Multiple sequence alignment - TraesCS7B01G069700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G069700 chr7B 100.000 4770 0 0 1 4770 75052089 75047320 0 8809
1 TraesCS7B01G069700 chr7B 98.429 4775 66 8 1 4770 628741838 628746608 0 8394
2 TraesCS7B01G069700 chr6B 98.618 4774 59 6 1 4770 482838192 482833422 0 8444
3 TraesCS7B01G069700 chr6B 98.407 4772 71 4 1 4770 482818559 482813791 0 8386
4 TraesCS7B01G069700 chr7A 98.555 4775 63 5 1 4770 28244722 28249495 0 8431
5 TraesCS7B01G069700 chr2B 98.555 4775 62 7 1 4770 615344295 615339523 0 8429
6 TraesCS7B01G069700 chr2B 98.387 4774 68 9 1 4770 616523001 616518233 0 8381
7 TraesCS7B01G069700 chr3A 98.366 4773 68 6 1 4770 742303656 742308421 0 8373
8 TraesCS7B01G069700 chr2A 98.325 4775 72 7 1 4770 167353553 167348782 0 8368
9 TraesCS7B01G069700 chr2A 98.622 4428 57 3 1 4425 70021021 70016595 0 7836


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G069700 chr7B 75047320 75052089 4769 True 8809 8809 100.000 1 4770 1 chr7B.!!$R1 4769
1 TraesCS7B01G069700 chr7B 628741838 628746608 4770 False 8394 8394 98.429 1 4770 1 chr7B.!!$F1 4769
2 TraesCS7B01G069700 chr6B 482833422 482838192 4770 True 8444 8444 98.618 1 4770 1 chr6B.!!$R2 4769
3 TraesCS7B01G069700 chr6B 482813791 482818559 4768 True 8386 8386 98.407 1 4770 1 chr6B.!!$R1 4769
4 TraesCS7B01G069700 chr7A 28244722 28249495 4773 False 8431 8431 98.555 1 4770 1 chr7A.!!$F1 4769
5 TraesCS7B01G069700 chr2B 615339523 615344295 4772 True 8429 8429 98.555 1 4770 1 chr2B.!!$R1 4769
6 TraesCS7B01G069700 chr2B 616518233 616523001 4768 True 8381 8381 98.387 1 4770 1 chr2B.!!$R2 4769
7 TraesCS7B01G069700 chr3A 742303656 742308421 4765 False 8373 8373 98.366 1 4770 1 chr3A.!!$F1 4769
8 TraesCS7B01G069700 chr2A 167348782 167353553 4771 True 8368 8368 98.325 1 4770 1 chr2A.!!$R2 4769
9 TraesCS7B01G069700 chr2A 70016595 70021021 4426 True 7836 7836 98.622 1 4425 1 chr2A.!!$R1 4424

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
324 335 0.881159 CCCACTAACAAACGACGCCA 60.881 55.000 0.00 0.0 0.00 5.69 F
325 336 1.153353 CCACTAACAAACGACGCCAT 58.847 50.000 0.00 0.0 0.00 4.40 F
557 569 2.090524 CCGTACAAACTCCGTCGGC 61.091 63.158 6.34 0.0 0.00 5.54 F
1933 1946 2.102588 AGGTAACACTTGAGCACGTCTT 59.897 45.455 0.00 0.0 41.41 3.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1789 1802 0.036306 GCCCTCTTTCCTCGTTCCAA 59.964 55.000 0.00 0.0 0.00 3.53 R
2319 2332 0.809636 ATGCGATGCGATTTCGTCCA 60.810 50.000 1.55 0.0 42.22 4.02 R
2546 2559 3.211045 ACAATTCTGTAACGCACCACTT 58.789 40.909 0.00 0.0 32.54 3.16 R
3780 3795 3.007182 CCCAATCACATGCAAAACTCCTT 59.993 43.478 0.00 0.0 0.00 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
35 36 2.746279 TTTCTGGGTTTTCTGCCTGA 57.254 45.000 0.00 0.00 0.00 3.86
324 335 0.881159 CCCACTAACAAACGACGCCA 60.881 55.000 0.00 0.00 0.00 5.69
325 336 1.153353 CCACTAACAAACGACGCCAT 58.847 50.000 0.00 0.00 0.00 4.40
557 569 2.090524 CCGTACAAACTCCGTCGGC 61.091 63.158 6.34 0.00 0.00 5.54
585 597 4.697756 CGGCTTGCGTCCCCTCAA 62.698 66.667 0.00 0.00 0.00 3.02
889 901 9.403583 TCACTTTTTACTCCAAAGTTACAATCT 57.596 29.630 0.00 0.00 41.58 2.40
998 1010 8.311109 GTGTACTCCATATTTGGTTGGAAAAAT 58.689 33.333 1.86 0.00 44.06 1.82
1664 1677 7.945033 AAGTAAAGTGTGCATATGGTTTTTG 57.055 32.000 4.56 0.00 0.00 2.44
1933 1946 2.102588 AGGTAACACTTGAGCACGTCTT 59.897 45.455 0.00 0.00 41.41 3.01
2036 2049 3.006110 CGTCTCCTACAAACCCAGTAACA 59.994 47.826 0.00 0.00 0.00 2.41
2319 2332 4.500499 AAGCTGCCACATCTTTAGAGAT 57.500 40.909 0.00 0.00 43.43 2.75
3116 3129 6.995686 TGCAGACTTACATTCCTCTAAACAAA 59.004 34.615 0.00 0.00 0.00 2.83
3525 3538 5.585820 TGTATGCACTAGGAATTCGTGTA 57.414 39.130 10.86 7.88 0.00 2.90
3641 3654 2.813754 ACAATGAACGCTGTGCTAACAT 59.186 40.909 0.00 0.00 35.22 2.71
3858 3873 6.862944 TGCGCACTTGCTTATAAATTTTAC 57.137 33.333 5.66 0.00 39.32 2.01
4122 4142 2.163010 TCTCCACGGCGTTTCTTAGTAG 59.837 50.000 11.19 0.00 0.00 2.57
4262 4282 1.302511 AATGCAACGACGGGAGCTT 60.303 52.632 0.00 0.00 0.00 3.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
5 6 0.679960 ACCCAGAAAATACTGCCCGC 60.680 55.000 0.00 0.00 36.67 6.13
35 36 7.033185 GTCCGTATGCATTTTCTACCATTTTT 58.967 34.615 3.54 0.00 0.00 1.94
486 498 4.760047 CAAGGCGACGGGTCAGGG 62.760 72.222 0.00 0.00 0.00 4.45
585 597 2.410469 GCGTATAGTGGCGACGGT 59.590 61.111 0.00 0.00 37.08 4.83
664 676 5.636903 ACCATCATACTGTTATGAGCCTT 57.363 39.130 1.22 0.00 45.89 4.35
998 1010 4.746466 ACCCAAAAACATCCACTCCATTA 58.254 39.130 0.00 0.00 0.00 1.90
1789 1802 0.036306 GCCCTCTTTCCTCGTTCCAA 59.964 55.000 0.00 0.00 0.00 3.53
1933 1946 9.076781 TCTTCAATTCAGTGATGGACATTAAAA 57.923 29.630 0.00 0.00 0.00 1.52
2036 2049 4.099266 CAGATTCTCTTCGTCCTCTTCCAT 59.901 45.833 0.00 0.00 0.00 3.41
2319 2332 0.809636 ATGCGATGCGATTTCGTCCA 60.810 50.000 1.55 0.00 42.22 4.02
2546 2559 3.211045 ACAATTCTGTAACGCACCACTT 58.789 40.909 0.00 0.00 32.54 3.16
3116 3129 7.606456 ACGACAGTAATCCAGTGATTATTTTGT 59.394 33.333 0.00 4.75 43.47 2.83
3525 3538 5.606348 AAGCATCGAAGGAGAAATAGTCT 57.394 39.130 0.00 0.00 40.25 3.24
3780 3795 3.007182 CCCAATCACATGCAAAACTCCTT 59.993 43.478 0.00 0.00 0.00 3.36
3858 3873 7.644490 ACTATTCAGAAGCAGAGTCTATTACG 58.356 38.462 0.00 0.00 0.00 3.18
4122 4142 2.178235 GGCTTGATAACGACGGGCC 61.178 63.158 0.00 0.00 0.00 5.80
4262 4282 4.692625 GGACGACGACCTGCTTATATACTA 59.307 45.833 9.18 0.00 0.00 1.82
4439 4459 4.462417 CGTCGAGAAGACCGCGCT 62.462 66.667 5.56 0.00 46.92 5.92
4674 4694 0.399075 AACGGGACCCTACAACAAGG 59.601 55.000 9.41 0.00 36.30 3.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.