B01G084200 chr4B 95.667 1500 32 7 609 2078 402786596 402785100 0.000000e+00 2379
13 TraesCS7B01G084200 chr6B 95.177 1472 34 9 609 2044 687513828 687512358 0.000000e+00 2290
14 TraesCS7B01G084200 chr6B 92.729 839 31 19 1 824 650646762 650645939 0.000000e+00 1184
15 TraesCS7B01G084200 chr6B 92.729 839 31 18 1 824 661051548 661052371 0.000000e+00 1184
16 TraesCS7B01G084200 chr5B 95.956 1360 25 6 609 1938 464634713 464636072 0.000000e+00 2180
17 TraesCS7B01G084200 chr5B 92.723 852 32 20 1 837 426532726 426533562 0.000000e+00 1203
18 TraesCS7B01G084200 chr5B 92.849 839 30 20 1 824 464634009 464634832 0.000000e+00 1190
19 TraesCS7B01G084200 chr5B 83.566 572 53 16 1732 2264 433000814 433000245 4.340000e-137 497
20 TraesCS7B01G084200 chr5B 83.042 572 56 16 1732 2264 471293235 471292666 4.370000e-132 481
21 TraesCS7B01G084200 chr2B 96.018 1356 27 5 609 1938 563916533 563915179 0.000000e+00 2180
22 TraesCS7B01G084200 chr2B 92.849 839 29 21 1 824 42193306 42194128 0.000000e+00 1188
23 TraesCS7B01G084200 chr4A 92.610 839 32 19 1 824 712877381 712878204 0.000000e+00 1179
24 TraesCS7B01G084200 chr6A 91.895 839 37 19 1 823 592020759 592019936 0.000000e+00 1144
25 TraesCS7B01G084200 chrUn 83.042 572 55 17 1732 2264 416567433 416566865 4.370000e-132 481


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G084200 chr7B 95039711 95041974 2263 True 4181.0 4181 100.0000 1 2264 1 chr7B.!!$R1 2263
1 TraesCS7B01G084200 chr7B 713541862 713543514 1652 True 2870.0 2870 98.0640 618 2264 1 chr7B.!!$R2 1646
2 TraesCS7B01G084200 chr7B 687041229 687042890 1661 False 2826.0 2826 97.4130 609 2264 1 chr7B.!!$F1 1655
3 TraesCS7B01G084200 chr2A 728933688 728935939 2251 False 2929.0 2929 90.2230 1 2264 1 chr2A.!!$F1 2263
4 TraesCS7B01G084200 chr1B 38183998 38185647 1649 False 2748.0 2748 96.6930 609 2264 1 chr1B.!!$F1 1655
5 TraesCS7B01G084200 chr1B 357899863 357902228 2365 True 820.5 1179 91.3755 1 2263 2 chr1B.!!$R1 2262
6 TraesCS7B01G084200 chr3B 28617532 28619192 1660 False 2503.0 2503 93.9480 609 2264 1 chr3B.!!$F1 1655
7 TraesCS7B01G084200 chr3B 16122182 16123830 1648 True 1331.0 2196 94.5165 609 2264 2 chr3B.!!$R1 1655
8 TraesCS7B01G084200 chr7A 699321132 699323002 1870 True 2462.0 2462 90.7010 1 1846 1 chr7A.!!$R1 1845
9 TraesCS7B01G084200 chr7A 16006710 16007278 568 False 481.0 481 83.0420 1732 2264 1 chr7A.!!$F1 532
10 TraesCS7B01G084200 chr4B 402785100 402786596 1496 True 2379.0 2379 95.6670 609 2078 1 chr4B.!!$R1 1469
11 TraesCS7B01G084200 chr6B 687512358 687513828 1470 True 2290.0 2290 95.1770 609 2044 1 chr6B.!!$R2 1435
12 TraesCS7B01G084200 chr6B 650645939 650646762 823 True 1184.0 1184 92.7290 1 824 1 chr6B.!!$R1 823
13 TraesCS7B01G084200 chr6B 661051548 661052371 823 False 1184.0 1184 92.7290 1 824 1 chr6B.!!$F1 823
14 TraesCS7B01G084200 chr5B 464634009 464636072 2063 False 1685.0 2180 94.4025 1 1938 2 chr5B.!!$F2 1937
15 TraesCS7B01G084200 chr5B 426532726 426533562 836 False 1203.0 1203 92.7230 1 837 1 chr5B.!!$F1 836
16 TraesCS7B01G084200 chr5B 433000245 433000814 569 True 497.0 497 83.5660 1732 2264 1 chr5B.!!$R1 532
17 TraesCS7B01G084200 chr5B 471292666 471293235 569 True 481.0 481 83.0420 1732 2264 1 chr5B.!!$R2 532
18 TraesCS7B01G084200 chr2B 563915179 563916533 1354 True 2180.0 2180 96.0180 609 1938 1 chr2B.!!$R1 1329
19 TraesCS7B01G084200 chr2B 42193306 42194128 822 False 1188.0 1188 92.8490 1 824 1 chr2B.!!$F1 823
20 TraesCS7B01G084200 chr4A 712877381 712878204 823 False 1179.0 1179 92.6100 1 824 1 chr4A.!!$F1 823
21 TraesCS7B01G084200 chr6A 592019936 592020759 823 True 1144.0 1144 91.8950 1 823 1 chr6A.!!$R1 822
22 TraesCS7B01G084200 chrUn 416566865 416567433 568 True 481.0 481 83.0420 1732 2264 1 chrUn.!!$R1 532

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
613 637 0.037232 GTGAACGAGGTGGAAGAGGG 60.037 60.0 0.0 0.0 0.0 4.3 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1510 1713 0.108585 TTCTCTTTGCGTGCCCTCTT 59.891 50.0 0.0 0.0 0.0 2.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
461 463 6.435591 TGGATACACTGGCATGAAACAATTTA 59.564 34.615 0.00 0.00 46.17 1.40
466 468 6.714810 ACACTGGCATGAAACAATTTAGTAGA 59.285 34.615 0.00 0.00 0.00 2.59
519 521 3.164977 TGGGGTGTGCGGTGAAGA 61.165 61.111 0.00 0.00 0.00 2.87
613 637 0.037232 GTGAACGAGGTGGAAGAGGG 60.037 60.000 0.00 0.00 0.00 4.30
644 743 0.622136 TAGAGGTGGTGGTCGAGCTA 59.378 55.000 16.64 0.00 30.83 3.32
756 861 2.290260 CCACAAATGCTAGAGGTGGTGA 60.290 50.000 0.00 0.00 43.08 4.02
1227 1429 2.584492 ATGCACATGATCGTCGAAGA 57.416 45.000 2.86 2.86 0.00 2.87
1407 1609 2.829094 TCCAAGAGGACCAACGTCA 58.171 52.632 0.00 0.00 41.13 4.35
1468 1671 3.090532 GGGGATTGGAGCGGGAGT 61.091 66.667 0.00 0.00 0.00 3.85
1472 1675 1.596934 GATTGGAGCGGGAGTGTCA 59.403 57.895 0.00 0.00 0.00 3.58
2005 2610 2.936912 GCGCAGGAGACCAGACACT 61.937 63.158 0.30 0.00 0.00 3.55
2164 2770 3.322466 CCCAGACGCCAAGGTCCT 61.322 66.667 0.00 0.00 37.66 3.85
2192 2798 4.320456 CTGCCACACCCAGACGCT 62.320 66.667 0.00 0.00 32.03 5.07
2244 2850 0.614979 GCAGGAGACCAGACACCCTA 60.615 60.000 0.00 0.00 0.00 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
519 521 1.296715 GTCCGCTCATTGTGTCCCT 59.703 57.895 0.00 0.0 0.00 4.20
563 566 2.554032 CGCCTCCATGACTTGTTTTTCT 59.446 45.455 0.00 0.0 0.00 2.52
613 637 2.826725 ACCACCTCTAGCACTTGTACTC 59.173 50.000 0.00 0.0 0.00 2.59
756 861 2.037136 GCACTTGTGCCTGCTCGAT 61.037 57.895 14.17 0.0 0.00 3.59
1227 1429 5.054477 GGTATGTCATATGCGTTAGTTGGT 58.946 41.667 0.00 0.0 0.00 3.67
1407 1609 0.679960 GCTGCCCCGTAACCAATCTT 60.680 55.000 0.00 0.0 0.00 2.40
1468 1671 0.820226 CGAGCCTCCTTCTCATGACA 59.180 55.000 0.00 0.0 0.00 3.58
1472 1675 1.110442 CTCACGAGCCTCCTTCTCAT 58.890 55.000 0.00 0.0 0.00 2.90
1510 1713 0.108585 TTCTCTTTGCGTGCCCTCTT 59.891 50.000 0.00 0.0 0.00 2.85
2005 2610 3.194329 GTCCATCAGACACATCAGACAGA 59.806 47.826 0.00 0.0 45.55 3.41
2192 2798 2.363795 CAGACGCCAGGGTCCCTA 60.364 66.667 11.12 0.0 37.66 3.53


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.