Multiple sequence alignment - TraesCS7B01G049500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G049500 chr7B 100.000 2674 0 0 1 2674 49400681 49403354 0 4939
1 TraesCS7B01G049500 chr7B 99.201 1001 8 0 1 1001 49390996 49391996 0 1805
2 TraesCS7B01G049500 chr7B 98.510 1007 14 1 1669 2674 49392000 49393006 0 1775
3 TraesCS7B01G049500 chr7B 95.631 1007 38 5 1669 2674 550904171 550903170 0 1611
4 TraesCS7B01G049500 chr7B 95.414 1003 39 6 1669 2670 331105450 331104454 0 1591
5 TraesCS7B01G049500 chr2B 99.101 1001 8 1 1 1001 635402953 635403952 0 1797
6 TraesCS7B01G049500 chr3B 98.902 1002 9 2 1 1001 661253408 661252408 0 1788
7 TraesCS7B01G049500 chr3B 95.531 1007 39 5 1669 2674 732080865 732081866 0 1605
8 TraesCS7B01G049500 chr4A 98.901 1001 10 1 1 1001 245841976 245840977 0 1786
9 TraesCS7B01G049500 chr4A 95.631 1007 38 5 1669 2674 79137264 79136263 0 1611
10 TraesCS7B01G049500 chr4A 95.233 1007 42 5 1669 2674 22566890 22565889 0 1589
11 TraesCS7B01G049500 chr3A 98.901 1001 9 2 1 1001 680027077 680026079 0 1786
12 TraesCS7B01G049500 chr5A 98.900 1000 10 1 2 1001 9134659 9135657 0 1784
13 TraesCS7B01G049500 chr5A 95.333 1007 42 5 1669 2674 380605492 380604490 0 1594
14 TraesCS7B01G049500 chr6B 98.801 1001 12 0 1 1001 687381846 687382846 0 1783
15 TraesCS7B01G049500 chr6B 95.233 1007 44 4 1669 2674 541338746 541339749 0 1591
16 TraesCS7B01G049500 chrUn 98.801 1001 11 1 1 1001 389174060 389173061 0 1781
17 TraesCS7B01G049500 chrUn 99.555 674 3 0 1000 1673 67510035 67509362 0 1229
18 TraesCS7B01G049500 chrUn 99.409 677 4 0 997 1673 199875570 199876246 0 1229
19 TraesCS7B01G049500 chrUn 99.409 677 4 0 997 1673 199905490 199906166 0 1229
20 TraesCS7B01G049500 chrUn 99.407 674 4 0 1000 1673 229309478 229308805 0 1223
21 TraesCS7B01G049500 chrUn 99.261 677 5 0 997 1673 245706814 245707490 0 1223
22 TraesCS7B01G049500 chrUn 99.407 674 4 0 1000 1673 260639443 260638770 0 1223
23 TraesCS7B01G049500 chrUn 99.407 674 4 0 1000 1673 274340533 274339860 0 1223
24 TraesCS7B01G049500 chrUn 99.261 677 5 0 997 1673 291536186 291536862 0 1223
25 TraesCS7B01G049500 chr4B 98.801 1001 11 1 1 1001 25651805 25652804 0 1781
26 TraesCS7B01G049500 chr7A 95.333 1007 41 5 1669 2674 381762759 381761758 0 1594
27 TraesCS7B01G049500 chr1B 99.409 677 4 0 997 1673 544594441 544595117 0 1229


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G049500 chr7B 49400681 49403354 2673 False 4939 4939 100.0000 1 2674 1 chr7B.!!$F1 2673
1 TraesCS7B01G049500 chr7B 49390996 49393006 2010 False 1790 1805 98.8555 1 2674 2 chr7B.!!$F2 2673
2 TraesCS7B01G049500 chr7B 550903170 550904171 1001 True 1611 1611 95.6310 1669 2674 1 chr7B.!!$R2 1005
3 TraesCS7B01G049500 chr7B 331104454 331105450 996 True 1591 1591 95.4140 1669 2670 1 chr7B.!!$R1 1001
4 TraesCS7B01G049500 chr2B 635402953 635403952 999 False 1797 1797 99.1010 1 1001 1 chr2B.!!$F1 1000
5 TraesCS7B01G049500 chr3B 661252408 661253408 1000 True 1788 1788 98.9020 1 1001 1 chr3B.!!$R1 1000
6 TraesCS7B01G049500 chr3B 732080865 732081866 1001 False 1605 1605 95.5310 1669 2674 1 chr3B.!!$F1 1005
7 TraesCS7B01G049500 chr4A 245840977 245841976 999 True 1786 1786 98.9010 1 1001 1 chr4A.!!$R3 1000
8 TraesCS7B01G049500 chr4A 79136263 79137264 1001 True 1611 1611 95.6310 1669 2674 1 chr4A.!!$R2 1005
9 TraesCS7B01G049500 chr4A 22565889 22566890 1001 True 1589 1589 95.2330 1669 2674 1 chr4A.!!$R1 1005
10 TraesCS7B01G049500 chr3A 680026079 680027077 998 True 1786 1786 98.9010 1 1001 1 chr3A.!!$R1 1000
11 TraesCS7B01G049500 chr5A 9134659 9135657 998 False 1784 1784 98.9000 2 1001 1 chr5A.!!$F1 999
12 TraesCS7B01G049500 chr5A 380604490 380605492 1002 True 1594 1594 95.3330 1669 2674 1 chr5A.!!$R1 1005
13 TraesCS7B01G049500 chr6B 687381846 687382846 1000 False 1783 1783 98.8010 1 1001 1 chr6B.!!$F2 1000
14 TraesCS7B01G049500 chr6B 541338746 541339749 1003 False 1591 1591 95.2330 1669 2674 1 chr6B.!!$F1 1005
15 TraesCS7B01G049500 chrUn 389173061 389174060 999 True 1781 1781 98.8010 1 1001 1 chrUn.!!$R5 1000
16 TraesCS7B01G049500 chrUn 67509362 67510035 673 True 1229 1229 99.5550 1000 1673 1 chrUn.!!$R1 673
17 TraesCS7B01G049500 chrUn 199875570 199876246 676 False 1229 1229 99.4090 997 1673 1 chrUn.!!$F1 676
18 TraesCS7B01G049500 chrUn 199905490 199906166 676 False 1229 1229 99.4090 997 1673 1 chrUn.!!$F2 676
19 TraesCS7B01G049500 chrUn 229308805 229309478 673 True 1223 1223 99.4070 1000 1673 1 chrUn.!!$R2 673
20 TraesCS7B01G049500 chrUn 245706814 245707490 676 False 1223 1223 99.2610 997 1673 1 chrUn.!!$F3 676
21 TraesCS7B01G049500 chrUn 260638770 260639443 673 True 1223 1223 99.4070 1000 1673 1 chrUn.!!$R3 673
22 TraesCS7B01G049500 chrUn 274339860 274340533 673 True 1223 1223 99.4070 1000 1673 1 chrUn.!!$R4 673
23 TraesCS7B01G049500 chrUn 291536186 291536862 676 False 1223 1223 99.2610 997 1673 1 chrUn.!!$F4 676
24 TraesCS7B01G049500 chr4B 25651805 25652804 999 False 1781 1781 98.8010 1 1001 1 chr4B.!!$F1 1000
25 TraesCS7B01G049500 chr7A 381761758 381762759 1001 True 1594 1594 95.3330 1669 2674 1 chr7A.!!$R1 1005
26 TraesCS7B01G049500 chr1B 544594441 544595117 676 False 1229 1229 99.4090 997 1673 1 chr1B.!!$F1 676

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1094 1096 1.394618 CAACCCTGGAAACGGTTCAA 58.605 50.0 16.38 1.89 40.44 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2340 2342 9.99291 CGTAAGATATAATAAATGCATGCATGT 57.007 29.63 32.79 29.33 43.02 3.21 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1094 1096 1.394618 CAACCCTGGAAACGGTTCAA 58.605 50.000 16.38 1.89 40.44 2.69
1823 1825 4.141287 TCCATGTCAAGTTTCGTTCCATT 58.859 39.130 0.00 0.00 0.00 3.16
2290 2292 3.578978 GTTTCCCCTTTTTCTTACCCCA 58.421 45.455 0.00 0.00 0.00 4.96
2340 2342 6.293571 CCTTGCTGAATTAATCATGTCGCATA 60.294 38.462 0.00 0.00 35.98 3.14
2670 2673 4.402793 GTCAGTAGTATGTCTCCACACCAT 59.597 45.833 0.00 0.00 34.48 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1094 1096 2.363361 CTGGACCCTACCTCCGGT 59.637 66.667 0.00 0.00 40.16 5.28
1453 1455 3.062763 CTGAGTCGACTGTTTCATGCTT 58.937 45.455 25.58 0.00 0.00 3.91
1740 1742 5.908341 TGTACAAAATTTTTCCCACAGTCC 58.092 37.500 0.00 0.00 0.00 3.85
1823 1825 9.241919 TCAAAGCTGACAATTGATTAGGATAAA 57.758 29.630 13.59 0.00 0.00 1.40
2340 2342 9.992910 CGTAAGATATAATAAATGCATGCATGT 57.007 29.630 32.79 29.33 43.02 3.21


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.