Multiple sequence alignment - TraesCS7B01G064400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G064400 chr7B 100.000 3629 0 0 1 3629 69911899 69915527 0.000000e+00 6702
1 TraesCS7B01G064400 chr7B 99.366 3629 23 0 1 3629 69848627 69852255 0.000000e+00 6575
2 TraesCS7B01G064400 chr7B 98.292 3630 59 3 1 3629 69991784 69995411 0.000000e+00 6357
3 TraesCS7B01G064400 chr7B 99.328 3123 20 1 1 3122 70068282 70071404 0.000000e+00 5650
4 TraesCS7B01G064400 chr7B 95.515 3233 108 19 422 3629 70339171 70342391 0.000000e+00 5132
5 TraesCS7B01G064400 chr7B 96.877 2818 76 8 422 3232 70242982 70245794 0.000000e+00 4706
6 TraesCS7B01G064400 chr7B 95.443 395 11 4 3231 3624 70245955 70246343 1.110000e-174 623
7 TraesCS7B01G064400 chr7B 97.199 357 7 2 3269 3624 70071903 70072257 5.180000e-168 601
8 TraesCS7B01G064400 chr7B 98.113 159 3 0 3114 3272 70071586 70071744 9.920000e-71 278
9 TraesCS7B01G064400 chr6B 97.825 3633 66 5 1 3629 548947683 548951306 0.000000e+00 6259
10 TraesCS7B01G064400 chr6B 97.774 3638 64 6 1 3629 549028195 549031824 0.000000e+00 6253
11 TraesCS7B01G064400 chr7D 93.975 3668 143 31 1 3629 110889656 110893284 0.000000e+00 5478
12 TraesCS7B01G064400 chr7D 86.957 621 58 6 1 607 272267450 272266839 0.000000e+00 676
13 TraesCS7B01G064400 chr7A 92.923 3137 143 37 144 3235 116018003 116021105 0.000000e+00 4490
14 TraesCS7B01G064400 chr7A 93.267 401 23 1 3229 3629 116021536 116021932 4.040000e-164 588
15 TraesCS7B01G064400 chrUn 88.016 2929 248 61 769 3624 16612153 16615051 0.000000e+00 3369
16 TraesCS7B01G064400 chrUn 92.593 1566 98 15 1507 3064 379234394 379232839 0.000000e+00 2233
17 TraesCS7B01G064400 chrUn 99.050 1158 7 2 1 1154 426293982 426295139 0.000000e+00 2074
18 TraesCS7B01G064400 chr2B 92.025 1768 126 13 1133 2889 27356054 27357817 0.000000e+00 2470
19 TraesCS7B01G064400 chr5B 88.728 621 47 6 1 607 116642551 116643162 0.000000e+00 737


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G064400 chr7B 69911899 69915527 3628 False 6702.000000 6702 100.000000 1 3629 1 chr7B.!!$F2 3628
1 TraesCS7B01G064400 chr7B 69848627 69852255 3628 False 6575.000000 6575 99.366000 1 3629 1 chr7B.!!$F1 3628
2 TraesCS7B01G064400 chr7B 69991784 69995411 3627 False 6357.000000 6357 98.292000 1 3629 1 chr7B.!!$F3 3628
3 TraesCS7B01G064400 chr7B 70339171 70342391 3220 False 5132.000000 5132 95.515000 422 3629 1 chr7B.!!$F4 3207
4 TraesCS7B01G064400 chr7B 70242982 70246343 3361 False 2664.500000 4706 96.160000 422 3624 2 chr7B.!!$F6 3202
5 TraesCS7B01G064400 chr7B 70068282 70072257 3975 False 2176.333333 5650 98.213333 1 3624 3 chr7B.!!$F5 3623
6 TraesCS7B01G064400 chr6B 548947683 548951306 3623 False 6259.000000 6259 97.825000 1 3629 1 chr6B.!!$F1 3628
7 TraesCS7B01G064400 chr6B 549028195 549031824 3629 False 6253.000000 6253 97.774000 1 3629 1 chr6B.!!$F2 3628
8 TraesCS7B01G064400 chr7D 110889656 110893284 3628 False 5478.000000 5478 93.975000 1 3629 1 chr7D.!!$F1 3628
9 TraesCS7B01G064400 chr7D 272266839 272267450 611 True 676.000000 676 86.957000 1 607 1 chr7D.!!$R1 606
10 TraesCS7B01G064400 chr7A 116018003 116021932 3929 False 2539.000000 4490 93.095000 144 3629 2 chr7A.!!$F1 3485
11 TraesCS7B01G064400 chrUn 16612153 16615051 2898 False 3369.000000 3369 88.016000 769 3624 1 chrUn.!!$F1 2855
12 TraesCS7B01G064400 chrUn 379232839 379234394 1555 True 2233.000000 2233 92.593000 1507 3064 1 chrUn.!!$R1 1557
13 TraesCS7B01G064400 chrUn 426293982 426295139 1157 False 2074.000000 2074 99.050000 1 1154 1 chrUn.!!$F2 1153
14 TraesCS7B01G064400 chr2B 27356054 27357817 1763 False 2470.000000 2470 92.025000 1133 2889 1 chr2B.!!$F1 1756
15 TraesCS7B01G064400 chr5B 116642551 116643162 611 False 737.000000 737 88.728000 1 607 1 chr5B.!!$F1 606

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
980 1056 2.125326 TGTTCCCGGCGATCGATCT 61.125 57.895 21.57 0.0 42.43 2.75 F
1107 1202 0.684805 TTTCCTCCTCCTCTCGGCTC 60.685 60.000 0.00 0.0 0.00 4.70 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2378 2515 3.636300 TCTGGATGGGTTTGTGACTTTTG 59.364 43.478 0.0 0.0 0.0 2.44 R
3520 4569 9.605275 TGACTCTAGATCATTCAAATACAAAGG 57.395 33.333 0.0 0.0 0.0 3.11 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
927 995 4.940654 CCAAACAAATCACAACCAACCTTT 59.059 37.500 0.00 0.00 0.00 3.11
980 1056 2.125326 TGTTCCCGGCGATCGATCT 61.125 57.895 21.57 0.00 42.43 2.75
1107 1202 0.684805 TTTCCTCCTCCTCTCGGCTC 60.685 60.000 0.00 0.00 0.00 4.70
2378 2515 8.492748 CGGTATGTACATACACATTGGATAAAC 58.507 37.037 35.27 18.68 44.09 2.01
3191 3557 3.448660 GCTTTGGGTCCATGCTAGAAATT 59.551 43.478 0.00 0.00 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
927 995 1.202722 GGGGGAACAAACGACTTGAGA 60.203 52.381 8.62 0.0 38.50 3.27
980 1056 4.324267 CATGATGCTCAGCAAGATGGATA 58.676 43.478 1.73 0.0 43.62 2.59
1107 1202 4.139786 CCACCTTCCATCCATGAATACAG 58.860 47.826 0.00 0.0 0.00 2.74
2378 2515 3.636300 TCTGGATGGGTTTGTGACTTTTG 59.364 43.478 0.00 0.0 0.00 2.44
3520 4569 9.605275 TGACTCTAGATCATTCAAATACAAAGG 57.395 33.333 0.00 0.0 0.00 3.11


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.