Multiple sequence alignment - TraesCS7B01G023700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G023700 chr7B 100.000 2461 0 0 1 2461 22731190 22733650 0.000000e+00 4545
1 TraesCS7B01G023700 chr7B 97.527 2467 53 7 1 2461 22802815 22805279 0.000000e+00 4211
2 TraesCS7B01G023700 chr7B 97.201 2465 61 6 1 2461 22623724 22626184 0.000000e+00 4163
3 TraesCS7B01G023700 chr7B 97.161 2466 62 7 1 2461 22910564 22913026 0.000000e+00 4159
4 TraesCS7B01G023700 chr7B 97.077 2463 66 6 1 2461 22980042 22982500 0.000000e+00 4145
5 TraesCS7B01G023700 chr7B 96.836 2465 59 10 1 2461 22849774 22852223 0.000000e+00 4102
6 TraesCS7B01G023700 chr2B 96.578 1987 63 3 1 1984 357927640 357929624 0.000000e+00 3288
7 TraesCS7B01G023700 chr4B 94.358 2003 89 16 1 1984 44959918 44961915 0.000000e+00 3051
8 TraesCS7B01G023700 chr4B 94.697 132 5 2 1856 1985 655117024 655117155 1.150000e-48 204
9 TraesCS7B01G023700 chr6B 96.756 1819 53 4 1 1816 27352996 27351181 0.000000e+00 3027
10 TraesCS7B01G023700 chr6B 97.647 170 4 0 1814 1983 27340481 27340312 2.390000e-75 292
11 TraesCS7B01G023700 chr4A 90.691 1998 161 20 1 1983 26443705 26441718 0.000000e+00 2636
12 TraesCS7B01G023700 chr7A 86.874 419 41 11 1985 2396 70209028 70209439 8.020000e-125 457


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G023700 chr7B 22731190 22733650 2460 False 4545 4545 100.000 1 2461 1 chr7B.!!$F2 2460
1 TraesCS7B01G023700 chr7B 22802815 22805279 2464 False 4211 4211 97.527 1 2461 1 chr7B.!!$F3 2460
2 TraesCS7B01G023700 chr7B 22623724 22626184 2460 False 4163 4163 97.201 1 2461 1 chr7B.!!$F1 2460
3 TraesCS7B01G023700 chr7B 22910564 22913026 2462 False 4159 4159 97.161 1 2461 1 chr7B.!!$F5 2460
4 TraesCS7B01G023700 chr7B 22980042 22982500 2458 False 4145 4145 97.077 1 2461 1 chr7B.!!$F6 2460
5 TraesCS7B01G023700 chr7B 22849774 22852223 2449 False 4102 4102 96.836 1 2461 1 chr7B.!!$F4 2460
6 TraesCS7B01G023700 chr2B 357927640 357929624 1984 False 3288 3288 96.578 1 1984 1 chr2B.!!$F1 1983
7 TraesCS7B01G023700 chr4B 44959918 44961915 1997 False 3051 3051 94.358 1 1984 1 chr4B.!!$F1 1983
8 TraesCS7B01G023700 chr6B 27351181 27352996 1815 True 3027 3027 96.756 1 1816 1 chr6B.!!$R2 1815
9 TraesCS7B01G023700 chr4A 26441718 26443705 1987 True 2636 2636 90.691 1 1983 1 chr4A.!!$R1 1982

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
356 362 2.812011 CCAACTGGCACCTAGTTTGTAC 59.188 50.0 0.0 0.0 36.29 2.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1932 1959 3.081804 CCGGCCCCATTTTATAGATGAC 58.918 50.0 0.0 0.0 0.0 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
133 134 6.575411 AGGATATACAACCCCTGATAGACAT 58.425 40.000 0.00 0.00 0.00 3.06
234 235 3.519510 GGCTAGCATTCCCATATACCTCA 59.480 47.826 18.24 0.00 0.00 3.86
282 288 6.155827 GGCTCTAGATATGATCAACAGTCAC 58.844 44.000 0.00 0.00 0.00 3.67
356 362 2.812011 CCAACTGGCACCTAGTTTGTAC 59.188 50.000 0.00 0.00 36.29 2.90
512 518 7.265599 TCCACAACTTCCCTAATATCTTTGA 57.734 36.000 0.00 0.00 0.00 2.69
595 601 9.889128 CTTTGAAATTTGGATATAAATGGGTGT 57.111 29.630 0.00 0.00 31.05 4.16
823 829 5.845734 TCATTAGGAGTACCCTACTTTGGA 58.154 41.667 9.01 2.50 46.85 3.53
1011 1019 3.496130 ACAACAAGCTGATGACGAAAGAG 59.504 43.478 0.00 0.00 0.00 2.85
1782 1795 6.465084 GGAGAGAAGTGTTGGTTATTACAGT 58.535 40.000 0.00 0.00 0.00 3.55
1897 1924 2.457598 TCTAGCTCGTTCCTGGACATT 58.542 47.619 0.00 0.00 0.00 2.71
1932 1959 5.067273 TGTAATGGTGTTACTTTCCTGGTG 58.933 41.667 0.00 0.00 0.00 4.17
2020 2049 6.893583 TGGGAAAAAGTTCATGGATTTTTCA 58.106 32.000 26.57 13.83 46.95 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
133 134 4.228210 AGCCAGACATCCTTTTGAGGATTA 59.772 41.667 5.23 0.00 45.80 1.75
282 288 2.835580 TCCACAAACAATTGGCCATG 57.164 45.000 6.09 5.28 41.01 3.66
356 362 1.379843 CCCCCATGTTTCTTCCCCG 60.380 63.158 0.00 0.00 0.00 5.73
512 518 4.108287 TGGAAGGGTTTTGGGGTTTACTAT 59.892 41.667 0.00 0.00 0.00 2.12
595 601 9.347240 GAATCTGATTTTCTATCCATCTCCAAA 57.653 33.333 4.11 0.00 0.00 3.28
823 829 2.938428 ATGAGAGAGTGACCCTCCTT 57.062 50.000 0.00 0.00 41.47 3.36
832 838 6.688637 TTCATATTGCCAAATGAGAGAGTG 57.311 37.500 3.66 0.00 33.83 3.51
919 927 4.526650 TGACCACATCGCTGGTATATACAT 59.473 41.667 14.70 0.00 45.15 2.29
1011 1019 1.967535 GCCTCTTTTGGCCAGGTTC 59.032 57.895 5.11 0.00 46.82 3.62
1142 1150 8.079211 AGTAGTTAGTTCCTAATTCTGCATCA 57.921 34.615 0.00 0.00 0.00 3.07
1897 1924 3.244875 ACACCATTACAGTCATGGCAAGA 60.245 43.478 13.02 0.00 44.69 3.02
1932 1959 3.081804 CCGGCCCCATTTTATAGATGAC 58.918 50.000 0.00 0.00 0.00 3.06
2027 2056 7.603297 TTTTTCTTCAAAATCGACGAATGTC 57.397 32.000 0.00 0.00 35.24 3.06


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.