Multiple sequence alignment - TraesCS7B01G058800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G058800 chr7B 100.000 4629 0 0 1 4629 61443617 61438989 0.000000e+00 8549
1 TraesCS7B01G058800 chr7B 99.383 3079 19 0 1551 4629 61466993 61463915 0.000000e+00 5581
2 TraesCS7B01G058800 chr7B 84.880 2381 296 26 1828 4159 61118977 61116612 0.000000e+00 2344
3 TraesCS7B01G058800 chr7B 95.994 674 20 5 1 669 39973036 39972365 0.000000e+00 1088
4 TraesCS7B01G058800 chr7B 88.824 170 19 0 4305 4474 61116865 61116696 4.690000e-50 209
5 TraesCS7B01G058800 chrUn 99.482 4630 23 1 1 4629 187851701 187847072 0.000000e+00 8416
6 TraesCS7B01G058800 chrUn 99.453 4570 25 0 1 4570 187876438 187871869 0.000000e+00 8301
7 TraesCS7B01G058800 chrUn 99.504 2623 12 1 1 2622 196516860 196514238 0.000000e+00 4771
8 TraesCS7B01G058800 chrUn 99.588 1942 8 0 2629 4570 196513984 196512043 0.000000e+00 3542
9 TraesCS7B01G058800 chrUn 99.437 1422 7 1 1 1421 364776595 364775174 0.000000e+00 2580
10 TraesCS7B01G058800 chrUn 99.216 1403 9 2 148 1549 403449592 403450993 0.000000e+00 2529
11 TraesCS7B01G058800 chrUn 98.601 929 4 4 1 927 187827062 187826141 0.000000e+00 1635
12 TraesCS7B01G058800 chrUn 99.439 535 3 0 4095 4629 336845009 336844475 0.000000e+00 972
13 TraesCS7B01G058800 chrUn 99.439 535 3 0 4095 4629 370675300 370674766 0.000000e+00 972
14 TraesCS7B01G058800 chrUn 88.235 170 20 0 3906 4075 187847396 187847227 2.180000e-48 204
15 TraesCS7B01G058800 chrUn 88.235 170 20 0 3906 4075 187872134 187871965 2.180000e-48 204
16 TraesCS7B01G058800 chr7A 90.721 3287 196 47 917 4159 107813989 107810768 0.000000e+00 4279
17 TraesCS7B01G058800 chr7A 74.297 1031 197 43 2399 3391 106744551 106743551 1.570000e-99 374
18 TraesCS7B01G058800 chr7A 93.956 182 11 0 722 903 107814515 107814334 4.560000e-70 276
19 TraesCS7B01G058800 chr7A 89.474 171 17 1 4305 4474 107811020 107810850 1.010000e-51 215
20 TraesCS7B01G058800 chr7D 92.212 2414 149 14 1733 4125 102962447 102960052 0.000000e+00 3380
21 TraesCS7B01G058800 chr7D 84.922 2381 294 33 1828 4159 102940469 102938105 0.000000e+00 2348
22 TraesCS7B01G058800 chr7D 87.814 1075 61 40 696 1741 102963728 102962695 0.000000e+00 1195
23 TraesCS7B01G058800 chr7D 91.772 158 13 0 4472 4629 222492851 222492694 2.170000e-53 220
24 TraesCS7B01G058800 chr7D 89.941 169 17 0 4306 4474 102938357 102938189 7.800000e-53 219
25 TraesCS7B01G058800 chr6A 92.340 705 32 12 1 685 427430352 427431054 0.000000e+00 983
26 TraesCS7B01G058800 chr6A 85.899 695 83 13 1 685 294362934 294363623 0.000000e+00 726
27 TraesCS7B01G058800 chr2D 92.405 158 12 0 4472 4629 355171542 355171385 4.660000e-55 226
28 TraesCS7B01G058800 chr4B 91.304 161 14 0 4469 4629 546552694 546552854 2.170000e-53 220


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G058800 chr7B 61438989 61443617 4628 True 8549.0 8549 100.000000 1 4629 1 chr7B.!!$R2 4628
1 TraesCS7B01G058800 chr7B 61463915 61466993 3078 True 5581.0 5581 99.383000 1551 4629 1 chr7B.!!$R3 3078
2 TraesCS7B01G058800 chr7B 61116612 61118977 2365 True 1276.5 2344 86.852000 1828 4474 2 chr7B.!!$R4 2646
3 TraesCS7B01G058800 chr7B 39972365 39973036 671 True 1088.0 1088 95.994000 1 669 1 chr7B.!!$R1 668
4 TraesCS7B01G058800 chrUn 187847072 187851701 4629 True 8416.0 8416 99.482000 1 4629 1 chrUn.!!$R2 4628
5 TraesCS7B01G058800 chrUn 187871869 187876438 4569 True 8301.0 8301 99.453000 1 4570 1 chrUn.!!$R4 4569
6 TraesCS7B01G058800 chrUn 196512043 196516860 4817 True 4156.5 4771 99.546000 1 4570 2 chrUn.!!$R9 4569
7 TraesCS7B01G058800 chrUn 364775174 364776595 1421 True 2580.0 2580 99.437000 1 1421 1 chrUn.!!$R7 1420
8 TraesCS7B01G058800 chrUn 403449592 403450993 1401 False 2529.0 2529 99.216000 148 1549 1 chrUn.!!$F1 1401
9 TraesCS7B01G058800 chrUn 187826141 187827062 921 True 1635.0 1635 98.601000 1 927 1 chrUn.!!$R1 926
10 TraesCS7B01G058800 chrUn 336844475 336845009 534 True 972.0 972 99.439000 4095 4629 1 chrUn.!!$R6 534
11 TraesCS7B01G058800 chrUn 370674766 370675300 534 True 972.0 972 99.439000 4095 4629 1 chrUn.!!$R8 534
12 TraesCS7B01G058800 chr7A 107810768 107814515 3747 True 1590.0 4279 91.383667 722 4474 3 chr7A.!!$R2 3752
13 TraesCS7B01G058800 chr7A 106743551 106744551 1000 True 374.0 374 74.297000 2399 3391 1 chr7A.!!$R1 992
14 TraesCS7B01G058800 chr7D 102960052 102963728 3676 True 2287.5 3380 90.013000 696 4125 2 chr7D.!!$R3 3429
15 TraesCS7B01G058800 chr7D 102938105 102940469 2364 True 1283.5 2348 87.431500 1828 4474 2 chr7D.!!$R2 2646
16 TraesCS7B01G058800 chr6A 427430352 427431054 702 False 983.0 983 92.340000 1 685 1 chr6A.!!$F2 684
17 TraesCS7B01G058800 chr6A 294362934 294363623 689 False 726.0 726 85.899000 1 685 1 chr6A.!!$F1 684

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
909 955 0.531200 GTTCGTCGGAATGACCTCCT 59.469 55.000 0.00 0.0 45.23 3.69 F
2064 2736 5.700832 TGTTCTTCATTATGAGTTCGTTGCT 59.299 36.000 0.00 0.0 0.00 3.91 F
2449 3121 1.072648 CCAGAAACCCGGAGTACCAAA 59.927 52.381 0.73 0.0 35.59 3.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2449 3121 2.297315 TGCACTGTCTCAAACTCGATCT 59.703 45.455 0.0 0.0 0.0 2.75 R
3071 4014 4.348863 AGCTATTGTAAGGATGCAGAGG 57.651 45.455 0.0 0.0 0.0 3.69 R
4275 5259 5.455326 GGGACATAATGACATGGAAGTAGCT 60.455 44.000 0.0 0.0 0.0 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
909 955 0.531200 GTTCGTCGGAATGACCTCCT 59.469 55.000 0.00 0.0 45.23 3.69
1175 1575 7.870445 TCATGAAAATTACTAACCAAACAAGGC 59.130 33.333 0.00 0.0 0.00 4.35
1418 1830 7.773224 TGTTAGATGGACAATATCGACCATTTT 59.227 33.333 4.64 0.7 40.77 1.82
2064 2736 5.700832 TGTTCTTCATTATGAGTTCGTTGCT 59.299 36.000 0.00 0.0 0.00 3.91
2449 3121 1.072648 CCAGAAACCCGGAGTACCAAA 59.927 52.381 0.73 0.0 35.59 3.28
3071 4014 3.383185 ACTCTAGCACTTCAGTAGATGCC 59.617 47.826 0.00 0.0 38.92 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1175 1575 6.359883 CACTACTACAATATTCACATCGGTCG 59.640 42.308 0.00 0.0 0.00 4.79
1418 1830 2.719739 ACTTTCCACCTCGACGATCTA 58.280 47.619 0.00 0.0 0.00 1.98
2064 2736 5.547465 AGTTCGTCATAAGAACCATCAACA 58.453 37.500 5.59 0.0 46.58 3.33
2327 2999 5.410924 GCTTTAGGAACACCCATTCAATTC 58.589 41.667 0.00 0.0 37.41 2.17
2449 3121 2.297315 TGCACTGTCTCAAACTCGATCT 59.703 45.455 0.00 0.0 0.00 2.75
2624 3319 5.200483 CAGGGGGCTTCTAATAATTTGACA 58.800 41.667 0.00 0.0 0.00 3.58
3071 4014 4.348863 AGCTATTGTAAGGATGCAGAGG 57.651 45.455 0.00 0.0 0.00 3.69
4275 5259 5.455326 GGGACATAATGACATGGAAGTAGCT 60.455 44.000 0.00 0.0 0.00 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.