Multiple sequence alignment - TraesCS7B01G046600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G046600 chr7B 100.000 2117 0 0 1 2117 45216294 45214178 0.000000e+00 3873
1 TraesCS7B01G046600 chr7B 96.636 654 19 3 1 652 45259620 45258968 0.000000e+00 1083
2 TraesCS7B01G046600 chr7B 95.253 653 30 1 1 652 45252213 45251561 0.000000e+00 1033
3 TraesCS7B01G046600 chr7B 94.064 657 32 6 1 652 319033468 319032814 0.000000e+00 990
4 TraesCS7B01G046600 chr7B 94.349 584 33 0 1534 2117 45258964 45258381 0.000000e+00 896
5 TraesCS7B01G046600 chr7B 94.027 586 32 2 1534 2117 28992980 28993564 0.000000e+00 885
6 TraesCS7B01G046600 chr7B 100.000 185 0 0 1339 1523 45215421 45215237 2.010000e-90 342
7 TraesCS7B01G046600 chrUn 99.112 676 6 0 653 1328 445812516 445811841 0.000000e+00 1216
8 TraesCS7B01G046600 chrUn 98.919 185 2 0 1339 1523 445812295 445812111 4.350000e-87 331
9 TraesCS7B01G046600 chr3B 99.112 676 6 0 653 1328 201513648 201514323 0.000000e+00 1216
10 TraesCS7B01G046600 chr3B 93.323 659 34 8 1 652 538507707 538507052 0.000000e+00 965
11 TraesCS7B01G046600 chr3B 93.390 590 33 5 1528 2116 132727279 132726695 0.000000e+00 869
12 TraesCS7B01G046600 chr3B 99.459 185 1 0 1339 1523 201514406 201514590 9.360000e-89 337
13 TraesCS7B01G046600 chr3B 99.454 183 1 0 1339 1521 201513869 201514051 1.210000e-87 333
14 TraesCS7B01G046600 chr5D 97.932 677 12 2 653 1328 560873015 560873690 0.000000e+00 1171
15 TraesCS7B01G046600 chr5D 97.198 678 15 4 653 1328 6200735 6200060 0.000000e+00 1144
16 TraesCS7B01G046600 chr5D 96.898 677 19 2 653 1328 329162724 329163399 0.000000e+00 1133
17 TraesCS7B01G046600 chr5D 98.913 184 2 0 1339 1522 560873236 560873419 1.570000e-86 329
18 TraesCS7B01G046600 chr5D 98.907 183 2 0 1339 1521 6200515 6200333 5.630000e-86 327
19 TraesCS7B01G046600 chr5D 97.838 185 4 0 1339 1523 329162945 329163129 9.420000e-84 320
20 TraesCS7B01G046600 chr6B 97.337 676 18 0 653 1328 22426491 22427166 0.000000e+00 1149
21 TraesCS7B01G046600 chr1D 97.341 677 16 2 653 1328 254498545 254499220 0.000000e+00 1149
22 TraesCS7B01G046600 chr1D 98.919 185 2 0 1339 1523 254498766 254498950 4.350000e-87 331
23 TraesCS7B01G046600 chr1D 98.919 185 2 0 1339 1523 318665248 318665432 4.350000e-87 331
24 TraesCS7B01G046600 chr4D 96.750 677 18 4 653 1328 19917042 19917715 0.000000e+00 1125
25 TraesCS7B01G046600 chr1A 96.603 677 20 3 653 1328 168450020 168449346 0.000000e+00 1120
26 TraesCS7B01G046600 chr5B 93.972 647 37 2 1 646 159635775 159636420 0.000000e+00 977
27 TraesCS7B01G046600 chr5B 93.702 651 38 3 3 652 316167224 316167872 0.000000e+00 972
28 TraesCS7B01G046600 chr5B 93.313 658 37 6 1 652 37764373 37763717 0.000000e+00 965
29 TraesCS7B01G046600 chr5B 93.282 655 38 6 1 652 396774845 396774194 0.000000e+00 961
30 TraesCS7B01G046600 chr4B 93.617 658 35 6 1 652 432800995 432801651 0.000000e+00 976
31 TraesCS7B01G046600 chr4B 93.504 585 38 0 1533 2117 241514558 241515142 0.000000e+00 870
32 TraesCS7B01G046600 chr4B 93.109 595 40 1 1524 2117 438082076 438082670 0.000000e+00 870
33 TraesCS7B01G046600 chr4B 92.345 614 41 5 1507 2117 487848784 487848174 0.000000e+00 869
34 TraesCS7B01G046600 chr1B 94.599 574 29 2 1545 2117 580608822 580609394 0.000000e+00 887
35 TraesCS7B01G046600 chr1B 93.537 588 32 5 1533 2117 400191019 400190435 0.000000e+00 870
36 TraesCS7B01G046600 chr2B 93.504 585 38 0 1533 2117 697498422 697499006 0.000000e+00 870
37 TraesCS7B01G046600 chr2B 93.220 590 38 2 1529 2117 154884989 154885577 0.000000e+00 867
38 TraesCS7B01G046600 chr3D 98.919 185 2 0 1339 1523 21905395 21905579 4.350000e-87 331


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G046600 chr7B 45214178 45216294 2116 True 2107.500000 3873 100.000000 1 2117 2 chr7B.!!$R3 2116
1 TraesCS7B01G046600 chr7B 45251561 45252213 652 True 1033.000000 1033 95.253000 1 652 1 chr7B.!!$R1 651
2 TraesCS7B01G046600 chr7B 319032814 319033468 654 True 990.000000 990 94.064000 1 652 1 chr7B.!!$R2 651
3 TraesCS7B01G046600 chr7B 45258381 45259620 1239 True 989.500000 1083 95.492500 1 2117 2 chr7B.!!$R4 2116
4 TraesCS7B01G046600 chr7B 28992980 28993564 584 False 885.000000 885 94.027000 1534 2117 1 chr7B.!!$F1 583
5 TraesCS7B01G046600 chrUn 445811841 445812516 675 True 773.500000 1216 99.015500 653 1523 2 chrUn.!!$R1 870
6 TraesCS7B01G046600 chr3B 538507052 538507707 655 True 965.000000 965 93.323000 1 652 1 chr3B.!!$R2 651
7 TraesCS7B01G046600 chr3B 132726695 132727279 584 True 869.000000 869 93.390000 1528 2116 1 chr3B.!!$R1 588
8 TraesCS7B01G046600 chr3B 201513648 201514590 942 False 628.666667 1216 99.341667 653 1523 3 chr3B.!!$F1 870
9 TraesCS7B01G046600 chr5D 560873015 560873690 675 False 750.000000 1171 98.422500 653 1522 2 chr5D.!!$F2 869
10 TraesCS7B01G046600 chr5D 6200060 6200735 675 True 735.500000 1144 98.052500 653 1521 2 chr5D.!!$R1 868
11 TraesCS7B01G046600 chr5D 329162724 329163399 675 False 726.500000 1133 97.368000 653 1523 2 chr5D.!!$F1 870
12 TraesCS7B01G046600 chr6B 22426491 22427166 675 False 1149.000000 1149 97.337000 653 1328 1 chr6B.!!$F1 675
13 TraesCS7B01G046600 chr1D 254498545 254499220 675 False 740.000000 1149 98.130000 653 1523 2 chr1D.!!$F2 870
14 TraesCS7B01G046600 chr4D 19917042 19917715 673 False 1125.000000 1125 96.750000 653 1328 1 chr4D.!!$F1 675
15 TraesCS7B01G046600 chr1A 168449346 168450020 674 True 1120.000000 1120 96.603000 653 1328 1 chr1A.!!$R1 675
16 TraesCS7B01G046600 chr5B 159635775 159636420 645 False 977.000000 977 93.972000 1 646 1 chr5B.!!$F1 645
17 TraesCS7B01G046600 chr5B 316167224 316167872 648 False 972.000000 972 93.702000 3 652 1 chr5B.!!$F2 649
18 TraesCS7B01G046600 chr5B 37763717 37764373 656 True 965.000000 965 93.313000 1 652 1 chr5B.!!$R1 651
19 TraesCS7B01G046600 chr5B 396774194 396774845 651 True 961.000000 961 93.282000 1 652 1 chr5B.!!$R2 651
20 TraesCS7B01G046600 chr4B 432800995 432801651 656 False 976.000000 976 93.617000 1 652 1 chr4B.!!$F2 651
21 TraesCS7B01G046600 chr4B 241514558 241515142 584 False 870.000000 870 93.504000 1533 2117 1 chr4B.!!$F1 584
22 TraesCS7B01G046600 chr4B 438082076 438082670 594 False 870.000000 870 93.109000 1524 2117 1 chr4B.!!$F3 593
23 TraesCS7B01G046600 chr4B 487848174 487848784 610 True 869.000000 869 92.345000 1507 2117 1 chr4B.!!$R1 610
24 TraesCS7B01G046600 chr1B 580608822 580609394 572 False 887.000000 887 94.599000 1545 2117 1 chr1B.!!$F1 572
25 TraesCS7B01G046600 chr1B 400190435 400191019 584 True 870.000000 870 93.537000 1533 2117 1 chr1B.!!$R1 584
26 TraesCS7B01G046600 chr2B 697498422 697499006 584 False 870.000000 870 93.504000 1533 2117 1 chr2B.!!$F2 584
27 TraesCS7B01G046600 chr2B 154884989 154885577 588 False 867.000000 867 93.220000 1529 2117 1 chr2B.!!$F1 588

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
237 240 0.24445 CAAATTGCCATGTCAGCCGT 59.756 50.0 0.0 0.0 0.0 5.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1974 2062 1.269621 CGTGTTCACTTTCCGGACTCT 60.27 52.381 1.83 0.0 0.0 3.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
30 31 6.094325 TCGTTAGTTCCTGTTTTGTTGTGATT 59.906 34.615 0.00 0.00 0.00 2.57
136 137 1.066430 GCAAGATGACCGTTACCCTGA 60.066 52.381 0.00 0.00 0.00 3.86
144 145 2.232941 GACCGTTACCCTGAATCTCACA 59.767 50.000 0.00 0.00 0.00 3.58
237 240 0.244450 CAAATTGCCATGTCAGCCGT 59.756 50.000 0.00 0.00 0.00 5.68
461 471 1.404035 GTTTTGTTCCACTCTTGCCGT 59.596 47.619 0.00 0.00 0.00 5.68
632 646 4.394712 CCCTTGGGAGTCGCGCTT 62.395 66.667 5.56 0.00 0.00 4.68
734 748 2.415893 GCATGGCGCTAGAACATTGTTT 60.416 45.455 7.64 0.00 37.77 2.83
827 841 5.501156 GGAGATCCAACTACAAGGAAACAT 58.499 41.667 0.00 0.00 37.48 2.71
1654 1742 0.321564 CCGATGTTGCCCTGAGAACA 60.322 55.000 0.00 0.00 36.54 3.18
1869 1957 4.430765 AGTCGTGCCCGCGGTTAG 62.431 66.667 26.12 10.30 0.00 2.34
1974 2062 0.904865 ATGGTGGTCTCTTCTCGGCA 60.905 55.000 0.00 0.00 0.00 5.69
2060 2152 4.063998 TGATCATTGCTAGCTTCACGAT 57.936 40.909 17.23 10.37 0.00 3.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
30 31 2.159612 CGTAGACGAACGAATCCTCACA 60.160 50.000 0.14 0.00 45.68 3.58
136 137 6.996879 AGCATAGCAATGATAGTTGTGAGATT 59.003 34.615 0.00 0.00 34.84 2.40
237 240 5.074804 GCTAGGAAGGGTGAAAAAGGTTAA 58.925 41.667 0.00 0.00 0.00 2.01
461 471 4.529377 ACACCGGTATGAAAGAAACTAGGA 59.471 41.667 6.87 0.00 0.00 2.94
632 646 5.022787 CCCCAAATAAAGATGACCCTCAAA 58.977 41.667 0.00 0.00 0.00 2.69
734 748 5.000591 TCAATACCAGCAAAAACATCTCGA 58.999 37.500 0.00 0.00 0.00 4.04
766 780 3.094572 CCAAATTCCACTTGAGCATCCT 58.905 45.455 0.00 0.00 0.00 3.24
827 841 2.495155 ACAATGTGTATCAGGCTGCA 57.505 45.000 10.34 1.42 0.00 4.41
1654 1742 4.185467 CGATAGGAGCTGCACATATCTT 57.815 45.455 22.52 3.57 31.60 2.40
1974 2062 1.269621 CGTGTTCACTTTCCGGACTCT 60.270 52.381 1.83 0.00 0.00 3.24
2007 2097 7.876068 TGATCCTGAAACTACTTACGTTCAAAT 59.124 33.333 0.00 0.00 0.00 2.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.