Multiple sequence alignment - TraesCS7B01G023800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G023800 chr7B 100.000 2785 0 0 1 2785 22770684 22773468 0.000000e+00 5144
1 TraesCS7B01G023800 chr7B 98.170 2787 44 5 1 2785 22891809 22894590 0.000000e+00 4857
2 TraesCS7B01G023800 chr7B 98.266 1557 26 1 1 1556 22962750 22964306 0.000000e+00 2724
3 TraesCS7B01G023800 chr7B 98.072 1556 30 0 1 1556 22708755 22710310 0.000000e+00 2708
4 TraesCS7B01G023800 chr7B 97.622 1556 35 2 1 1556 22667026 22668579 0.000000e+00 2667
5 TraesCS7B01G023800 chr7B 98.138 1235 20 2 1552 2785 22710352 22711584 0.000000e+00 2150
6 TraesCS7B01G023800 chr7B 98.138 1235 20 2 1552 2785 22834037 22835269 0.000000e+00 2150
7 TraesCS7B01G023800 chr7B 97.652 1235 20 4 1552 2785 22668621 22669847 0.000000e+00 2111
8 TraesCS7B01G023800 chr7B 98.182 990 16 1 1 988 22832025 22833014 0.000000e+00 1727
9 TraesCS7B01G023800 chr7B 98.523 880 10 3 1552 2429 22964348 22965226 0.000000e+00 1550
10 TraesCS7B01G023800 chr7B 96.192 919 32 3 1 919 23007974 23008889 0.000000e+00 1500
11 TraesCS7B01G023800 chr7B 98.100 579 10 1 978 1556 22833418 22833995 0.000000e+00 1007
12 TraesCS7B01G023800 chr7B 82.486 708 102 12 854 1556 23410815 23411505 3.970000e-168 601
13 TraesCS7B01G023800 chr7B 80.796 729 114 17 841 1556 23084170 23084885 5.240000e-152 547
14 TraesCS7B01G023800 chr7B 93.774 257 14 1 2529 2785 22789496 22789750 4.350000e-103 385
15 TraesCS7B01G023800 chr7D 96.144 1556 54 3 1 1556 76502240 76503789 0.000000e+00 2536
16 TraesCS7B01G023800 chr7D 94.170 1235 39 4 1552 2785 76521979 76523181 0.000000e+00 1851
17 TraesCS7B01G023800 chr7D 93.441 1235 48 4 1552 2785 76503831 76505033 0.000000e+00 1801
18 TraesCS7B01G023800 chr7D 97.414 812 20 1 217 1028 76520389 76521199 0.000000e+00 1382
19 TraesCS7B01G023800 chr7D 94.242 712 34 4 1972 2682 76482579 76483284 0.000000e+00 1081
20 TraesCS7B01G023800 chr7D 96.525 518 18 0 1039 1556 76521420 76521937 0.000000e+00 857
21 TraesCS7B01G023800 chr7D 81.779 461 63 19 1542 1995 76726520 76726966 1.580000e-97 366
22 TraesCS7B01G023800 chr7A 95.307 1513 61 7 46 1556 80538322 80539826 0.000000e+00 2392
23 TraesCS7B01G023800 chr7A 94.906 1217 52 4 1552 2762 80539868 80541080 0.000000e+00 1895


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G023800 chr7B 22770684 22773468 2784 False 5144.000000 5144 100.000000 1 2785 1 chr7B.!!$F1 2784
1 TraesCS7B01G023800 chr7B 22891809 22894590 2781 False 4857.000000 4857 98.170000 1 2785 1 chr7B.!!$F3 2784
2 TraesCS7B01G023800 chr7B 22708755 22711584 2829 False 2429.000000 2708 98.105000 1 2785 2 chr7B.!!$F8 2784
3 TraesCS7B01G023800 chr7B 22667026 22669847 2821 False 2389.000000 2667 97.637000 1 2785 2 chr7B.!!$F7 2784
4 TraesCS7B01G023800 chr7B 22962750 22965226 2476 False 2137.000000 2724 98.394500 1 2429 2 chr7B.!!$F10 2428
5 TraesCS7B01G023800 chr7B 22832025 22835269 3244 False 1628.000000 2150 98.140000 1 2785 3 chr7B.!!$F9 2784
6 TraesCS7B01G023800 chr7B 23007974 23008889 915 False 1500.000000 1500 96.192000 1 919 1 chr7B.!!$F4 918
7 TraesCS7B01G023800 chr7B 23410815 23411505 690 False 601.000000 601 82.486000 854 1556 1 chr7B.!!$F6 702
8 TraesCS7B01G023800 chr7B 23084170 23084885 715 False 547.000000 547 80.796000 841 1556 1 chr7B.!!$F5 715
9 TraesCS7B01G023800 chr7D 76502240 76505033 2793 False 2168.500000 2536 94.792500 1 2785 2 chr7D.!!$F3 2784
10 TraesCS7B01G023800 chr7D 76520389 76523181 2792 False 1363.333333 1851 96.036333 217 2785 3 chr7D.!!$F4 2568
11 TraesCS7B01G023800 chr7D 76482579 76483284 705 False 1081.000000 1081 94.242000 1972 2682 1 chr7D.!!$F1 710
12 TraesCS7B01G023800 chr7A 80538322 80541080 2758 False 2143.500000 2392 95.106500 46 2762 2 chr7A.!!$F1 2716

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
215 218 4.142315 ACGTATCTAAAGGCGTACATGTGT 60.142 41.667 9.11 0.0 35.71 3.72 F
930 935 5.946377 ACACTAATTAAAGGCCCAAGAGAAG 59.054 40.000 0.00 0.0 0.00 2.85 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1302 1940 0.739561 CGTCGTCCCAAACCCAAAAA 59.260 50.000 0.0 0.0 0.00 1.94 R
2122 2871 1.228644 ATGCACCTCAAGCCTGCAA 60.229 52.632 0.0 0.0 43.85 4.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
215 218 4.142315 ACGTATCTAAAGGCGTACATGTGT 60.142 41.667 9.11 0.00 35.71 3.72
583 586 7.237920 ACCTTTTGTTTAAGTGTACACTACG 57.762 36.000 28.13 12.00 41.58 3.51
638 641 8.630054 TCTAAATACTTAAAGTGGCACATGTT 57.370 30.769 21.41 12.83 44.52 2.71
930 935 5.946377 ACACTAATTAAAGGCCCAAGAGAAG 59.054 40.000 0.00 0.00 0.00 2.85
1301 1939 6.040054 GGAAACCTTACTCCAAGCAAGTTTTA 59.960 38.462 0.00 0.00 30.79 1.52
1302 1940 7.255836 GGAAACCTTACTCCAAGCAAGTTTTAT 60.256 37.037 0.00 0.00 30.79 1.40
1322 1960 1.102222 TTTTGGGTTTGGGACGACGG 61.102 55.000 0.00 0.00 0.00 4.79
2122 2871 2.306847 AGCCATGGTTTCACTTTTCGT 58.693 42.857 14.67 0.00 0.00 3.85
2338 3087 6.506770 ATGGTGGATATCCAGTCCATAATCTT 59.493 38.462 31.60 16.68 45.62 2.40
2546 3296 5.661458 CACTTAACAGTGTCTATCCCGAAT 58.339 41.667 0.00 0.00 44.96 3.34
2565 3315 4.327680 GAATGCAGTTTACCTCAAGGACT 58.672 43.478 2.30 0.00 38.94 3.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
128 131 8.995027 ATTATATTTCCATGGACTAGTTGCAA 57.005 30.769 15.91 3.54 0.00 4.08
215 218 5.303333 TGTCAAGTCAGATAGTTGGTGTACA 59.697 40.000 0.00 0.00 38.79 2.90
286 289 7.070198 AGCAATGGATATGGATTCATTTTGACA 59.930 33.333 0.00 0.00 37.96 3.58
564 567 4.605968 TCGCGTAGTGTACACTTAAACAA 58.394 39.130 32.15 11.73 42.54 2.83
583 586 9.107367 GTGCATCTAATAAATAGACAAATTCGC 57.893 33.333 0.00 0.00 43.33 4.70
1301 1939 1.338655 CGTCGTCCCAAACCCAAAAAT 59.661 47.619 0.00 0.00 0.00 1.82
1302 1940 0.739561 CGTCGTCCCAAACCCAAAAA 59.260 50.000 0.00 0.00 0.00 1.94
1345 1983 5.465390 CGTGTCTCTGGAATTTGTTGTCTTA 59.535 40.000 0.00 0.00 0.00 2.10
1346 1984 4.273480 CGTGTCTCTGGAATTTGTTGTCTT 59.727 41.667 0.00 0.00 0.00 3.01
1864 2612 6.545504 TTCTCTTCAACAAATAGAGCACAC 57.454 37.500 0.00 0.00 36.27 3.82
1970 2718 7.422399 GCTAATGTTGTTAAAACAGAACCTCA 58.578 34.615 0.00 0.00 40.50 3.86
2122 2871 1.228644 ATGCACCTCAAGCCTGCAA 60.229 52.632 0.00 0.00 43.85 4.08
2338 3087 3.131933 CCAACAAACAGATGGGTTGACAA 59.868 43.478 12.76 0.00 42.34 3.18
2546 3296 6.439375 TCTTATAGTCCTTGAGGTAAACTGCA 59.561 38.462 0.00 0.00 36.34 4.41
2565 3315 6.916909 TGTGGAAAATAATGGGGCTCTTATA 58.083 36.000 0.00 0.00 0.00 0.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.