Multiple sequence alignment - TraesCS7B01G010900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G010900 chr7B 100.000 2924 0 0 1 2924 6942270 6945193 0.000000e+00 5400.0
1 TraesCS7B01G010900 chr2B 98.929 2148 21 2 777 2924 563766010 563768155 0.000000e+00 3838.0
2 TraesCS7B01G010900 chr2B 98.604 2149 28 2 777 2924 106933065 106935212 0.000000e+00 3801.0
3 TraesCS7B01G010900 chr2B 98.557 2148 30 1 777 2924 297491194 297493340 0.000000e+00 3794.0
4 TraesCS7B01G010900 chr2B 98.586 778 11 0 1 778 106931081 106931858 0.000000e+00 1376.0
5 TraesCS7B01G010900 chr2B 98.201 778 14 0 1 778 563764026 563764803 0.000000e+00 1360.0
6 TraesCS7B01G010900 chr2B 82.911 158 19 6 3 160 169267317 169267168 5.080000e-28 135.0
7 TraesCS7B01G010900 chr2B 100.000 28 0 0 1 28 63582989 63583016 5.000000e-03 52.8
8 TraesCS7B01G010900 chr5B 98.651 2149 27 2 777 2924 36452704 36450557 0.000000e+00 3807.0
9 TraesCS7B01G010900 chr5B 98.586 778 11 0 1 778 690083270 690082493 0.000000e+00 1376.0
10 TraesCS7B01G010900 chr4B 98.651 2149 25 4 777 2924 11626784 11624639 0.000000e+00 3805.0
11 TraesCS7B01G010900 chr4B 98.072 778 15 0 1 778 244503914 244504691 0.000000e+00 1354.0
12 TraesCS7B01G010900 chr1B 98.650 2148 28 1 777 2924 26650356 26652502 0.000000e+00 3805.0
13 TraesCS7B01G010900 chr1B 97.686 778 18 0 1 778 26648372 26649149 0.000000e+00 1338.0
14 TraesCS7B01G010900 chr3B 98.603 2148 29 1 777 2924 717599405 717597259 0.000000e+00 3799.0
15 TraesCS7B01G010900 chr3B 98.597 713 9 1 67 778 717601324 717600612 0.000000e+00 1260.0
16 TraesCS7B01G010900 chr6B 98.510 2148 31 1 777 2924 21616949 21614803 0.000000e+00 3788.0
17 TraesCS7B01G010900 chr6B 98.464 2148 32 1 777 2924 586281062 586278916 0.000000e+00 3783.0
18 TraesCS7B01G010900 chr6B 98.738 713 8 1 67 778 21618717 21618005 0.000000e+00 1266.0
19 TraesCS7B01G010900 chr6B 98.457 713 10 1 67 778 586282981 586282269 0.000000e+00 1254.0
20 TraesCS7B01G010900 chr4A 97.561 779 18 1 1 778 588878271 588879049 0.000000e+00 1332.0
21 TraesCS7B01G010900 chr4A 96.800 125 4 0 1 125 340790068 340790192 2.950000e-50 209.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G010900 chr7B 6942270 6945193 2923 False 5400.0 5400 100.0000 1 2924 1 chr7B.!!$F1 2923
1 TraesCS7B01G010900 chr2B 297491194 297493340 2146 False 3794.0 3794 98.5570 777 2924 1 chr2B.!!$F2 2147
2 TraesCS7B01G010900 chr2B 563764026 563768155 4129 False 2599.0 3838 98.5650 1 2924 2 chr2B.!!$F4 2923
3 TraesCS7B01G010900 chr2B 106931081 106935212 4131 False 2588.5 3801 98.5950 1 2924 2 chr2B.!!$F3 2923
4 TraesCS7B01G010900 chr5B 36450557 36452704 2147 True 3807.0 3807 98.6510 777 2924 1 chr5B.!!$R1 2147
5 TraesCS7B01G010900 chr5B 690082493 690083270 777 True 1376.0 1376 98.5860 1 778 1 chr5B.!!$R2 777
6 TraesCS7B01G010900 chr4B 11624639 11626784 2145 True 3805.0 3805 98.6510 777 2924 1 chr4B.!!$R1 2147
7 TraesCS7B01G010900 chr4B 244503914 244504691 777 False 1354.0 1354 98.0720 1 778 1 chr4B.!!$F1 777
8 TraesCS7B01G010900 chr1B 26648372 26652502 4130 False 2571.5 3805 98.1680 1 2924 2 chr1B.!!$F1 2923
9 TraesCS7B01G010900 chr3B 717597259 717601324 4065 True 2529.5 3799 98.6000 67 2924 2 chr3B.!!$R1 2857
10 TraesCS7B01G010900 chr6B 21614803 21618717 3914 True 2527.0 3788 98.6240 67 2924 2 chr6B.!!$R1 2857
11 TraesCS7B01G010900 chr6B 586278916 586282981 4065 True 2518.5 3783 98.4605 67 2924 2 chr6B.!!$R2 2857
12 TraesCS7B01G010900 chr4A 588878271 588879049 778 False 1332.0 1332 97.5610 1 778 1 chr4A.!!$F2 777

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
718 720 2.613595 CTGCTCTGCACTTGTTGTACAA 59.386 45.455 3.59 3.59 33.88 2.41 F
1403 2764 3.078837 GGTAATTGTGTGTCCATCCGTT 58.921 45.455 0.00 0.00 0.00 4.44 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1858 3219 1.746615 GCCATGAGCTTCTTGCCGA 60.747 57.895 0.0 0.0 44.23 5.54 R
2204 3565 3.920412 GCTAGTACCATGCTTTTTGTTGC 59.080 43.478 0.0 0.0 0.00 4.17 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 2.636412 CCGCTCAAGGAGACCGTCA 61.636 63.158 0.40 0.00 0.00 4.35
160 161 6.073003 CCACTTCTTCTTCATACTGACCAAAC 60.073 42.308 0.00 0.00 0.00 2.93
198 199 4.344679 AGTGAGATTTTGGAACATTGGCAA 59.655 37.500 0.68 0.68 39.30 4.52
259 260 7.581213 TGTATTTTGGACAGTGTTGATCTTT 57.419 32.000 0.00 0.00 0.00 2.52
342 343 5.334028 GCAAATAAGTGTTTTGGTTGGATGC 60.334 40.000 0.00 0.00 35.18 3.91
718 720 2.613595 CTGCTCTGCACTTGTTGTACAA 59.386 45.455 3.59 3.59 33.88 2.41
1403 2764 3.078837 GGTAATTGTGTGTCCATCCGTT 58.921 45.455 0.00 0.00 0.00 4.44
1858 3219 1.695893 CGAGCGAACGGATGCAACAT 61.696 55.000 0.00 0.00 0.00 2.71
2204 3565 8.569641 ACTACTATCTCATTTTAACTAGCTCGG 58.430 37.037 0.00 0.00 0.00 4.63
2740 4103 2.187958 CTGACAACTGGGACCCATCTA 58.812 52.381 15.39 0.00 30.82 1.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 3.408229 CTGGGACTGGATGCTGGT 58.592 61.111 0.00 0.00 0.00 4.00
198 199 5.643777 CCTAGCTAATGCAGTGTTAAGTTGT 59.356 40.000 0.00 0.00 42.74 3.32
342 343 8.768955 GCATATTCAGTCCTTCTGTAAATGTAG 58.231 37.037 0.00 0.00 43.97 2.74
718 720 5.395768 GCAGGGTAGATAGTGATCAACTTGT 60.396 44.000 0.00 0.00 40.56 3.16
988 2349 6.182039 TCTTGTGTAAATGATGCTAGCAAC 57.818 37.500 23.54 20.21 0.00 4.17
1227 2588 3.973425 AGGTGATTTTCTCCCCAGATTG 58.027 45.455 0.00 0.00 30.62 2.67
1403 2764 3.316868 GGGCACAACTTAGTTAACTGCAA 59.683 43.478 18.56 4.56 0.00 4.08
1858 3219 1.746615 GCCATGAGCTTCTTGCCGA 60.747 57.895 0.00 0.00 44.23 5.54
2204 3565 3.920412 GCTAGTACCATGCTTTTTGTTGC 59.080 43.478 0.00 0.00 0.00 4.17
2384 3747 5.882557 GGAACCATAGTCAGATGAACAACAT 59.117 40.000 0.00 0.00 42.47 2.71
2632 3995 9.617523 TCATATTTCAAGCAGTATTCAGATTCA 57.382 29.630 0.00 0.00 0.00 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.