Multiple sequence alignment - TraesCS7B01G050800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G050800 chr7B 100.000 2576 0 0 1 2576 52678278 52675703 0.000000e+00 4758.0
1 TraesCS7B01G050800 chr7B 99.612 2577 9 1 1 2576 52656896 52654320 0.000000e+00 4702.0
2 TraesCS7B01G050800 chr7B 98.140 645 11 1 1932 2576 145725270 145724627 0.000000e+00 1123.0
3 TraesCS7B01G050800 chr7B 90.814 381 27 6 587 963 615196699 615197075 1.060000e-138 503.0
4 TraesCS7B01G050800 chr7D 93.756 1009 43 10 585 1585 98039294 98038298 0.000000e+00 1496.0
5 TraesCS7B01G050800 chr7D 97.436 39 1 0 1623 1661 41602238 41602276 1.650000e-07 67.6
6 TraesCS7B01G050800 chr7D 93.023 43 2 1 1620 1661 111471870 111471828 7.700000e-06 62.1
7 TraesCS7B01G050800 chr7D 92.105 38 3 0 504 541 98039322 98039285 1.000000e-03 54.7
8 TraesCS7B01G050800 chr6B 96.119 773 24 2 1808 2576 705549550 705548780 0.000000e+00 1256.0
9 TraesCS7B01G050800 chr6B 97.117 659 17 2 1918 2576 22580119 22579463 0.000000e+00 1110.0
10 TraesCS7B01G050800 chr6B 95.599 659 19 6 1918 2576 685008189 685008837 0.000000e+00 1048.0
11 TraesCS7B01G050800 chr6B 97.436 39 1 0 1623 1661 23290620 23290658 1.650000e-07 67.6
12 TraesCS7B01G050800 chr6B 97.368 38 1 0 1623 1660 77784074 77784111 5.950000e-07 65.8
13 TraesCS7B01G050800 chr2B 96.965 659 19 1 1918 2576 677038816 677038159 0.000000e+00 1105.0
14 TraesCS7B01G050800 chr2B 95.296 659 23 1 1918 2576 13307020 13306370 0.000000e+00 1038.0
15 TraesCS7B01G050800 chr2B 91.848 184 9 3 1811 1988 82656205 82656388 4.260000e-63 252.0
16 TraesCS7B01G050800 chr2B 96.694 121 3 1 1804 1924 677038970 677038851 1.560000e-47 200.0
17 TraesCS7B01G050800 chr2B 86.813 91 9 1 1483 1570 793698667 793698757 5.870000e-17 99.0
18 TraesCS7B01G050800 chr1B 96.206 659 25 0 1918 2576 654116333 654115675 0.000000e+00 1079.0
19 TraesCS7B01G050800 chr1B 97.436 39 1 0 1623 1661 27285978 27285940 1.650000e-07 67.6
20 TraesCS7B01G050800 chr1B 100.000 31 0 0 1004 1034 634262866 634262896 9.960000e-05 58.4
21 TraesCS7B01G050800 chr5B 95.593 658 25 3 1919 2576 697922792 697923445 0.000000e+00 1051.0
22 TraesCS7B01G050800 chr5B 94.309 123 5 1 190 310 697787097 697787219 1.220000e-43 187.0
23 TraesCS7B01G050800 chr5B 96.250 80 3 0 36 115 697785974 697786053 5.780000e-27 132.0
24 TraesCS7B01G050800 chr5B 100.000 55 0 0 128 182 697786046 697786100 4.530000e-18 102.0
25 TraesCS7B01G050800 chr2A 86.768 786 39 17 1827 2572 58197937 58197177 0.000000e+00 815.0
26 TraesCS7B01G050800 chr2A 92.241 116 8 1 1 116 692741900 692741786 2.050000e-36 163.0
27 TraesCS7B01G050800 chr2A 96.154 52 2 0 322 373 692741682 692741631 4.570000e-13 86.1
28 TraesCS7B01G050800 chr2A 97.826 46 1 0 137 182 692741785 692741740 2.120000e-11 80.5
29 TraesCS7B01G050800 chr2A 94.737 38 2 0 422 459 118213160 118213197 2.770000e-05 60.2
30 TraesCS7B01G050800 chr7A 84.969 805 49 26 1808 2571 720438691 720439464 0.000000e+00 750.0
31 TraesCS7B01G050800 chr7A 84.701 804 53 28 1808 2571 586344244 586343471 0.000000e+00 739.0
32 TraesCS7B01G050800 chr7A 84.720 805 52 25 1808 2571 720378043 720378817 0.000000e+00 739.0
33 TraesCS7B01G050800 chr7A 93.528 309 14 3 943 1245 100555470 100555162 3.020000e-124 455.0
34 TraesCS7B01G050800 chr7A 90.882 340 25 3 586 919 100555796 100555457 3.910000e-123 451.0
35 TraesCS7B01G050800 chr7A 94.650 243 13 0 1322 1564 100555030 100554788 6.730000e-101 377.0
36 TraesCS7B01G050800 chr7A 89.764 127 12 1 1665 1791 100554722 100554597 7.380000e-36 161.0
37 TraesCS7B01G050800 chr3B 82.798 779 56 30 1835 2576 26646792 26646055 2.180000e-175 625.0
38 TraesCS7B01G050800 chr3B 85.117 383 16 10 1823 2175 135712835 135713206 1.130000e-93 353.0
39 TraesCS7B01G050800 chr6A 91.064 235 16 4 190 421 36967000 36966768 1.920000e-81 313.0
40 TraesCS7B01G050800 chr6A 93.103 116 7 1 1 116 36967207 36967093 4.410000e-38 169.0
41 TraesCS7B01G050800 chr6A 100.000 46 0 0 137 182 36967092 36967047 4.570000e-13 86.1
42 TraesCS7B01G050800 chr4A 86.620 284 25 7 950 1228 601283827 601284102 4.170000e-78 302.0
43 TraesCS7B01G050800 chr4D 85.366 246 26 5 992 1228 3428396 3428152 1.980000e-61 246.0
44 TraesCS7B01G050800 chr4D 83.858 254 35 5 1322 1572 3430298 3430048 1.190000e-58 237.0
45 TraesCS7B01G050800 chr4D 97.500 40 1 0 1623 1662 98939165 98939204 4.600000e-08 69.4
46 TraesCS7B01G050800 chr4D 94.872 39 2 0 1623 1661 503418688 503418650 7.700000e-06 62.1
47 TraesCS7B01G050800 chr4B 82.770 296 31 9 950 1232 6029666 6029954 1.980000e-61 246.0
48 TraesCS7B01G050800 chr4B 85.714 203 20 5 1022 1215 6026922 6027124 3.360000e-49 206.0
49 TraesCS7B01G050800 chr2D 88.043 92 8 1 1482 1570 2135058 2135149 3.510000e-19 106.0
50 TraesCS7B01G050800 chr2D 87.912 91 9 1 1482 1570 635748841 635748931 3.510000e-19 106.0
51 TraesCS7B01G050800 chr2D 97.500 40 1 0 1622 1661 636130674 636130635 4.600000e-08 69.4
52 TraesCS7B01G050800 chr5D 97.436 39 1 0 1623 1661 37359364 37359326 1.650000e-07 67.6
53 TraesCS7B01G050800 chr5D 95.349 43 1 1 1620 1661 58224560 58224518 1.650000e-07 67.6
54 TraesCS7B01G050800 chr5D 95.000 40 1 1 1622 1661 45201273 45201235 7.700000e-06 62.1
55 TraesCS7B01G050800 chr1A 97.436 39 1 0 1623 1661 23184334 23184296 1.650000e-07 67.6
56 TraesCS7B01G050800 chr5A 97.297 37 1 0 423 459 524983039 524983003 2.140000e-06 63.9
57 TraesCS7B01G050800 chr5A 97.143 35 1 0 425 459 563359836 563359802 2.770000e-05 60.2
58 TraesCS7B01G050800 chr6D 94.872 39 2 0 1623 1661 209924747 209924785 7.700000e-06 62.1
59 TraesCS7B01G050800 chr6D 97.222 36 1 0 1623 1658 376854726 376854691 7.700000e-06 62.1
60 TraesCS7B01G050800 chr6D 92.105 38 2 1 1625 1662 472313394 472313358 5.000000e-03 52.8
61 TraesCS7B01G050800 chr1D 94.872 39 2 0 1623 1661 489955731 489955693 7.700000e-06 62.1
62 TraesCS7B01G050800 chr1D 94.872 39 2 0 1623 1661 489967334 489967296 7.700000e-06 62.1
63 TraesCS7B01G050800 chr1D 97.143 35 1 0 1623 1657 269400009 269400043 2.770000e-05 60.2
64 TraesCS7B01G050800 chr1D 94.444 36 2 0 424 459 445242815 445242850 3.580000e-04 56.5
65 TraesCS7B01G050800 chr3D 94.444 36 2 0 422 457 79555155 79555120 3.580000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G050800 chr7B 52675703 52678278 2575 True 4758.00 4758 100.0000 1 2576 1 chr7B.!!$R2 2575
1 TraesCS7B01G050800 chr7B 52654320 52656896 2576 True 4702.00 4702 99.6120 1 2576 1 chr7B.!!$R1 2575
2 TraesCS7B01G050800 chr7B 145724627 145725270 643 True 1123.00 1123 98.1400 1932 2576 1 chr7B.!!$R3 644
3 TraesCS7B01G050800 chr7D 98038298 98039322 1024 True 775.35 1496 92.9305 504 1585 2 chr7D.!!$R2 1081
4 TraesCS7B01G050800 chr6B 705548780 705549550 770 True 1256.00 1256 96.1190 1808 2576 1 chr6B.!!$R2 768
5 TraesCS7B01G050800 chr6B 22579463 22580119 656 True 1110.00 1110 97.1170 1918 2576 1 chr6B.!!$R1 658
6 TraesCS7B01G050800 chr6B 685008189 685008837 648 False 1048.00 1048 95.5990 1918 2576 1 chr6B.!!$F3 658
7 TraesCS7B01G050800 chr2B 13306370 13307020 650 True 1038.00 1038 95.2960 1918 2576 1 chr2B.!!$R1 658
8 TraesCS7B01G050800 chr2B 677038159 677038970 811 True 652.50 1105 96.8295 1804 2576 2 chr2B.!!$R2 772
9 TraesCS7B01G050800 chr1B 654115675 654116333 658 True 1079.00 1079 96.2060 1918 2576 1 chr1B.!!$R2 658
10 TraesCS7B01G050800 chr5B 697922792 697923445 653 False 1051.00 1051 95.5930 1919 2576 1 chr5B.!!$F1 657
11 TraesCS7B01G050800 chr2A 58197177 58197937 760 True 815.00 815 86.7680 1827 2572 1 chr2A.!!$R1 745
12 TraesCS7B01G050800 chr7A 720438691 720439464 773 False 750.00 750 84.9690 1808 2571 1 chr7A.!!$F2 763
13 TraesCS7B01G050800 chr7A 586343471 586344244 773 True 739.00 739 84.7010 1808 2571 1 chr7A.!!$R1 763
14 TraesCS7B01G050800 chr7A 720378043 720378817 774 False 739.00 739 84.7200 1808 2571 1 chr7A.!!$F1 763
15 TraesCS7B01G050800 chr7A 100554597 100555796 1199 True 361.00 455 92.2060 586 1791 4 chr7A.!!$R2 1205
16 TraesCS7B01G050800 chr3B 26646055 26646792 737 True 625.00 625 82.7980 1835 2576 1 chr3B.!!$R1 741
17 TraesCS7B01G050800 chr4D 3428152 3430298 2146 True 241.50 246 84.6120 992 1572 2 chr4D.!!$R2 580
18 TraesCS7B01G050800 chr4B 6026922 6029954 3032 False 226.00 246 84.2420 950 1232 2 chr4B.!!$F1 282

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
493 495 5.689383 AAATGAGTGTTTGCGTCTGTAAT 57.311 34.783 0.0 0.0 0.0 1.89 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1793 4344 3.192633 GCACTCCCCAATATCAAAACGTT 59.807 43.478 0.0 0.0 0.0 3.99 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
493 495 5.689383 AAATGAGTGTTTGCGTCTGTAAT 57.311 34.783 0.0 0.0 0.0 1.89
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
593 595 6.556682 CGTTTTTGTCACGTTGCTTAATTAC 58.443 36.000 0.0 0.0 32.8 1.89
1793 4344 3.192633 GCACTCCCCAATATCAAAACGTT 59.807 43.478 0.0 0.0 0.0 3.99


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.