Multiple sequence alignment - TraesCS7B01G006300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G006300 chr7B 100.000 3464 0 0 1 3464 3539114 3542577 0.000000e+00 6397.0
1 TraesCS7B01G006300 chr7B 89.066 1509 162 3 965 2472 3342559 3341053 0.000000e+00 1869.0
2 TraesCS7B01G006300 chr7B 83.473 1077 164 8 1452 2524 3507735 3506669 0.000000e+00 990.0
3 TraesCS7B01G006300 chr7B 94.044 319 19 0 1 319 3528010 3528328 5.200000e-133 484.0
4 TraesCS7B01G006300 chr7B 94.643 56 3 0 2463 2518 3341032 3340977 1.710000e-13 87.9
5 TraesCS7B01G006300 chr7D 85.485 1557 216 10 967 2518 61228932 61227381 0.000000e+00 1615.0
6 TraesCS7B01G006300 chr7D 85.865 1514 207 6 965 2475 60705586 60704077 0.000000e+00 1604.0
7 TraesCS7B01G006300 chr7D 81.905 1354 231 11 1108 2454 62280163 62281509 0.000000e+00 1131.0
8 TraesCS7B01G006300 chr7D 81.091 1063 193 8 1393 2451 62107383 62106325 0.000000e+00 843.0
9 TraesCS7B01G006300 chr7D 82.273 440 68 7 3031 3464 488806760 488807195 4.220000e-99 372.0
10 TraesCS7B01G006300 chr7D 81.538 130 22 2 2994 3122 538913424 538913296 4.730000e-19 106.0
11 TraesCS7B01G006300 chr7D 92.727 55 4 0 2464 2518 60704060 60704006 2.870000e-11 80.5
12 TraesCS7B01G006300 chr7A 85.411 1556 219 8 967 2518 65154844 65153293 0.000000e+00 1609.0
13 TraesCS7B01G006300 chr7A 82.353 153 26 1 2970 3122 35389384 35389233 7.800000e-27 132.0
14 TraesCS7B01G006300 chr2A 82.378 1413 234 13 1048 2454 734654268 734652865 0.000000e+00 1216.0
15 TraesCS7B01G006300 chr2D 82.166 1413 237 13 1048 2454 601263976 601262573 0.000000e+00 1199.0
16 TraesCS7B01G006300 chr6D 85.839 459 60 5 3009 3464 144100097 144100553 1.870000e-132 483.0
17 TraesCS7B01G006300 chr6D 82.740 365 55 6 3101 3462 149357484 149357843 5.580000e-83 318.0
18 TraesCS7B01G006300 chr3D 91.850 319 25 1 1 319 50167603 50167286 8.820000e-121 444.0
19 TraesCS7B01G006300 chr3D 91.536 319 26 1 1 319 50161797 50161480 4.100000e-119 438.0
20 TraesCS7B01G006300 chr3D 80.439 501 89 8 2970 3464 517117322 517116825 1.170000e-99 374.0
21 TraesCS7B01G006300 chr3B 91.401 314 26 1 6 319 343080956 343081268 2.470000e-116 429.0
22 TraesCS7B01G006300 chr3B 90.596 319 29 1 1 319 623040963 623040646 4.130000e-114 422.0
23 TraesCS7B01G006300 chr3B 90.062 322 28 3 1 319 692211724 692212044 6.920000e-112 414.0
24 TraesCS7B01G006300 chr5D 90.938 320 26 3 1 319 518490597 518490914 8.880000e-116 427.0
25 TraesCS7B01G006300 chr5D 81.781 494 86 4 2968 3459 230030527 230031018 8.950000e-111 411.0
26 TraesCS7B01G006300 chr2B 83.736 455 67 6 3012 3463 45783343 45782893 1.150000e-114 424.0
27 TraesCS7B01G006300 chr2B 100.000 30 0 0 2604 2633 420448157 420448186 4.830000e-04 56.5
28 TraesCS7B01G006300 chr6B 90.343 321 28 2 1 319 497187014 497187333 5.350000e-113 418.0
29 TraesCS7B01G006300 chr5B 90.536 317 27 3 4 319 225171664 225171350 1.920000e-112 416.0
30 TraesCS7B01G006300 chr5B 78.782 476 92 9 2994 3464 636352452 636352923 9.340000e-81 311.0
31 TraesCS7B01G006300 chr4A 80.200 500 92 5 2970 3464 593825348 593824851 5.460000e-98 368.0
32 TraesCS7B01G006300 chr4A 97.059 34 1 0 2604 2637 707313475 707313442 1.340000e-04 58.4
33 TraesCS7B01G006300 chr6A 80.217 460 84 7 3009 3464 203402010 203401554 4.280000e-89 339.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G006300 chr7B 3539114 3542577 3463 False 6397.00 6397 100.0000 1 3464 1 chr7B.!!$F2 3463
1 TraesCS7B01G006300 chr7B 3506669 3507735 1066 True 990.00 990 83.4730 1452 2524 1 chr7B.!!$R1 1072
2 TraesCS7B01G006300 chr7B 3340977 3342559 1582 True 978.45 1869 91.8545 965 2518 2 chr7B.!!$R2 1553
3 TraesCS7B01G006300 chr7D 61227381 61228932 1551 True 1615.00 1615 85.4850 967 2518 1 chr7D.!!$R1 1551
4 TraesCS7B01G006300 chr7D 62280163 62281509 1346 False 1131.00 1131 81.9050 1108 2454 1 chr7D.!!$F1 1346
5 TraesCS7B01G006300 chr7D 62106325 62107383 1058 True 843.00 843 81.0910 1393 2451 1 chr7D.!!$R2 1058
6 TraesCS7B01G006300 chr7D 60704006 60705586 1580 True 842.25 1604 89.2960 965 2518 2 chr7D.!!$R4 1553
7 TraesCS7B01G006300 chr7A 65153293 65154844 1551 True 1609.00 1609 85.4110 967 2518 1 chr7A.!!$R2 1551
8 TraesCS7B01G006300 chr2A 734652865 734654268 1403 True 1216.00 1216 82.3780 1048 2454 1 chr2A.!!$R1 1406
9 TraesCS7B01G006300 chr2D 601262573 601263976 1403 True 1199.00 1199 82.1660 1048 2454 1 chr2D.!!$R1 1406


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
525 526 0.032515 TTAGATGGTCGGCTCCCTGA 60.033 55.0 0.00 0.00 0.00 3.86 F
799 800 0.036448 CCAGCTAGATGCCCCATCAG 59.964 60.0 1.39 4.73 42.72 2.90 F
1241 1243 0.041535 TACCTTGCCCTCCGTCCTAA 59.958 55.0 0.00 0.00 0.00 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2015 2017 0.838987 TAGGACAAGAGGCCCGGTTT 60.839 55.0 0.00 0.0 0.00 3.27 R
2430 2432 0.902531 AGATGTCCACTGGGTAACGG 59.097 55.0 0.00 0.0 34.93 4.44 R
3026 3085 0.104304 GATACAGGACCGCGTTGGAT 59.896 55.0 4.92 0.0 42.00 3.41 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
18 19 3.106738 CATCATGGAGGTGCCTTCC 57.893 57.895 0.00 0.00 37.63 3.46
19 20 0.816825 CATCATGGAGGTGCCTTCCG 60.817 60.000 0.00 0.00 37.63 4.30
20 21 0.982852 ATCATGGAGGTGCCTTCCGA 60.983 55.000 0.00 0.00 37.63 4.55
21 22 1.153289 CATGGAGGTGCCTTCCGAG 60.153 63.158 0.00 0.00 37.63 4.63
22 23 3.036429 ATGGAGGTGCCTTCCGAGC 62.036 63.158 0.00 0.00 37.63 5.03
23 24 4.475135 GGAGGTGCCTTCCGAGCC 62.475 72.222 0.00 0.00 0.00 4.70
24 25 3.394836 GAGGTGCCTTCCGAGCCT 61.395 66.667 0.00 0.00 0.00 4.58
25 26 2.930562 AGGTGCCTTCCGAGCCTT 60.931 61.111 0.00 0.00 0.00 4.35
26 27 2.747855 GGTGCCTTCCGAGCCTTG 60.748 66.667 0.00 0.00 0.00 3.61
27 28 2.747855 GTGCCTTCCGAGCCTTGG 60.748 66.667 0.00 0.00 0.00 3.61
28 29 3.249189 TGCCTTCCGAGCCTTGGT 61.249 61.111 0.00 0.00 0.00 3.67
29 30 2.034221 GCCTTCCGAGCCTTGGTT 59.966 61.111 0.00 0.00 0.00 3.67
30 31 2.041115 GCCTTCCGAGCCTTGGTTC 61.041 63.158 0.00 0.00 0.00 3.62
31 32 1.377333 CCTTCCGAGCCTTGGTTCC 60.377 63.158 0.00 0.00 0.00 3.62
32 33 1.374947 CTTCCGAGCCTTGGTTCCA 59.625 57.895 0.00 0.00 0.00 3.53
33 34 0.250727 CTTCCGAGCCTTGGTTCCAA 60.251 55.000 0.00 4.17 0.00 3.53
34 35 0.404040 TTCCGAGCCTTGGTTCCAAT 59.596 50.000 4.67 0.00 0.00 3.16
35 36 0.322456 TCCGAGCCTTGGTTCCAATG 60.322 55.000 4.67 3.84 0.00 2.82
36 37 0.609131 CCGAGCCTTGGTTCCAATGT 60.609 55.000 4.67 0.00 0.00 2.71
37 38 0.523072 CGAGCCTTGGTTCCAATGTG 59.477 55.000 4.67 0.00 0.00 3.21
38 39 0.890683 GAGCCTTGGTTCCAATGTGG 59.109 55.000 4.67 4.62 39.43 4.17
39 40 0.188342 AGCCTTGGTTCCAATGTGGT 59.812 50.000 4.67 0.77 39.03 4.16
40 41 1.047801 GCCTTGGTTCCAATGTGGTT 58.952 50.000 4.67 0.00 39.03 3.67
41 42 1.270252 GCCTTGGTTCCAATGTGGTTG 60.270 52.381 4.67 0.00 39.03 3.77
42 43 2.038659 CCTTGGTTCCAATGTGGTTGT 58.961 47.619 4.67 0.00 39.03 3.32
43 44 2.035832 CCTTGGTTCCAATGTGGTTGTC 59.964 50.000 4.67 0.00 39.03 3.18
44 45 1.313772 TGGTTCCAATGTGGTTGTCG 58.686 50.000 0.00 0.00 39.03 4.35
45 46 0.596082 GGTTCCAATGTGGTTGTCGG 59.404 55.000 0.00 0.00 39.03 4.79
46 47 1.600023 GTTCCAATGTGGTTGTCGGA 58.400 50.000 0.00 0.00 39.03 4.55
47 48 1.950909 GTTCCAATGTGGTTGTCGGAA 59.049 47.619 0.00 0.00 39.03 4.30
48 49 2.350057 TCCAATGTGGTTGTCGGAAA 57.650 45.000 0.00 0.00 39.03 3.13
49 50 1.950909 TCCAATGTGGTTGTCGGAAAC 59.049 47.619 0.00 0.00 39.03 2.78
55 56 3.105187 GGTTGTCGGAAACCTTGGT 57.895 52.632 11.56 0.00 45.25 3.67
56 57 0.949397 GGTTGTCGGAAACCTTGGTC 59.051 55.000 11.56 0.00 45.25 4.02
57 58 1.476291 GGTTGTCGGAAACCTTGGTCT 60.476 52.381 11.56 0.00 45.25 3.85
58 59 1.871676 GTTGTCGGAAACCTTGGTCTC 59.128 52.381 0.00 0.00 0.00 3.36
59 60 0.032952 TGTCGGAAACCTTGGTCTCG 59.967 55.000 0.00 0.00 0.00 4.04
60 61 0.316204 GTCGGAAACCTTGGTCTCGA 59.684 55.000 0.00 0.88 0.00 4.04
61 62 0.601558 TCGGAAACCTTGGTCTCGAG 59.398 55.000 5.93 5.93 0.00 4.04
63 64 0.036294 GGAAACCTTGGTCTCGAGGG 60.036 60.000 13.56 7.89 46.72 4.30
64 65 0.685660 GAAACCTTGGTCTCGAGGGT 59.314 55.000 13.56 8.60 46.43 4.34
65 66 0.396811 AAACCTTGGTCTCGAGGGTG 59.603 55.000 13.56 0.00 43.69 4.61
66 67 1.481056 AACCTTGGTCTCGAGGGTGG 61.481 60.000 13.56 10.42 46.72 4.61
67 68 2.266055 CTTGGTCTCGAGGGTGGC 59.734 66.667 13.56 0.00 0.00 5.01
68 69 3.649277 CTTGGTCTCGAGGGTGGCG 62.649 68.421 13.56 0.00 0.00 5.69
110 111 3.373565 GCCCCGGCAAGGTTCTTG 61.374 66.667 0.00 3.50 41.49 3.02
111 112 3.373565 CCCCGGCAAGGTTCTTGC 61.374 66.667 20.54 20.54 44.22 4.01
116 117 3.373565 GCAAGGTTCTTGCCGGGG 61.374 66.667 18.66 0.00 39.38 5.73
117 118 3.373565 CAAGGTTCTTGCCGGGGC 61.374 66.667 2.18 1.86 42.35 5.80
118 119 4.678743 AAGGTTCTTGCCGGGGCC 62.679 66.667 2.18 0.00 41.09 5.80
121 122 4.397832 GTTCTTGCCGGGGCCGTA 62.398 66.667 2.18 0.00 41.09 4.02
122 123 4.090588 TTCTTGCCGGGGCCGTAG 62.091 66.667 2.18 2.47 41.09 3.51
124 125 4.530857 CTTGCCGGGGCCGTAGAG 62.531 72.222 2.18 0.00 41.09 2.43
151 152 2.677875 GCAAGGGTCTTGCCAGGG 60.678 66.667 18.66 0.00 39.38 4.45
152 153 2.036256 CAAGGGTCTTGCCAGGGG 59.964 66.667 0.00 0.00 39.65 4.79
153 154 2.121506 AAGGGTCTTGCCAGGGGA 60.122 61.111 0.00 0.00 39.65 4.81
154 155 1.778383 AAGGGTCTTGCCAGGGGAA 60.778 57.895 0.00 0.00 39.65 3.97
155 156 2.035783 GGGTCTTGCCAGGGGAAC 59.964 66.667 0.00 0.00 39.65 3.62
168 169 4.097361 GGAACCCACCTCGCCCTC 62.097 72.222 0.00 0.00 0.00 4.30
169 170 3.003763 GAACCCACCTCGCCCTCT 61.004 66.667 0.00 0.00 0.00 3.69
170 171 2.529389 AACCCACCTCGCCCTCTT 60.529 61.111 0.00 0.00 0.00 2.85
171 172 2.804828 GAACCCACCTCGCCCTCTTG 62.805 65.000 0.00 0.00 0.00 3.02
172 173 4.785453 CCCACCTCGCCCTCTTGC 62.785 72.222 0.00 0.00 0.00 4.01
173 174 3.710722 CCACCTCGCCCTCTTGCT 61.711 66.667 0.00 0.00 0.00 3.91
174 175 2.125350 CACCTCGCCCTCTTGCTC 60.125 66.667 0.00 0.00 0.00 4.26
175 176 2.284258 ACCTCGCCCTCTTGCTCT 60.284 61.111 0.00 0.00 0.00 4.09
176 177 1.915769 ACCTCGCCCTCTTGCTCTT 60.916 57.895 0.00 0.00 0.00 2.85
177 178 1.153469 CCTCGCCCTCTTGCTCTTC 60.153 63.158 0.00 0.00 0.00 2.87
178 179 1.518133 CTCGCCCTCTTGCTCTTCG 60.518 63.158 0.00 0.00 0.00 3.79
179 180 2.219325 CTCGCCCTCTTGCTCTTCGT 62.219 60.000 0.00 0.00 0.00 3.85
180 181 2.097038 CGCCCTCTTGCTCTTCGTG 61.097 63.158 0.00 0.00 0.00 4.35
181 182 1.004440 GCCCTCTTGCTCTTCGTGT 60.004 57.895 0.00 0.00 0.00 4.49
182 183 1.016653 GCCCTCTTGCTCTTCGTGTC 61.017 60.000 0.00 0.00 0.00 3.67
183 184 0.605589 CCCTCTTGCTCTTCGTGTCT 59.394 55.000 0.00 0.00 0.00 3.41
184 185 1.403514 CCCTCTTGCTCTTCGTGTCTC 60.404 57.143 0.00 0.00 0.00 3.36
185 186 1.543802 CCTCTTGCTCTTCGTGTCTCT 59.456 52.381 0.00 0.00 0.00 3.10
186 187 2.594321 CTCTTGCTCTTCGTGTCTCTG 58.406 52.381 0.00 0.00 0.00 3.35
187 188 1.957177 TCTTGCTCTTCGTGTCTCTGT 59.043 47.619 0.00 0.00 0.00 3.41
188 189 2.030717 TCTTGCTCTTCGTGTCTCTGTC 60.031 50.000 0.00 0.00 0.00 3.51
189 190 1.610363 TGCTCTTCGTGTCTCTGTCT 58.390 50.000 0.00 0.00 0.00 3.41
190 191 1.957177 TGCTCTTCGTGTCTCTGTCTT 59.043 47.619 0.00 0.00 0.00 3.01
191 192 2.287849 TGCTCTTCGTGTCTCTGTCTTG 60.288 50.000 0.00 0.00 0.00 3.02
192 193 2.924454 GCTCTTCGTGTCTCTGTCTTGG 60.924 54.545 0.00 0.00 0.00 3.61
193 194 1.000163 TCTTCGTGTCTCTGTCTTGGC 60.000 52.381 0.00 0.00 0.00 4.52
194 195 0.318699 TTCGTGTCTCTGTCTTGGCG 60.319 55.000 0.00 0.00 0.00 5.69
195 196 1.007271 CGTGTCTCTGTCTTGGCGT 60.007 57.895 0.00 0.00 0.00 5.68
196 197 0.597637 CGTGTCTCTGTCTTGGCGTT 60.598 55.000 0.00 0.00 0.00 4.84
197 198 0.861837 GTGTCTCTGTCTTGGCGTTG 59.138 55.000 0.00 0.00 0.00 4.10
198 199 0.880278 TGTCTCTGTCTTGGCGTTGC 60.880 55.000 0.00 0.00 0.00 4.17
199 200 0.601311 GTCTCTGTCTTGGCGTTGCT 60.601 55.000 0.00 0.00 0.00 3.91
200 201 0.106708 TCTCTGTCTTGGCGTTGCTT 59.893 50.000 0.00 0.00 0.00 3.91
201 202 0.947244 CTCTGTCTTGGCGTTGCTTT 59.053 50.000 0.00 0.00 0.00 3.51
202 203 0.662619 TCTGTCTTGGCGTTGCTTTG 59.337 50.000 0.00 0.00 0.00 2.77
203 204 0.662619 CTGTCTTGGCGTTGCTTTGA 59.337 50.000 0.00 0.00 0.00 2.69
204 205 0.380378 TGTCTTGGCGTTGCTTTGAC 59.620 50.000 0.00 0.00 0.00 3.18
205 206 0.317854 GTCTTGGCGTTGCTTTGACC 60.318 55.000 0.00 0.00 0.00 4.02
206 207 1.370414 CTTGGCGTTGCTTTGACCG 60.370 57.895 0.00 0.00 0.00 4.79
207 208 3.477224 TTGGCGTTGCTTTGACCGC 62.477 57.895 0.00 0.00 45.05 5.68
209 210 3.660111 GCGTTGCTTTGACCGCCT 61.660 61.111 0.00 0.00 40.25 5.52
210 211 3.030652 CGTTGCTTTGACCGCCTT 58.969 55.556 0.00 0.00 0.00 4.35
211 212 1.370414 CGTTGCTTTGACCGCCTTG 60.370 57.895 0.00 0.00 0.00 3.61
212 213 1.733526 GTTGCTTTGACCGCCTTGT 59.266 52.632 0.00 0.00 0.00 3.16
213 214 0.594796 GTTGCTTTGACCGCCTTGTG 60.595 55.000 0.00 0.00 0.00 3.33
214 215 1.733402 TTGCTTTGACCGCCTTGTGG 61.733 55.000 0.00 0.00 39.41 4.17
225 226 2.482326 CCTTGTGGCTTCGATTCCC 58.518 57.895 0.00 0.00 0.00 3.97
226 227 0.035056 CCTTGTGGCTTCGATTCCCT 60.035 55.000 0.00 0.00 0.00 4.20
227 228 1.089920 CTTGTGGCTTCGATTCCCTG 58.910 55.000 0.00 0.00 0.00 4.45
228 229 0.960364 TTGTGGCTTCGATTCCCTGC 60.960 55.000 0.00 0.00 0.00 4.85
229 230 2.115291 GTGGCTTCGATTCCCTGCC 61.115 63.158 0.00 0.00 43.49 4.85
230 231 2.517166 GGCTTCGATTCCCTGCCC 60.517 66.667 0.00 0.00 37.81 5.36
231 232 2.517166 GCTTCGATTCCCTGCCCC 60.517 66.667 0.00 0.00 0.00 5.80
232 233 3.049080 GCTTCGATTCCCTGCCCCT 62.049 63.158 0.00 0.00 0.00 4.79
233 234 1.153086 CTTCGATTCCCTGCCCCTG 60.153 63.158 0.00 0.00 0.00 4.45
234 235 3.344137 TTCGATTCCCTGCCCCTGC 62.344 63.158 0.00 0.00 38.26 4.85
235 236 4.883354 CGATTCCCTGCCCCTGCC 62.883 72.222 0.00 0.00 36.33 4.85
236 237 4.529731 GATTCCCTGCCCCTGCCC 62.530 72.222 0.00 0.00 36.33 5.36
242 243 3.731728 CTGCCCCTGCCCTGCTAA 61.732 66.667 0.00 0.00 36.33 3.09
243 244 3.711059 CTGCCCCTGCCCTGCTAAG 62.711 68.421 0.00 0.00 36.33 2.18
245 246 4.864334 CCCCTGCCCTGCTAAGCG 62.864 72.222 0.00 0.00 0.00 4.68
246 247 4.101448 CCCTGCCCTGCTAAGCGT 62.101 66.667 0.00 0.00 0.00 5.07
247 248 2.821366 CCTGCCCTGCTAAGCGTG 60.821 66.667 0.00 0.00 0.00 5.34
248 249 2.821366 CTGCCCTGCTAAGCGTGG 60.821 66.667 0.00 0.00 0.00 4.94
252 253 4.760047 CCTGCTAAGCGTGGCCGT 62.760 66.667 5.41 0.00 36.15 5.68
253 254 3.490759 CTGCTAAGCGTGGCCGTG 61.491 66.667 5.41 0.00 36.15 4.94
278 279 2.740055 CTCTGACTGCCCGTGCAC 60.740 66.667 6.82 6.82 44.23 4.57
279 280 3.519973 CTCTGACTGCCCGTGCACA 62.520 63.158 18.64 0.00 44.23 4.57
280 281 2.591429 CTGACTGCCCGTGCACAA 60.591 61.111 18.64 0.00 44.23 3.33
281 282 2.591429 TGACTGCCCGTGCACAAG 60.591 61.111 18.64 8.27 44.23 3.16
282 283 2.591715 GACTGCCCGTGCACAAGT 60.592 61.111 18.64 13.82 44.23 3.16
283 284 1.301401 GACTGCCCGTGCACAAGTA 60.301 57.895 18.64 5.67 44.23 2.24
284 285 0.882927 GACTGCCCGTGCACAAGTAA 60.883 55.000 18.64 0.00 44.23 2.24
285 286 0.884704 ACTGCCCGTGCACAAGTAAG 60.885 55.000 18.64 9.58 44.23 2.34
286 287 1.577328 CTGCCCGTGCACAAGTAAGG 61.577 60.000 18.64 8.46 44.23 2.69
287 288 3.981308 CCCGTGCACAAGTAAGGG 58.019 61.111 18.64 14.08 42.04 3.95
288 289 1.674322 CCCGTGCACAAGTAAGGGG 60.674 63.158 18.64 13.32 43.56 4.79
289 290 1.072505 CCGTGCACAAGTAAGGGGT 59.927 57.895 18.64 0.00 0.00 4.95
290 291 0.322322 CCGTGCACAAGTAAGGGGTA 59.678 55.000 18.64 0.00 0.00 3.69
291 292 1.435577 CGTGCACAAGTAAGGGGTAC 58.564 55.000 18.64 0.00 0.00 3.34
292 293 1.270412 CGTGCACAAGTAAGGGGTACA 60.270 52.381 18.64 0.00 34.88 2.90
293 294 2.807472 CGTGCACAAGTAAGGGGTACAA 60.807 50.000 18.64 0.00 34.88 2.41
294 295 3.215975 GTGCACAAGTAAGGGGTACAAA 58.784 45.455 13.17 0.00 34.88 2.83
295 296 3.252458 GTGCACAAGTAAGGGGTACAAAG 59.748 47.826 13.17 0.00 34.88 2.77
296 297 2.817844 GCACAAGTAAGGGGTACAAAGG 59.182 50.000 0.00 0.00 34.88 3.11
297 298 3.497227 GCACAAGTAAGGGGTACAAAGGA 60.497 47.826 0.00 0.00 34.88 3.36
298 299 4.324267 CACAAGTAAGGGGTACAAAGGAG 58.676 47.826 0.00 0.00 34.88 3.69
299 300 3.978672 ACAAGTAAGGGGTACAAAGGAGT 59.021 43.478 0.00 0.00 34.88 3.85
300 301 4.202430 ACAAGTAAGGGGTACAAAGGAGTG 60.202 45.833 0.00 0.00 34.88 3.51
301 302 2.305052 AGTAAGGGGTACAAAGGAGTGC 59.695 50.000 0.00 0.00 34.88 4.40
302 303 0.404426 AAGGGGTACAAAGGAGTGCC 59.596 55.000 0.00 0.00 42.74 5.01
304 305 4.736739 GGTACAAAGGAGTGCCCC 57.263 61.111 0.00 0.00 38.21 5.80
305 306 2.075837 GGTACAAAGGAGTGCCCCT 58.924 57.895 0.00 0.00 38.21 4.79
306 307 0.322546 GGTACAAAGGAGTGCCCCTG 60.323 60.000 0.00 0.00 38.21 4.45
307 308 0.960861 GTACAAAGGAGTGCCCCTGC 60.961 60.000 0.00 0.00 36.49 4.85
308 309 1.133809 TACAAAGGAGTGCCCCTGCT 61.134 55.000 0.00 0.00 44.89 4.24
311 312 4.250699 AGGAGTGCCCCTGCTTTA 57.749 55.556 0.00 0.00 39.04 1.85
312 313 1.994463 AGGAGTGCCCCTGCTTTAG 59.006 57.895 0.00 0.00 39.04 1.85
313 314 0.842467 AGGAGTGCCCCTGCTTTAGT 60.842 55.000 0.00 0.00 39.04 2.24
314 315 0.909623 GGAGTGCCCCTGCTTTAGTA 59.090 55.000 0.00 0.00 38.71 1.82
315 316 1.407025 GGAGTGCCCCTGCTTTAGTAC 60.407 57.143 0.00 0.00 38.71 2.73
316 317 1.278127 GAGTGCCCCTGCTTTAGTACA 59.722 52.381 0.00 0.00 38.71 2.90
317 318 1.003233 AGTGCCCCTGCTTTAGTACAC 59.997 52.381 0.00 0.00 38.71 2.90
318 319 0.326927 TGCCCCTGCTTTAGTACACC 59.673 55.000 0.00 0.00 38.71 4.16
319 320 0.618981 GCCCCTGCTTTAGTACACCT 59.381 55.000 0.00 0.00 33.53 4.00
320 321 1.679032 GCCCCTGCTTTAGTACACCTG 60.679 57.143 0.00 0.00 33.53 4.00
321 322 1.679032 CCCCTGCTTTAGTACACCTGC 60.679 57.143 0.00 0.00 0.00 4.85
322 323 1.003118 CCCTGCTTTAGTACACCTGCA 59.997 52.381 0.00 0.00 0.00 4.41
323 324 2.076863 CCTGCTTTAGTACACCTGCAC 58.923 52.381 0.00 0.00 0.00 4.57
324 325 2.076863 CTGCTTTAGTACACCTGCACC 58.923 52.381 0.00 0.00 0.00 5.01
325 326 1.076332 GCTTTAGTACACCTGCACCG 58.924 55.000 0.00 0.00 0.00 4.94
326 327 1.337447 GCTTTAGTACACCTGCACCGA 60.337 52.381 0.00 0.00 0.00 4.69
327 328 2.334838 CTTTAGTACACCTGCACCGAC 58.665 52.381 0.00 0.00 0.00 4.79
328 329 0.604578 TTAGTACACCTGCACCGACC 59.395 55.000 0.00 0.00 0.00 4.79
329 330 0.540133 TAGTACACCTGCACCGACCA 60.540 55.000 0.00 0.00 0.00 4.02
330 331 1.374252 GTACACCTGCACCGACCAG 60.374 63.158 0.00 0.00 0.00 4.00
335 336 4.063967 CTGCACCGACCAGGCGTA 62.064 66.667 0.00 0.00 46.52 4.42
336 337 3.371097 CTGCACCGACCAGGCGTAT 62.371 63.158 0.00 0.00 46.52 3.06
337 338 2.890474 GCACCGACCAGGCGTATG 60.890 66.667 0.00 0.00 46.52 2.39
338 339 2.889617 CACCGACCAGGCGTATGA 59.110 61.111 0.00 0.00 46.52 2.15
339 340 1.216977 CACCGACCAGGCGTATGAA 59.783 57.895 0.00 0.00 46.52 2.57
340 341 0.806102 CACCGACCAGGCGTATGAAG 60.806 60.000 0.00 0.00 46.52 3.02
341 342 1.255667 ACCGACCAGGCGTATGAAGT 61.256 55.000 0.00 0.00 46.52 3.01
342 343 0.806102 CCGACCAGGCGTATGAAGTG 60.806 60.000 0.00 0.00 0.00 3.16
343 344 0.172578 CGACCAGGCGTATGAAGTGA 59.827 55.000 0.00 0.00 0.00 3.41
344 345 1.641577 GACCAGGCGTATGAAGTGAC 58.358 55.000 0.00 0.00 0.00 3.67
345 346 0.249398 ACCAGGCGTATGAAGTGACC 59.751 55.000 0.00 0.00 0.00 4.02
346 347 0.806102 CCAGGCGTATGAAGTGACCG 60.806 60.000 0.00 0.00 0.00 4.79
347 348 0.108804 CAGGCGTATGAAGTGACCGT 60.109 55.000 0.00 0.00 0.00 4.83
348 349 0.172803 AGGCGTATGAAGTGACCGTC 59.827 55.000 0.00 0.00 0.00 4.79
349 350 0.172803 GGCGTATGAAGTGACCGTCT 59.827 55.000 0.00 0.00 0.00 4.18
350 351 1.269166 GCGTATGAAGTGACCGTCTG 58.731 55.000 0.00 0.00 0.00 3.51
351 352 1.269166 CGTATGAAGTGACCGTCTGC 58.731 55.000 0.00 0.00 0.00 4.26
352 353 1.641577 GTATGAAGTGACCGTCTGCC 58.358 55.000 0.00 0.00 0.00 4.85
353 354 1.067142 GTATGAAGTGACCGTCTGCCA 60.067 52.381 0.00 0.00 0.00 4.92
354 355 0.320771 ATGAAGTGACCGTCTGCCAC 60.321 55.000 0.00 0.00 0.00 5.01
355 356 1.069090 GAAGTGACCGTCTGCCACA 59.931 57.895 0.00 0.00 33.53 4.17
356 357 0.946221 GAAGTGACCGTCTGCCACAG 60.946 60.000 0.00 0.00 33.53 3.66
357 358 1.686325 AAGTGACCGTCTGCCACAGT 61.686 55.000 0.00 0.00 33.53 3.55
358 359 1.664965 GTGACCGTCTGCCACAGTC 60.665 63.158 0.00 0.00 33.49 3.51
359 360 1.832608 TGACCGTCTGCCACAGTCT 60.833 57.895 0.00 0.00 33.97 3.24
360 361 0.538746 TGACCGTCTGCCACAGTCTA 60.539 55.000 0.00 0.00 33.97 2.59
361 362 0.171455 GACCGTCTGCCACAGTCTAG 59.829 60.000 0.00 0.00 30.58 2.43
362 363 0.539901 ACCGTCTGCCACAGTCTAGT 60.540 55.000 0.00 0.00 32.61 2.57
363 364 0.171455 CCGTCTGCCACAGTCTAGTC 59.829 60.000 0.00 0.00 32.61 2.59
364 365 0.171455 CGTCTGCCACAGTCTAGTCC 59.829 60.000 0.00 0.00 32.61 3.85
365 366 1.257743 GTCTGCCACAGTCTAGTCCA 58.742 55.000 0.00 0.00 32.61 4.02
366 367 1.618837 GTCTGCCACAGTCTAGTCCAA 59.381 52.381 0.00 0.00 32.61 3.53
367 368 2.234908 GTCTGCCACAGTCTAGTCCAAT 59.765 50.000 0.00 0.00 32.61 3.16
368 369 2.906389 TCTGCCACAGTCTAGTCCAATT 59.094 45.455 0.00 0.00 32.61 2.32
369 370 3.327757 TCTGCCACAGTCTAGTCCAATTT 59.672 43.478 0.00 0.00 32.61 1.82
370 371 4.074970 CTGCCACAGTCTAGTCCAATTTT 58.925 43.478 0.00 0.00 0.00 1.82
371 372 5.012664 TCTGCCACAGTCTAGTCCAATTTTA 59.987 40.000 0.00 0.00 32.61 1.52
372 373 5.815581 TGCCACAGTCTAGTCCAATTTTAT 58.184 37.500 0.00 0.00 0.00 1.40
373 374 6.953101 TGCCACAGTCTAGTCCAATTTTATA 58.047 36.000 0.00 0.00 0.00 0.98
374 375 7.573710 TGCCACAGTCTAGTCCAATTTTATAT 58.426 34.615 0.00 0.00 0.00 0.86
375 376 8.710239 TGCCACAGTCTAGTCCAATTTTATATA 58.290 33.333 0.00 0.00 0.00 0.86
376 377 9.209175 GCCACAGTCTAGTCCAATTTTATATAG 57.791 37.037 0.00 0.00 0.00 1.31
377 378 9.712305 CCACAGTCTAGTCCAATTTTATATAGG 57.288 37.037 0.00 0.00 0.00 2.57
416 417 6.929587 CGGATGAAATATCGTTCGTTCTAT 57.070 37.500 0.00 0.00 38.52 1.98
417 418 6.742472 CGGATGAAATATCGTTCGTTCTATG 58.258 40.000 0.00 0.00 38.52 2.23
418 419 6.362551 CGGATGAAATATCGTTCGTTCTATGT 59.637 38.462 0.00 0.00 38.52 2.29
419 420 7.536281 CGGATGAAATATCGTTCGTTCTATGTA 59.464 37.037 0.00 0.00 38.52 2.29
420 421 9.188588 GGATGAAATATCGTTCGTTCTATGTAA 57.811 33.333 0.00 0.00 0.00 2.41
430 431 9.356433 TCGTTCGTTCTATGTAAATTATGTTCA 57.644 29.630 0.00 0.00 0.00 3.18
431 432 9.961266 CGTTCGTTCTATGTAAATTATGTTCAA 57.039 29.630 0.00 0.00 0.00 2.69
450 451 7.339207 TGTTCAAACTTAAGTGAATTACGTCG 58.661 34.615 9.34 0.00 36.23 5.12
451 452 7.010367 TGTTCAAACTTAAGTGAATTACGTCGT 59.990 33.333 9.34 2.21 36.23 4.34
452 453 6.869473 TCAAACTTAAGTGAATTACGTCGTG 58.131 36.000 9.34 0.00 0.00 4.35
453 454 6.476380 TCAAACTTAAGTGAATTACGTCGTGT 59.524 34.615 9.34 0.00 0.00 4.49
454 455 6.833342 AACTTAAGTGAATTACGTCGTGTT 57.167 33.333 9.34 2.70 0.00 3.32
455 456 6.833342 ACTTAAGTGAATTACGTCGTGTTT 57.167 33.333 7.48 0.97 0.00 2.83
456 457 7.928908 ACTTAAGTGAATTACGTCGTGTTTA 57.071 32.000 7.48 0.00 0.00 2.01
457 458 7.777425 ACTTAAGTGAATTACGTCGTGTTTAC 58.223 34.615 7.48 9.66 0.00 2.01
458 459 5.580911 AAGTGAATTACGTCGTGTTTACC 57.419 39.130 8.47 0.00 0.00 2.85
459 460 4.874970 AGTGAATTACGTCGTGTTTACCT 58.125 39.130 8.47 0.00 0.00 3.08
460 461 4.682860 AGTGAATTACGTCGTGTTTACCTG 59.317 41.667 8.47 0.00 0.00 4.00
461 462 4.681025 GTGAATTACGTCGTGTTTACCTGA 59.319 41.667 8.47 0.00 0.00 3.86
462 463 5.175491 GTGAATTACGTCGTGTTTACCTGAA 59.825 40.000 8.47 0.00 0.00 3.02
463 464 5.752472 TGAATTACGTCGTGTTTACCTGAAA 59.248 36.000 8.47 0.00 0.00 2.69
464 465 6.424509 TGAATTACGTCGTGTTTACCTGAAAT 59.575 34.615 8.47 0.00 0.00 2.17
465 466 5.827568 TTACGTCGTGTTTACCTGAAATC 57.172 39.130 8.47 0.00 0.00 2.17
466 467 3.986277 ACGTCGTGTTTACCTGAAATCT 58.014 40.909 0.00 0.00 0.00 2.40
467 468 3.739300 ACGTCGTGTTTACCTGAAATCTG 59.261 43.478 0.00 0.00 0.00 2.90
468 469 3.122948 CGTCGTGTTTACCTGAAATCTGG 59.877 47.826 4.93 4.93 40.37 3.86
470 471 4.514066 GTCGTGTTTACCTGAAATCTGGTT 59.486 41.667 15.86 2.92 44.38 3.67
471 472 5.008316 GTCGTGTTTACCTGAAATCTGGTTT 59.992 40.000 15.86 0.00 44.38 3.27
472 473 5.008217 TCGTGTTTACCTGAAATCTGGTTTG 59.992 40.000 15.86 2.92 44.38 2.93
473 474 4.982295 GTGTTTACCTGAAATCTGGTTTGC 59.018 41.667 15.86 8.06 44.38 3.68
474 475 4.892934 TGTTTACCTGAAATCTGGTTTGCT 59.107 37.500 15.86 0.00 44.38 3.91
475 476 6.016610 GTGTTTACCTGAAATCTGGTTTGCTA 60.017 38.462 15.86 0.00 44.38 3.49
476 477 6.547880 TGTTTACCTGAAATCTGGTTTGCTAA 59.452 34.615 15.86 3.11 44.38 3.09
477 478 7.068839 TGTTTACCTGAAATCTGGTTTGCTAAA 59.931 33.333 15.86 8.28 44.38 1.85
478 479 7.589958 TTACCTGAAATCTGGTTTGCTAAAA 57.410 32.000 15.86 1.87 44.38 1.52
479 480 6.670695 ACCTGAAATCTGGTTTGCTAAAAT 57.329 33.333 6.19 0.00 44.38 1.82
480 481 7.066307 ACCTGAAATCTGGTTTGCTAAAATT 57.934 32.000 6.19 0.00 44.38 1.82
481 482 7.508687 ACCTGAAATCTGGTTTGCTAAAATTT 58.491 30.769 6.19 0.00 44.38 1.82
482 483 7.442062 ACCTGAAATCTGGTTTGCTAAAATTTG 59.558 33.333 6.19 0.00 44.38 2.32
483 484 7.442062 CCTGAAATCTGGTTTGCTAAAATTTGT 59.558 33.333 0.00 0.00 0.00 2.83
484 485 9.474920 CTGAAATCTGGTTTGCTAAAATTTGTA 57.525 29.630 0.00 0.00 0.00 2.41
485 486 9.995003 TGAAATCTGGTTTGCTAAAATTTGTAT 57.005 25.926 0.00 0.00 0.00 2.29
487 488 8.776376 AATCTGGTTTGCTAAAATTTGTATGG 57.224 30.769 0.00 0.00 0.00 2.74
488 489 6.696411 TCTGGTTTGCTAAAATTTGTATGGG 58.304 36.000 0.00 0.00 0.00 4.00
489 490 6.495181 TCTGGTTTGCTAAAATTTGTATGGGA 59.505 34.615 0.00 0.00 0.00 4.37
490 491 7.015682 TCTGGTTTGCTAAAATTTGTATGGGAA 59.984 33.333 0.00 0.00 0.00 3.97
491 492 7.684529 TGGTTTGCTAAAATTTGTATGGGAAT 58.315 30.769 0.00 0.00 0.00 3.01
492 493 7.605691 TGGTTTGCTAAAATTTGTATGGGAATG 59.394 33.333 0.00 0.00 0.00 2.67
493 494 7.413988 GGTTTGCTAAAATTTGTATGGGAATGC 60.414 37.037 0.00 0.00 0.00 3.56
494 495 5.347342 TGCTAAAATTTGTATGGGAATGCG 58.653 37.500 0.00 0.00 0.00 4.73
495 496 5.105554 TGCTAAAATTTGTATGGGAATGCGT 60.106 36.000 0.00 0.00 0.00 5.24
496 497 5.231991 GCTAAAATTTGTATGGGAATGCGTG 59.768 40.000 0.00 0.00 0.00 5.34
497 498 4.799564 AAATTTGTATGGGAATGCGTGT 57.200 36.364 0.00 0.00 0.00 4.49
498 499 3.781079 ATTTGTATGGGAATGCGTGTG 57.219 42.857 0.00 0.00 0.00 3.82
499 500 2.481289 TTGTATGGGAATGCGTGTGA 57.519 45.000 0.00 0.00 0.00 3.58
500 501 2.022764 TGTATGGGAATGCGTGTGAG 57.977 50.000 0.00 0.00 0.00 3.51
501 502 0.657840 GTATGGGAATGCGTGTGAGC 59.342 55.000 0.00 0.00 37.71 4.26
514 515 2.893637 GTGTGAGCACGATTAGATGGT 58.106 47.619 0.00 0.00 35.75 3.55
515 516 2.860735 GTGTGAGCACGATTAGATGGTC 59.139 50.000 0.00 0.00 42.41 4.02
516 517 2.120232 GTGAGCACGATTAGATGGTCG 58.880 52.381 0.00 0.00 44.48 4.79
517 518 1.067060 TGAGCACGATTAGATGGTCGG 59.933 52.381 0.00 0.00 44.48 4.79
518 519 0.249489 AGCACGATTAGATGGTCGGC 60.249 55.000 0.00 0.00 41.87 5.54
519 520 0.249489 GCACGATTAGATGGTCGGCT 60.249 55.000 0.00 0.00 41.87 5.52
520 521 1.772182 CACGATTAGATGGTCGGCTC 58.228 55.000 0.00 0.00 41.87 4.70
521 522 0.674534 ACGATTAGATGGTCGGCTCC 59.325 55.000 0.00 0.00 41.87 4.70
522 523 0.038159 CGATTAGATGGTCGGCTCCC 60.038 60.000 0.00 0.00 34.39 4.30
523 524 1.343069 GATTAGATGGTCGGCTCCCT 58.657 55.000 0.00 0.00 0.00 4.20
524 525 1.001406 GATTAGATGGTCGGCTCCCTG 59.999 57.143 0.00 0.00 0.00 4.45
525 526 0.032515 TTAGATGGTCGGCTCCCTGA 60.033 55.000 0.00 0.00 0.00 3.86
526 527 0.188587 TAGATGGTCGGCTCCCTGAT 59.811 55.000 0.00 0.00 0.00 2.90
527 528 0.188587 AGATGGTCGGCTCCCTGATA 59.811 55.000 0.00 0.00 0.00 2.15
528 529 1.048601 GATGGTCGGCTCCCTGATAA 58.951 55.000 0.00 0.00 0.00 1.75
529 530 1.416401 GATGGTCGGCTCCCTGATAAA 59.584 52.381 0.00 0.00 0.00 1.40
530 531 1.507140 TGGTCGGCTCCCTGATAAAT 58.493 50.000 0.00 0.00 0.00 1.40
531 532 1.843851 TGGTCGGCTCCCTGATAAATT 59.156 47.619 0.00 0.00 0.00 1.82
532 533 2.222027 GGTCGGCTCCCTGATAAATTG 58.778 52.381 0.00 0.00 0.00 2.32
533 534 2.421529 GGTCGGCTCCCTGATAAATTGT 60.422 50.000 0.00 0.00 0.00 2.71
534 535 2.872858 GTCGGCTCCCTGATAAATTGTC 59.127 50.000 0.00 0.00 0.00 3.18
535 536 2.158813 TCGGCTCCCTGATAAATTGTCC 60.159 50.000 0.00 0.00 0.00 4.02
536 537 2.222027 GGCTCCCTGATAAATTGTCCG 58.778 52.381 0.00 0.00 0.00 4.79
537 538 2.222027 GCTCCCTGATAAATTGTCCGG 58.778 52.381 0.00 0.00 0.00 5.14
538 539 2.158813 GCTCCCTGATAAATTGTCCGGA 60.159 50.000 0.00 0.00 0.00 5.14
539 540 3.467803 CTCCCTGATAAATTGTCCGGAC 58.532 50.000 28.17 28.17 0.00 4.79
540 541 2.159014 TCCCTGATAAATTGTCCGGACG 60.159 50.000 28.70 11.38 0.00 4.79
541 542 1.597663 CCTGATAAATTGTCCGGACGC 59.402 52.381 28.70 7.68 0.00 5.19
542 543 1.257936 CTGATAAATTGTCCGGACGCG 59.742 52.381 28.70 3.53 0.00 6.01
543 544 1.283736 GATAAATTGTCCGGACGCGT 58.716 50.000 28.70 13.85 0.00 6.01
544 545 1.662122 GATAAATTGTCCGGACGCGTT 59.338 47.619 28.70 22.25 0.00 4.84
545 546 1.070038 TAAATTGTCCGGACGCGTTC 58.930 50.000 28.70 11.52 0.00 3.95
546 547 1.893168 AAATTGTCCGGACGCGTTCG 61.893 55.000 32.43 32.43 42.43 3.95
557 558 4.637970 GCGTTCGCGGACAAATAC 57.362 55.556 19.39 0.00 41.67 1.89
558 559 1.782807 GCGTTCGCGGACAAATACA 59.217 52.632 19.39 0.00 41.67 2.29
559 560 0.372334 GCGTTCGCGGACAAATACAT 59.628 50.000 19.39 0.00 41.67 2.29
560 561 1.201987 GCGTTCGCGGACAAATACATT 60.202 47.619 19.39 0.00 41.67 2.71
561 562 2.427169 CGTTCGCGGACAAATACATTG 58.573 47.619 19.39 0.00 39.90 2.82
575 576 6.683715 CAAATACATTGTCCGTTTTAAGGGT 58.316 36.000 0.00 0.00 35.51 4.34
576 577 6.505044 AATACATTGTCCGTTTTAAGGGTC 57.495 37.500 0.00 0.00 35.51 4.46
577 578 3.822940 ACATTGTCCGTTTTAAGGGTCA 58.177 40.909 1.56 0.00 35.51 4.02
578 579 4.208746 ACATTGTCCGTTTTAAGGGTCAA 58.791 39.130 13.40 13.40 42.74 3.18
579 580 4.830600 ACATTGTCCGTTTTAAGGGTCAAT 59.169 37.500 15.81 15.81 46.11 2.57
580 581 4.839668 TTGTCCGTTTTAAGGGTCAATG 57.160 40.909 8.93 0.00 37.17 2.82
581 582 3.822940 TGTCCGTTTTAAGGGTCAATGT 58.177 40.909 1.56 0.00 35.51 2.71
582 583 4.208746 TGTCCGTTTTAAGGGTCAATGTT 58.791 39.130 1.56 0.00 35.51 2.71
583 584 4.036971 TGTCCGTTTTAAGGGTCAATGTTG 59.963 41.667 1.56 0.00 35.51 3.33
584 585 3.570550 TCCGTTTTAAGGGTCAATGTTGG 59.429 43.478 1.56 0.00 35.51 3.77
585 586 3.570550 CCGTTTTAAGGGTCAATGTTGGA 59.429 43.478 0.00 0.00 0.00 3.53
586 587 4.038162 CCGTTTTAAGGGTCAATGTTGGAA 59.962 41.667 0.00 0.00 0.00 3.53
587 588 5.452077 CCGTTTTAAGGGTCAATGTTGGAAA 60.452 40.000 0.00 0.00 0.00 3.13
588 589 6.220201 CGTTTTAAGGGTCAATGTTGGAAAT 58.780 36.000 0.00 0.00 0.00 2.17
589 590 6.145371 CGTTTTAAGGGTCAATGTTGGAAATG 59.855 38.462 0.00 0.00 0.00 2.32
590 591 3.683365 AAGGGTCAATGTTGGAAATGC 57.317 42.857 0.00 0.00 0.00 3.56
591 592 2.893424 AGGGTCAATGTTGGAAATGCT 58.107 42.857 0.00 0.00 0.00 3.79
592 593 2.827921 AGGGTCAATGTTGGAAATGCTC 59.172 45.455 0.00 0.00 0.00 4.26
593 594 2.827921 GGGTCAATGTTGGAAATGCTCT 59.172 45.455 0.00 0.00 0.00 4.09
594 595 3.259123 GGGTCAATGTTGGAAATGCTCTT 59.741 43.478 0.00 0.00 0.00 2.85
595 596 4.462483 GGGTCAATGTTGGAAATGCTCTTA 59.538 41.667 0.00 0.00 0.00 2.10
596 597 5.127682 GGGTCAATGTTGGAAATGCTCTTAT 59.872 40.000 0.00 0.00 0.00 1.73
597 598 6.038356 GGTCAATGTTGGAAATGCTCTTATG 58.962 40.000 0.00 0.00 0.00 1.90
598 599 6.350445 GGTCAATGTTGGAAATGCTCTTATGT 60.350 38.462 0.00 0.00 0.00 2.29
599 600 6.749118 GTCAATGTTGGAAATGCTCTTATGTC 59.251 38.462 0.00 0.00 0.00 3.06
600 601 5.841957 ATGTTGGAAATGCTCTTATGTCC 57.158 39.130 0.00 0.00 35.38 4.02
601 602 4.661222 TGTTGGAAATGCTCTTATGTCCA 58.339 39.130 0.00 0.00 41.63 4.02
602 603 4.458989 TGTTGGAAATGCTCTTATGTCCAC 59.541 41.667 0.00 0.00 42.74 4.02
603 604 4.574674 TGGAAATGCTCTTATGTCCACT 57.425 40.909 0.00 0.00 39.11 4.00
604 605 4.922206 TGGAAATGCTCTTATGTCCACTT 58.078 39.130 0.00 0.00 39.11 3.16
605 606 6.061022 TGGAAATGCTCTTATGTCCACTTA 57.939 37.500 0.00 0.00 39.11 2.24
606 607 6.480763 TGGAAATGCTCTTATGTCCACTTAA 58.519 36.000 0.00 0.00 39.11 1.85
607 608 7.118723 TGGAAATGCTCTTATGTCCACTTAAT 58.881 34.615 0.00 0.00 39.11 1.40
608 609 8.271458 TGGAAATGCTCTTATGTCCACTTAATA 58.729 33.333 0.00 0.00 39.11 0.98
609 610 9.120538 GGAAATGCTCTTATGTCCACTTAATAA 57.879 33.333 0.00 0.00 35.00 1.40
614 615 9.679661 TGCTCTTATGTCCACTTAATAATTTGA 57.320 29.630 0.00 0.00 0.00 2.69
620 621 8.786826 ATGTCCACTTAATAATTTGAACGAGA 57.213 30.769 0.00 0.00 0.00 4.04
621 622 8.251750 TGTCCACTTAATAATTTGAACGAGAG 57.748 34.615 0.00 0.00 0.00 3.20
642 643 2.646930 TGCTCCTGCATCTTAATGTGG 58.353 47.619 0.00 0.00 45.31 4.17
643 644 2.239402 TGCTCCTGCATCTTAATGTGGA 59.761 45.455 0.00 0.00 45.31 4.02
644 645 3.282021 GCTCCTGCATCTTAATGTGGAA 58.718 45.455 0.00 0.00 37.27 3.53
645 646 3.696051 GCTCCTGCATCTTAATGTGGAAA 59.304 43.478 0.00 0.00 37.27 3.13
646 647 4.158394 GCTCCTGCATCTTAATGTGGAAAA 59.842 41.667 0.00 0.00 37.27 2.29
647 648 5.643379 TCCTGCATCTTAATGTGGAAAAC 57.357 39.130 0.00 0.00 35.90 2.43
648 649 5.076182 TCCTGCATCTTAATGTGGAAAACA 58.924 37.500 0.00 0.00 44.79 2.83
649 650 5.716228 TCCTGCATCTTAATGTGGAAAACAT 59.284 36.000 0.00 0.00 44.51 2.71
650 651 5.808540 CCTGCATCTTAATGTGGAAAACATG 59.191 40.000 0.00 0.00 44.51 3.21
651 652 5.722263 TGCATCTTAATGTGGAAAACATGG 58.278 37.500 0.00 0.00 44.51 3.66
652 653 5.111293 GCATCTTAATGTGGAAAACATGGG 58.889 41.667 0.00 0.00 44.51 4.00
653 654 5.663456 CATCTTAATGTGGAAAACATGGGG 58.337 41.667 0.00 0.00 44.51 4.96
654 655 4.746466 TCTTAATGTGGAAAACATGGGGT 58.254 39.130 0.00 0.00 44.51 4.95
655 656 5.893500 TCTTAATGTGGAAAACATGGGGTA 58.106 37.500 0.00 0.00 44.51 3.69
656 657 5.712917 TCTTAATGTGGAAAACATGGGGTAC 59.287 40.000 0.00 0.00 44.51 3.34
657 658 3.534357 ATGTGGAAAACATGGGGTACA 57.466 42.857 0.00 0.00 44.51 2.90
658 659 3.534357 TGTGGAAAACATGGGGTACAT 57.466 42.857 0.00 0.00 41.57 2.29
659 660 3.426615 TGTGGAAAACATGGGGTACATC 58.573 45.455 0.00 0.00 37.84 3.06
660 661 3.181428 TGTGGAAAACATGGGGTACATCA 60.181 43.478 0.00 0.00 37.84 3.07
661 662 4.023291 GTGGAAAACATGGGGTACATCAT 58.977 43.478 0.00 0.00 37.84 2.45
662 663 4.466015 GTGGAAAACATGGGGTACATCATT 59.534 41.667 0.00 0.00 37.84 2.57
663 664 5.654650 GTGGAAAACATGGGGTACATCATTA 59.345 40.000 0.00 0.00 37.84 1.90
664 665 5.890985 TGGAAAACATGGGGTACATCATTAG 59.109 40.000 0.00 0.00 37.84 1.73
665 666 5.301805 GGAAAACATGGGGTACATCATTAGG 59.698 44.000 0.00 0.00 37.84 2.69
666 667 3.508845 ACATGGGGTACATCATTAGGC 57.491 47.619 0.00 0.00 37.84 3.93
667 668 2.782925 ACATGGGGTACATCATTAGGCA 59.217 45.455 0.00 0.00 37.84 4.75
668 669 3.181440 ACATGGGGTACATCATTAGGCAG 60.181 47.826 0.00 0.00 37.84 4.85
669 670 1.142870 TGGGGTACATCATTAGGCAGC 59.857 52.381 0.00 0.00 0.00 5.25
670 671 1.142870 GGGGTACATCATTAGGCAGCA 59.857 52.381 0.00 0.00 0.00 4.41
671 672 2.224867 GGGGTACATCATTAGGCAGCAT 60.225 50.000 0.00 0.00 0.00 3.79
672 673 2.816087 GGGTACATCATTAGGCAGCATG 59.184 50.000 0.00 0.00 40.87 4.06
673 674 3.496692 GGGTACATCATTAGGCAGCATGA 60.497 47.826 0.00 0.00 39.69 3.07
674 675 4.136796 GGTACATCATTAGGCAGCATGAA 58.863 43.478 0.00 0.00 39.69 2.57
675 676 4.763793 GGTACATCATTAGGCAGCATGAAT 59.236 41.667 0.00 0.00 39.69 2.57
676 677 5.939883 GGTACATCATTAGGCAGCATGAATA 59.060 40.000 0.00 0.00 39.69 1.75
677 678 6.430925 GGTACATCATTAGGCAGCATGAATAA 59.569 38.462 0.00 0.00 39.69 1.40
678 679 7.121759 GGTACATCATTAGGCAGCATGAATAAT 59.878 37.037 0.00 0.00 39.69 1.28
679 680 9.166173 GTACATCATTAGGCAGCATGAATAATA 57.834 33.333 0.00 0.00 39.69 0.98
680 681 8.818622 ACATCATTAGGCAGCATGAATAATAT 57.181 30.769 0.00 0.00 39.69 1.28
681 682 9.251440 ACATCATTAGGCAGCATGAATAATATT 57.749 29.630 0.00 0.00 39.69 1.28
682 683 9.731819 CATCATTAGGCAGCATGAATAATATTC 57.268 33.333 6.07 6.07 39.69 1.75
683 684 9.696572 ATCATTAGGCAGCATGAATAATATTCT 57.303 29.630 13.45 0.00 39.69 2.40
684 685 8.953313 TCATTAGGCAGCATGAATAATATTCTG 58.047 33.333 13.45 10.11 39.69 3.02
685 686 8.737175 CATTAGGCAGCATGAATAATATTCTGT 58.263 33.333 13.45 1.06 39.69 3.41
686 687 6.570672 AGGCAGCATGAATAATATTCTGTG 57.429 37.500 13.45 12.46 39.69 3.66
687 688 6.301486 AGGCAGCATGAATAATATTCTGTGA 58.699 36.000 13.45 0.00 39.69 3.58
688 689 6.774170 AGGCAGCATGAATAATATTCTGTGAA 59.226 34.615 13.45 0.00 39.69 3.18
689 690 7.286087 AGGCAGCATGAATAATATTCTGTGAAA 59.714 33.333 13.45 0.00 39.69 2.69
690 691 8.086522 GGCAGCATGAATAATATTCTGTGAAAT 58.913 33.333 13.45 0.00 39.69 2.17
704 705 8.682936 ATTCTGTGAAATACAAGTTGAGAAGT 57.317 30.769 10.54 0.00 39.20 3.01
705 706 7.715265 TCTGTGAAATACAAGTTGAGAAGTC 57.285 36.000 10.54 1.09 39.20 3.01
706 707 6.706270 TCTGTGAAATACAAGTTGAGAAGTCC 59.294 38.462 10.54 0.00 39.20 3.85
707 708 5.465390 TGTGAAATACAAGTTGAGAAGTCCG 59.535 40.000 10.54 0.00 36.06 4.79
708 709 4.451096 TGAAATACAAGTTGAGAAGTCCGC 59.549 41.667 10.54 0.00 0.00 5.54
709 710 2.060326 TACAAGTTGAGAAGTCCGCG 57.940 50.000 10.54 0.00 0.00 6.46
710 711 0.104304 ACAAGTTGAGAAGTCCGCGT 59.896 50.000 10.54 0.00 0.00 6.01
711 712 0.508641 CAAGTTGAGAAGTCCGCGTG 59.491 55.000 4.92 0.00 0.00 5.34
712 713 1.222115 AAGTTGAGAAGTCCGCGTGC 61.222 55.000 4.92 0.00 0.00 5.34
713 714 1.954146 GTTGAGAAGTCCGCGTGCA 60.954 57.895 4.92 0.00 0.00 4.57
714 715 1.227409 TTGAGAAGTCCGCGTGCAA 60.227 52.632 4.92 0.00 0.00 4.08
715 716 0.812014 TTGAGAAGTCCGCGTGCAAA 60.812 50.000 4.92 0.00 0.00 3.68
716 717 1.221466 TGAGAAGTCCGCGTGCAAAG 61.221 55.000 4.92 0.00 0.00 2.77
717 718 1.222115 GAGAAGTCCGCGTGCAAAGT 61.222 55.000 4.92 0.00 0.00 2.66
718 719 1.204312 GAAGTCCGCGTGCAAAGTC 59.796 57.895 4.92 0.00 0.00 3.01
719 720 1.495584 GAAGTCCGCGTGCAAAGTCA 61.496 55.000 4.92 0.00 0.00 3.41
720 721 1.772063 AAGTCCGCGTGCAAAGTCAC 61.772 55.000 4.92 0.00 0.00 3.67
721 722 2.202946 TCCGCGTGCAAAGTCACA 60.203 55.556 4.92 0.00 36.80 3.58
722 723 1.596752 TCCGCGTGCAAAGTCACAT 60.597 52.632 4.92 0.00 36.80 3.21
723 724 0.319986 TCCGCGTGCAAAGTCACATA 60.320 50.000 4.92 0.00 36.80 2.29
724 725 0.179225 CCGCGTGCAAAGTCACATAC 60.179 55.000 4.92 0.00 36.80 2.39
725 726 0.516322 CGCGTGCAAAGTCACATACG 60.516 55.000 0.00 0.00 36.80 3.06
726 727 0.511221 GCGTGCAAAGTCACATACGT 59.489 50.000 0.00 0.00 36.80 3.57
727 728 1.722464 GCGTGCAAAGTCACATACGTA 59.278 47.619 0.00 0.00 36.80 3.57
728 729 2.471749 GCGTGCAAAGTCACATACGTAC 60.472 50.000 0.00 0.00 36.80 3.67
729 730 2.727278 CGTGCAAAGTCACATACGTACA 59.273 45.455 0.00 0.00 36.80 2.90
730 731 3.181544 CGTGCAAAGTCACATACGTACAG 60.182 47.826 0.00 0.00 36.80 2.74
731 732 3.122948 GTGCAAAGTCACATACGTACAGG 59.877 47.826 0.00 0.00 36.97 4.00
732 733 2.093783 GCAAAGTCACATACGTACAGGC 59.906 50.000 0.00 0.00 0.00 4.85
733 734 2.273370 AAGTCACATACGTACAGGCG 57.727 50.000 0.00 0.00 37.94 5.52
749 750 3.814049 GCGTACAGCGTACTATCGT 57.186 52.632 14.06 0.00 43.66 3.73
750 751 1.656713 GCGTACAGCGTACTATCGTC 58.343 55.000 14.06 0.00 43.66 4.20
751 752 1.916712 CGTACAGCGTACTATCGTCG 58.083 55.000 14.06 0.00 35.54 5.12
756 757 3.749936 GCGTACTATCGTCGCTCAT 57.250 52.632 0.00 0.00 45.29 2.90
757 758 1.319172 GCGTACTATCGTCGCTCATG 58.681 55.000 0.00 0.00 45.29 3.07
758 759 1.319172 CGTACTATCGTCGCTCATGC 58.681 55.000 0.00 0.00 0.00 4.06
759 760 1.333791 CGTACTATCGTCGCTCATGCA 60.334 52.381 0.00 0.00 39.64 3.96
760 761 2.044860 GTACTATCGTCGCTCATGCAC 58.955 52.381 0.00 0.00 39.64 4.57
761 762 0.741326 ACTATCGTCGCTCATGCACT 59.259 50.000 0.00 0.00 39.64 4.40
762 763 1.947456 ACTATCGTCGCTCATGCACTA 59.053 47.619 0.00 0.00 39.64 2.74
763 764 2.554462 ACTATCGTCGCTCATGCACTAT 59.446 45.455 0.00 0.00 39.64 2.12
764 765 2.515926 ATCGTCGCTCATGCACTATT 57.484 45.000 0.00 0.00 39.64 1.73
765 766 1.559831 TCGTCGCTCATGCACTATTG 58.440 50.000 0.00 0.00 39.64 1.90
781 782 6.139672 CACTATTGCAAAAATCGTTGTTCC 57.860 37.500 1.71 0.00 0.00 3.62
782 783 5.689514 CACTATTGCAAAAATCGTTGTTCCA 59.310 36.000 1.71 0.00 0.00 3.53
783 784 5.920273 ACTATTGCAAAAATCGTTGTTCCAG 59.080 36.000 1.71 0.00 0.00 3.86
784 785 2.468831 TGCAAAAATCGTTGTTCCAGC 58.531 42.857 0.00 0.00 0.00 4.85
785 786 2.100584 TGCAAAAATCGTTGTTCCAGCT 59.899 40.909 0.00 0.00 0.00 4.24
786 787 3.316588 TGCAAAAATCGTTGTTCCAGCTA 59.683 39.130 0.00 0.00 0.00 3.32
787 788 3.914364 GCAAAAATCGTTGTTCCAGCTAG 59.086 43.478 0.00 0.00 0.00 3.42
788 789 4.320202 GCAAAAATCGTTGTTCCAGCTAGA 60.320 41.667 0.00 0.00 0.00 2.43
789 790 5.619981 GCAAAAATCGTTGTTCCAGCTAGAT 60.620 40.000 0.00 0.00 0.00 1.98
790 791 5.551760 AAAATCGTTGTTCCAGCTAGATG 57.448 39.130 0.00 0.00 0.00 2.90
791 792 2.010145 TCGTTGTTCCAGCTAGATGC 57.990 50.000 1.39 0.00 43.29 3.91
792 793 1.009829 CGTTGTTCCAGCTAGATGCC 58.990 55.000 1.39 0.00 44.23 4.40
793 794 1.383523 GTTGTTCCAGCTAGATGCCC 58.616 55.000 1.39 0.00 44.23 5.36
794 795 0.255890 TTGTTCCAGCTAGATGCCCC 59.744 55.000 1.39 0.00 44.23 5.80
795 796 0.913934 TGTTCCAGCTAGATGCCCCA 60.914 55.000 1.39 0.00 44.23 4.96
796 797 0.475906 GTTCCAGCTAGATGCCCCAT 59.524 55.000 1.39 0.00 44.23 4.00
797 798 0.767375 TTCCAGCTAGATGCCCCATC 59.233 55.000 1.39 0.00 44.23 3.51
798 799 0.400381 TCCAGCTAGATGCCCCATCA 60.400 55.000 1.39 0.00 42.72 3.07
799 800 0.036448 CCAGCTAGATGCCCCATCAG 59.964 60.000 1.39 4.73 42.72 2.90
800 801 0.605860 CAGCTAGATGCCCCATCAGC 60.606 60.000 15.45 15.45 42.72 4.26
801 802 0.767446 AGCTAGATGCCCCATCAGCT 60.767 55.000 18.02 18.02 43.36 4.24
802 803 0.110104 GCTAGATGCCCCATCAGCTT 59.890 55.000 15.73 0.00 42.72 3.74
803 804 1.349026 GCTAGATGCCCCATCAGCTTA 59.651 52.381 15.73 0.00 42.72 3.09
804 805 2.873649 GCTAGATGCCCCATCAGCTTAC 60.874 54.545 15.73 0.00 42.72 2.34
805 806 0.107456 AGATGCCCCATCAGCTTACG 59.893 55.000 7.83 0.00 42.72 3.18
806 807 0.106708 GATGCCCCATCAGCTTACGA 59.893 55.000 0.00 0.00 40.28 3.43
807 808 0.179045 ATGCCCCATCAGCTTACGAC 60.179 55.000 0.00 0.00 0.00 4.34
808 809 1.883084 GCCCCATCAGCTTACGACG 60.883 63.158 0.00 0.00 0.00 5.12
809 810 1.515954 CCCCATCAGCTTACGACGT 59.484 57.895 5.52 5.52 0.00 4.34
810 811 0.108329 CCCCATCAGCTTACGACGTT 60.108 55.000 5.50 0.00 0.00 3.99
811 812 1.135527 CCCCATCAGCTTACGACGTTA 59.864 52.381 5.50 0.00 0.00 3.18
812 813 2.190981 CCCATCAGCTTACGACGTTAC 58.809 52.381 5.50 0.00 0.00 2.50
813 814 1.844357 CCATCAGCTTACGACGTTACG 59.156 52.381 5.50 2.19 39.31 3.18
815 816 3.485711 CCATCAGCTTACGACGTTACGTA 60.486 47.826 11.32 5.50 44.72 3.57
816 817 4.277258 CATCAGCTTACGACGTTACGTAT 58.723 43.478 11.32 4.79 45.70 3.06
817 818 4.340894 TCAGCTTACGACGTTACGTATT 57.659 40.909 11.32 2.97 45.70 1.89
818 819 4.722194 TCAGCTTACGACGTTACGTATTT 58.278 39.130 11.32 0.21 45.70 1.40
819 820 4.788100 TCAGCTTACGACGTTACGTATTTC 59.212 41.667 11.32 0.00 45.70 2.17
820 821 4.790140 CAGCTTACGACGTTACGTATTTCT 59.210 41.667 11.32 0.88 45.70 2.52
821 822 5.024555 AGCTTACGACGTTACGTATTTCTC 58.975 41.667 11.32 0.00 45.70 2.87
822 823 4.203160 GCTTACGACGTTACGTATTTCTCC 59.797 45.833 11.32 0.00 45.70 3.71
823 824 3.136808 ACGACGTTACGTATTTCTCCC 57.863 47.619 11.32 0.00 44.72 4.30
824 825 2.487762 ACGACGTTACGTATTTCTCCCA 59.512 45.455 11.32 0.00 44.72 4.37
825 826 3.129287 ACGACGTTACGTATTTCTCCCAT 59.871 43.478 11.32 0.00 44.72 4.00
826 827 4.335315 ACGACGTTACGTATTTCTCCCATA 59.665 41.667 11.32 0.00 44.72 2.74
827 828 5.009010 ACGACGTTACGTATTTCTCCCATAT 59.991 40.000 11.32 0.00 44.72 1.78
828 829 5.341462 CGACGTTACGTATTTCTCCCATATG 59.659 44.000 11.32 0.00 41.37 1.78
829 830 6.152932 ACGTTACGTATTTCTCCCATATGT 57.847 37.500 9.22 0.00 38.73 2.29
830 831 6.576185 ACGTTACGTATTTCTCCCATATGTT 58.424 36.000 9.22 0.00 38.73 2.71
831 832 6.477688 ACGTTACGTATTTCTCCCATATGTTG 59.522 38.462 9.22 0.00 38.73 3.33
832 833 6.477688 CGTTACGTATTTCTCCCATATGTTGT 59.522 38.462 1.24 0.00 30.51 3.32
833 834 7.010738 CGTTACGTATTTCTCCCATATGTTGTT 59.989 37.037 1.24 0.00 30.51 2.83
834 835 8.671028 GTTACGTATTTCTCCCATATGTTGTTT 58.329 33.333 1.24 0.00 30.51 2.83
835 836 7.316544 ACGTATTTCTCCCATATGTTGTTTC 57.683 36.000 1.24 0.00 0.00 2.78
836 837 6.882140 ACGTATTTCTCCCATATGTTGTTTCA 59.118 34.615 1.24 0.00 0.00 2.69
837 838 7.392113 ACGTATTTCTCCCATATGTTGTTTCAA 59.608 33.333 1.24 0.00 0.00 2.69
838 839 8.405531 CGTATTTCTCCCATATGTTGTTTCAAT 58.594 33.333 1.24 0.00 0.00 2.57
842 843 8.830201 TTCTCCCATATGTTGTTTCAATTTTG 57.170 30.769 1.24 0.00 0.00 2.44
843 844 7.961351 TCTCCCATATGTTGTTTCAATTTTGT 58.039 30.769 1.24 0.00 0.00 2.83
844 845 8.087750 TCTCCCATATGTTGTTTCAATTTTGTC 58.912 33.333 1.24 0.00 0.00 3.18
845 846 6.865726 TCCCATATGTTGTTTCAATTTTGTCG 59.134 34.615 1.24 0.00 0.00 4.35
846 847 6.865726 CCCATATGTTGTTTCAATTTTGTCGA 59.134 34.615 1.24 0.00 0.00 4.20
847 848 7.383572 CCCATATGTTGTTTCAATTTTGTCGAA 59.616 33.333 1.24 0.00 0.00 3.71
848 849 8.427012 CCATATGTTGTTTCAATTTTGTCGAAG 58.573 33.333 1.24 0.00 0.00 3.79
849 850 6.826893 ATGTTGTTTCAATTTTGTCGAAGG 57.173 33.333 0.00 0.00 0.00 3.46
850 851 5.955488 TGTTGTTTCAATTTTGTCGAAGGA 58.045 33.333 0.00 0.00 0.00 3.36
851 852 5.802956 TGTTGTTTCAATTTTGTCGAAGGAC 59.197 36.000 0.00 0.00 43.71 3.85
885 886 6.639632 TCAATGAGAAAAGGACAAGAAAGG 57.360 37.500 0.00 0.00 0.00 3.11
886 887 6.364701 TCAATGAGAAAAGGACAAGAAAGGA 58.635 36.000 0.00 0.00 0.00 3.36
887 888 6.488006 TCAATGAGAAAAGGACAAGAAAGGAG 59.512 38.462 0.00 0.00 0.00 3.69
888 889 5.373812 TGAGAAAAGGACAAGAAAGGAGT 57.626 39.130 0.00 0.00 0.00 3.85
889 890 5.755849 TGAGAAAAGGACAAGAAAGGAGTT 58.244 37.500 0.00 0.00 0.00 3.01
890 891 5.590259 TGAGAAAAGGACAAGAAAGGAGTTG 59.410 40.000 0.00 0.00 0.00 3.16
891 892 4.889995 AGAAAAGGACAAGAAAGGAGTTGG 59.110 41.667 0.00 0.00 0.00 3.77
892 893 2.278332 AGGACAAGAAAGGAGTTGGC 57.722 50.000 0.00 0.00 0.00 4.52
893 894 1.248486 GGACAAGAAAGGAGTTGGCC 58.752 55.000 0.00 0.00 44.64 5.36
894 895 1.248486 GACAAGAAAGGAGTTGGCCC 58.752 55.000 0.00 0.00 0.00 5.80
895 896 0.853530 ACAAGAAAGGAGTTGGCCCT 59.146 50.000 0.00 0.00 35.03 5.19
896 897 1.217942 ACAAGAAAGGAGTTGGCCCTT 59.782 47.619 0.00 0.00 45.36 3.95
897 898 1.615392 CAAGAAAGGAGTTGGCCCTTG 59.385 52.381 0.00 0.00 42.82 3.61
898 899 0.540597 AGAAAGGAGTTGGCCCTTGC 60.541 55.000 0.00 0.00 42.82 4.01
899 900 0.827507 GAAAGGAGTTGGCCCTTGCA 60.828 55.000 0.00 0.00 42.82 4.08
900 901 1.115326 AAAGGAGTTGGCCCTTGCAC 61.115 55.000 0.00 0.00 42.82 4.57
901 902 2.203480 GGAGTTGGCCCTTGCACA 60.203 61.111 0.00 0.00 40.13 4.57
902 903 2.270986 GGAGTTGGCCCTTGCACAG 61.271 63.158 0.00 0.00 40.13 3.66
903 904 1.529244 GAGTTGGCCCTTGCACAGT 60.529 57.895 0.00 0.00 40.13 3.55
904 905 1.076044 AGTTGGCCCTTGCACAGTT 60.076 52.632 0.00 0.00 40.13 3.16
905 906 1.067916 GTTGGCCCTTGCACAGTTG 59.932 57.895 0.00 0.00 40.13 3.16
906 907 2.132996 TTGGCCCTTGCACAGTTGG 61.133 57.895 0.00 0.00 40.13 3.77
907 908 3.305516 GGCCCTTGCACAGTTGGG 61.306 66.667 0.00 0.00 42.41 4.12
908 909 2.203480 GCCCTTGCACAGTTGGGA 60.203 61.111 10.84 0.00 42.11 4.37
909 910 2.270986 GCCCTTGCACAGTTGGGAG 61.271 63.158 10.84 0.00 42.11 4.30
910 911 1.604593 CCCTTGCACAGTTGGGAGG 60.605 63.158 0.00 0.00 42.11 4.30
911 912 2.270986 CCTTGCACAGTTGGGAGGC 61.271 63.158 0.00 0.00 0.00 4.70
912 913 2.203480 TTGCACAGTTGGGAGGCC 60.203 61.111 0.00 0.00 0.00 5.19
913 914 2.703675 CTTGCACAGTTGGGAGGCCT 62.704 60.000 3.86 3.86 0.00 5.19
914 915 2.116125 GCACAGTTGGGAGGCCTT 59.884 61.111 6.77 0.00 0.00 4.35
915 916 1.531602 GCACAGTTGGGAGGCCTTT 60.532 57.895 6.77 0.00 0.00 3.11
916 917 1.115326 GCACAGTTGGGAGGCCTTTT 61.115 55.000 6.77 0.00 0.00 2.27
917 918 1.821666 GCACAGTTGGGAGGCCTTTTA 60.822 52.381 6.77 0.00 0.00 1.52
918 919 2.162681 CACAGTTGGGAGGCCTTTTAG 58.837 52.381 6.77 0.00 0.00 1.85
919 920 2.062636 ACAGTTGGGAGGCCTTTTAGA 58.937 47.619 6.77 0.00 0.00 2.10
920 921 2.445525 ACAGTTGGGAGGCCTTTTAGAA 59.554 45.455 6.77 0.00 0.00 2.10
921 922 3.084786 CAGTTGGGAGGCCTTTTAGAAG 58.915 50.000 6.77 0.00 0.00 2.85
922 923 2.716969 AGTTGGGAGGCCTTTTAGAAGT 59.283 45.455 6.77 0.00 0.00 3.01
923 924 3.914435 AGTTGGGAGGCCTTTTAGAAGTA 59.086 43.478 6.77 0.00 0.00 2.24
924 925 3.994931 TGGGAGGCCTTTTAGAAGTAC 57.005 47.619 6.77 0.00 0.00 2.73
925 926 3.253220 TGGGAGGCCTTTTAGAAGTACA 58.747 45.455 6.77 0.00 0.00 2.90
926 927 3.263425 TGGGAGGCCTTTTAGAAGTACAG 59.737 47.826 6.77 0.00 0.00 2.74
927 928 3.271729 GGAGGCCTTTTAGAAGTACAGC 58.728 50.000 6.77 0.00 0.00 4.40
928 929 3.307480 GGAGGCCTTTTAGAAGTACAGCA 60.307 47.826 6.77 0.00 0.00 4.41
929 930 4.518249 GAGGCCTTTTAGAAGTACAGCAT 58.482 43.478 6.77 0.00 0.00 3.79
930 931 4.923415 AGGCCTTTTAGAAGTACAGCATT 58.077 39.130 0.00 0.00 0.00 3.56
931 932 4.944317 AGGCCTTTTAGAAGTACAGCATTC 59.056 41.667 0.00 0.00 0.00 2.67
932 933 4.700213 GGCCTTTTAGAAGTACAGCATTCA 59.300 41.667 0.00 0.00 0.00 2.57
933 934 5.392057 GGCCTTTTAGAAGTACAGCATTCAC 60.392 44.000 0.00 0.00 0.00 3.18
934 935 5.412904 GCCTTTTAGAAGTACAGCATTCACT 59.587 40.000 0.00 0.00 0.00 3.41
935 936 6.072452 GCCTTTTAGAAGTACAGCATTCACTT 60.072 38.462 0.00 0.00 35.27 3.16
936 937 7.301054 CCTTTTAGAAGTACAGCATTCACTTG 58.699 38.462 0.00 0.00 32.79 3.16
937 938 7.041098 CCTTTTAGAAGTACAGCATTCACTTGT 60.041 37.037 0.00 0.00 32.79 3.16
938 939 7.801716 TTTAGAAGTACAGCATTCACTTGTT 57.198 32.000 0.00 0.00 32.79 2.83
939 940 7.801716 TTAGAAGTACAGCATTCACTTGTTT 57.198 32.000 0.00 0.00 32.79 2.83
940 941 8.896320 TTAGAAGTACAGCATTCACTTGTTTA 57.104 30.769 0.00 0.00 32.79 2.01
941 942 7.801716 AGAAGTACAGCATTCACTTGTTTAA 57.198 32.000 0.00 0.00 32.79 1.52
942 943 8.220755 AGAAGTACAGCATTCACTTGTTTAAA 57.779 30.769 0.00 0.00 32.79 1.52
943 944 8.682710 AGAAGTACAGCATTCACTTGTTTAAAA 58.317 29.630 0.00 0.00 32.79 1.52
944 945 9.296400 GAAGTACAGCATTCACTTGTTTAAAAA 57.704 29.630 0.00 0.00 32.79 1.94
945 946 9.816354 AAGTACAGCATTCACTTGTTTAAAAAT 57.184 25.926 0.00 0.00 31.47 1.82
946 947 9.463443 AGTACAGCATTCACTTGTTTAAAAATC 57.537 29.630 0.00 0.00 0.00 2.17
947 948 9.463443 GTACAGCATTCACTTGTTTAAAAATCT 57.537 29.630 0.00 0.00 0.00 2.40
948 949 8.579682 ACAGCATTCACTTGTTTAAAAATCTC 57.420 30.769 0.00 0.00 0.00 2.75
949 950 7.653311 ACAGCATTCACTTGTTTAAAAATCTCC 59.347 33.333 0.00 0.00 0.00 3.71
950 951 7.116805 CAGCATTCACTTGTTTAAAAATCTCCC 59.883 37.037 0.00 0.00 0.00 4.30
951 952 6.928492 GCATTCACTTGTTTAAAAATCTCCCA 59.072 34.615 0.00 0.00 0.00 4.37
952 953 7.116805 GCATTCACTTGTTTAAAAATCTCCCAG 59.883 37.037 0.00 0.00 0.00 4.45
953 954 6.648879 TCACTTGTTTAAAAATCTCCCAGG 57.351 37.500 0.00 0.00 0.00 4.45
954 955 5.010617 TCACTTGTTTAAAAATCTCCCAGGC 59.989 40.000 0.00 0.00 0.00 4.85
955 956 4.283467 ACTTGTTTAAAAATCTCCCAGGCC 59.717 41.667 0.00 0.00 0.00 5.19
956 957 3.850752 TGTTTAAAAATCTCCCAGGCCA 58.149 40.909 5.01 0.00 0.00 5.36
957 958 4.424842 TGTTTAAAAATCTCCCAGGCCAT 58.575 39.130 5.01 0.00 0.00 4.40
958 959 4.843516 TGTTTAAAAATCTCCCAGGCCATT 59.156 37.500 5.01 0.00 0.00 3.16
959 960 5.178061 GTTTAAAAATCTCCCAGGCCATTG 58.822 41.667 5.01 0.00 0.00 2.82
960 961 1.870064 AAAATCTCCCAGGCCATTGG 58.130 50.000 5.01 4.39 38.00 3.16
961 962 0.712380 AAATCTCCCAGGCCATTGGT 59.288 50.000 5.01 0.00 36.45 3.67
962 963 0.259938 AATCTCCCAGGCCATTGGTC 59.740 55.000 5.01 0.00 36.45 4.02
963 964 0.625683 ATCTCCCAGGCCATTGGTCT 60.626 55.000 3.30 3.30 38.72 3.85
969 970 0.107312 CAGGCCATTGGTCTCCTCTG 60.107 60.000 6.90 0.00 34.19 3.35
990 991 2.224549 GCATGCACGTAAACTACACCAA 59.775 45.455 14.21 0.00 0.00 3.67
1007 1009 2.693074 ACCAACCCAACAACATGAGTTC 59.307 45.455 0.00 0.00 35.28 3.01
1008 1010 2.692557 CCAACCCAACAACATGAGTTCA 59.307 45.455 0.00 0.00 35.28 3.18
1009 1011 3.243501 CCAACCCAACAACATGAGTTCAG 60.244 47.826 0.00 0.46 35.28 3.02
1015 1017 3.131709 ACAACATGAGTTCAGGGTCTG 57.868 47.619 0.00 0.00 35.28 3.51
1025 1027 2.235898 GTTCAGGGTCTGATCTCAAGCT 59.764 50.000 0.00 0.00 40.39 3.74
1031 1033 2.159114 GGTCTGATCTCAAGCTCCTCAC 60.159 54.545 0.00 0.00 0.00 3.51
1056 1058 4.257731 TGCTATACAATCGAACTGCCAAA 58.742 39.130 0.00 0.00 0.00 3.28
1067 1069 0.673644 ACTGCCAAAATCCTCGTCCG 60.674 55.000 0.00 0.00 0.00 4.79
1110 1112 3.426568 GCAGCTGGCGTCCTCAAC 61.427 66.667 17.12 0.00 0.00 3.18
1115 1117 1.856265 GCTGGCGTCCTCAACAAAGG 61.856 60.000 0.00 0.00 37.81 3.11
1130 1132 0.760189 AAAGGTGCACCATGGCTTGT 60.760 50.000 36.39 11.61 38.89 3.16
1170 1172 1.959282 CCCCAATCCTCTGCTATTTGC 59.041 52.381 0.00 0.00 43.25 3.68
1218 1220 3.551846 TCTACTGATCATCACGGCTACA 58.448 45.455 0.00 0.00 0.00 2.74
1230 1232 1.134491 ACGGCTACATTCTACCTTGCC 60.134 52.381 0.00 0.00 35.94 4.52
1241 1243 0.041535 TACCTTGCCCTCCGTCCTAA 59.958 55.000 0.00 0.00 0.00 2.69
1251 1253 4.040095 GCCCTCCGTCCTAAAACTGTATAT 59.960 45.833 0.00 0.00 0.00 0.86
1254 1256 6.294620 CCCTCCGTCCTAAAACTGTATATCTC 60.295 46.154 0.00 0.00 0.00 2.75
1255 1257 6.294620 CCTCCGTCCTAAAACTGTATATCTCC 60.295 46.154 0.00 0.00 0.00 3.71
1274 1276 1.608025 CCTTGACTACGCTTGCTTCCA 60.608 52.381 0.00 0.00 0.00 3.53
1281 1283 0.751643 ACGCTTGCTTCCAACCAAGT 60.752 50.000 0.00 0.00 40.34 3.16
1309 1311 4.023193 ACTTAAGAATCACAAAGGCAACCG 60.023 41.667 10.09 0.00 37.17 4.44
1311 1313 0.313672 GAATCACAAAGGCAACCGCA 59.686 50.000 0.00 0.00 41.24 5.69
1321 1323 3.084579 CAACCGCACTCGAGCATC 58.915 61.111 13.61 0.38 38.10 3.91
1322 1324 1.737735 CAACCGCACTCGAGCATCA 60.738 57.895 13.61 0.00 38.10 3.07
1342 1344 0.249911 ACGTCTCTCGCCTTTGCTTT 60.250 50.000 0.00 0.00 44.19 3.51
1343 1345 0.868406 CGTCTCTCGCCTTTGCTTTT 59.132 50.000 0.00 0.00 34.43 2.27
1354 1356 5.703592 TCGCCTTTGCTTTTTGATTCTACTA 59.296 36.000 0.00 0.00 34.43 1.82
1358 1360 9.508567 GCCTTTGCTTTTTGATTCTACTATTAG 57.491 33.333 0.00 0.00 33.53 1.73
1391 1393 0.321919 ATTCTTGAGCGCTCAGGCAA 60.322 50.000 36.73 30.04 41.13 4.52
1811 1813 1.070376 GGTTAACGTCTTGTTCCGCAC 60.070 52.381 0.00 0.00 42.09 5.34
1885 1887 1.209127 GGGCATTTCACACGAACGG 59.791 57.895 0.00 0.00 0.00 4.44
1902 1904 2.642700 GTCACCGCGGCAAACAAT 59.357 55.556 28.58 0.00 0.00 2.71
1904 1906 1.894282 TCACCGCGGCAAACAATGA 60.894 52.632 28.58 17.11 0.00 2.57
1911 1913 2.795681 CGCGGCAAACAATGATGCTTAT 60.796 45.455 13.36 0.00 42.20 1.73
1948 1950 1.988107 AGGAAGATGAGAAGGGCAACA 59.012 47.619 0.00 0.00 39.74 3.33
1954 1956 0.918983 TGAGAAGGGCAACATAGGGG 59.081 55.000 0.00 0.00 39.74 4.79
1987 1989 3.460857 AAGACCTTATGGATGTCGCTC 57.539 47.619 0.81 0.00 37.04 5.03
1989 1991 0.249489 ACCTTATGGATGTCGCTCGC 60.249 55.000 0.81 0.00 37.04 5.03
2015 2017 3.633525 GCACTCAAGGCCAATATCATGAA 59.366 43.478 5.01 0.00 0.00 2.57
2035 2037 0.620700 AACCGGGCCTCTTGTCCTAT 60.621 55.000 6.32 0.00 0.00 2.57
2068 2070 8.184192 CAGAGCTTCTCAAGTTTTTGTTCTTTA 58.816 33.333 0.00 0.00 35.73 1.85
2093 2095 1.228657 GCGAGAAAGGTGCTCCGTTT 61.229 55.000 7.42 4.96 35.69 3.60
2100 2102 2.244946 GGTGCTCCGTTTGAGGAAC 58.755 57.895 0.00 0.00 43.70 3.62
2124 2126 3.199946 TCAGACCATACATCCCCAACTTC 59.800 47.826 0.00 0.00 0.00 3.01
2125 2127 3.054434 CAGACCATACATCCCCAACTTCA 60.054 47.826 0.00 0.00 0.00 3.02
2145 2147 4.695396 TCAGTGTTGCATTTGAGCATTTT 58.305 34.783 0.00 0.00 45.19 1.82
2241 2243 1.202110 CCATCAAAGATGACGCTGCAC 60.202 52.381 8.49 0.00 38.69 4.57
2262 2264 2.413837 CGATTTGGAAACCAGTCGACT 58.586 47.619 13.58 13.58 42.11 4.18
2302 2304 5.869579 AGTTATCATACATCGAGGCCAAAT 58.130 37.500 5.01 0.00 0.00 2.32
2377 2379 1.000270 TGCAACACTGTTGGGTGGT 60.000 52.632 20.94 0.00 41.09 4.16
2386 2388 3.751175 CACTGTTGGGTGGTTGTGTATAG 59.249 47.826 0.00 0.00 33.95 1.31
2405 2407 3.077484 AGAACCATCTTCATGTGTGGG 57.923 47.619 11.19 3.54 36.05 4.61
2430 2432 1.525535 CTGGGCTAGCTGCATCCAC 60.526 63.158 15.72 0.00 45.15 4.02
2475 2477 6.126768 CCAAGAGTGGTTAAATCCAGAGGATA 60.127 42.308 0.00 0.00 39.81 2.59
2476 2478 6.739331 AGAGTGGTTAAATCCAGAGGATAG 57.261 41.667 0.00 0.00 42.27 2.08
2477 2479 6.206042 AGAGTGGTTAAATCCAGAGGATAGT 58.794 40.000 0.00 0.00 42.27 2.12
2478 2480 7.363031 AGAGTGGTTAAATCCAGAGGATAGTA 58.637 38.462 0.00 0.00 42.27 1.82
2518 2577 9.574516 GATAATCCAATAATAGGGACAACACTT 57.425 33.333 0.00 0.00 35.67 3.16
2519 2578 7.645058 AATCCAATAATAGGGACAACACTTG 57.355 36.000 0.00 0.00 35.67 3.16
2524 2583 4.706842 AATAGGGACAACACTTGTGAGT 57.293 40.909 7.83 5.66 45.52 3.41
2525 2584 4.706842 ATAGGGACAACACTTGTGAGTT 57.293 40.909 7.83 0.00 45.52 3.01
2526 2585 3.366052 AGGGACAACACTTGTGAGTTT 57.634 42.857 7.83 0.00 45.52 2.66
2527 2586 3.697166 AGGGACAACACTTGTGAGTTTT 58.303 40.909 7.83 0.00 45.52 2.43
2528 2587 4.086457 AGGGACAACACTTGTGAGTTTTT 58.914 39.130 7.83 0.00 45.52 1.94
2529 2588 4.157840 AGGGACAACACTTGTGAGTTTTTC 59.842 41.667 7.83 0.00 45.52 2.29
2530 2589 4.082463 GGGACAACACTTGTGAGTTTTTCA 60.082 41.667 7.83 0.00 45.52 2.69
2531 2590 5.465935 GGACAACACTTGTGAGTTTTTCAA 58.534 37.500 7.83 0.00 45.52 2.69
2532 2591 5.923684 GGACAACACTTGTGAGTTTTTCAAA 59.076 36.000 7.83 0.00 45.52 2.69
2533 2592 6.422400 GGACAACACTTGTGAGTTTTTCAAAA 59.578 34.615 7.83 0.00 45.52 2.44
2534 2593 7.042389 GGACAACACTTGTGAGTTTTTCAAAAA 60.042 33.333 7.83 0.00 45.52 1.94
2535 2594 7.850501 ACAACACTTGTGAGTTTTTCAAAAAG 58.149 30.769 7.83 0.00 43.48 2.27
2536 2595 7.708752 ACAACACTTGTGAGTTTTTCAAAAAGA 59.291 29.630 7.83 0.00 43.48 2.52
2537 2596 8.547069 CAACACTTGTGAGTTTTTCAAAAAGAA 58.453 29.630 7.83 0.00 37.61 2.52
2538 2597 8.831715 ACACTTGTGAGTTTTTCAAAAAGAAT 57.168 26.923 7.83 0.00 37.61 2.40
2539 2598 9.271828 ACACTTGTGAGTTTTTCAAAAAGAATT 57.728 25.926 7.83 0.00 37.61 2.17
2574 2633 9.800433 TTATTAATGTACAATGTGCTTTCCATG 57.200 29.630 0.00 0.00 0.00 3.66
2575 2634 5.726980 AATGTACAATGTGCTTTCCATGT 57.273 34.783 0.00 0.00 0.00 3.21
2576 2635 4.764679 TGTACAATGTGCTTTCCATGTC 57.235 40.909 2.75 0.00 0.00 3.06
2577 2636 4.140536 TGTACAATGTGCTTTCCATGTCA 58.859 39.130 2.75 0.00 0.00 3.58
2578 2637 4.582240 TGTACAATGTGCTTTCCATGTCAA 59.418 37.500 2.75 0.00 0.00 3.18
2579 2638 4.669206 ACAATGTGCTTTCCATGTCAAA 57.331 36.364 0.00 0.00 0.00 2.69
2580 2639 5.217978 ACAATGTGCTTTCCATGTCAAAT 57.782 34.783 0.00 0.00 0.00 2.32
2581 2640 6.343716 ACAATGTGCTTTCCATGTCAAATA 57.656 33.333 0.00 0.00 0.00 1.40
2582 2641 6.938507 ACAATGTGCTTTCCATGTCAAATAT 58.061 32.000 0.00 0.00 0.00 1.28
2583 2642 8.065473 ACAATGTGCTTTCCATGTCAAATATA 57.935 30.769 0.00 0.00 0.00 0.86
2584 2643 8.192774 ACAATGTGCTTTCCATGTCAAATATAG 58.807 33.333 0.00 0.00 0.00 1.31
2585 2644 7.886629 ATGTGCTTTCCATGTCAAATATAGT 57.113 32.000 0.00 0.00 0.00 2.12
2586 2645 7.087409 TGTGCTTTCCATGTCAAATATAGTG 57.913 36.000 0.00 0.00 0.00 2.74
2587 2646 5.973565 GTGCTTTCCATGTCAAATATAGTGC 59.026 40.000 0.00 0.00 0.00 4.40
2588 2647 5.651576 TGCTTTCCATGTCAAATATAGTGCA 59.348 36.000 0.00 0.00 0.00 4.57
2589 2648 5.973565 GCTTTCCATGTCAAATATAGTGCAC 59.026 40.000 9.40 9.40 0.00 4.57
2590 2649 6.183360 GCTTTCCATGTCAAATATAGTGCACT 60.183 38.462 25.12 25.12 0.00 4.40
2591 2650 7.629222 GCTTTCCATGTCAAATATAGTGCACTT 60.629 37.037 27.06 15.06 0.00 3.16
2592 2651 8.800370 TTTCCATGTCAAATATAGTGCACTTA 57.200 30.769 27.06 16.73 0.00 2.24
2593 2652 8.800370 TTCCATGTCAAATATAGTGCACTTAA 57.200 30.769 27.06 14.04 0.00 1.85
2594 2653 8.800370 TCCATGTCAAATATAGTGCACTTAAA 57.200 30.769 27.06 7.61 0.00 1.52
2595 2654 9.407380 TCCATGTCAAATATAGTGCACTTAAAT 57.593 29.630 27.06 15.23 0.00 1.40
2606 2665 6.709018 AGTGCACTTAAATTTGTACCAAGT 57.291 33.333 15.25 0.00 0.00 3.16
2607 2666 6.735130 AGTGCACTTAAATTTGTACCAAGTC 58.265 36.000 15.25 0.00 0.00 3.01
2608 2667 6.320164 AGTGCACTTAAATTTGTACCAAGTCA 59.680 34.615 15.25 1.11 0.00 3.41
2609 2668 6.975772 GTGCACTTAAATTTGTACCAAGTCAA 59.024 34.615 10.32 0.00 0.00 3.18
2610 2669 7.489757 GTGCACTTAAATTTGTACCAAGTCAAA 59.510 33.333 10.32 0.00 37.82 2.69
2611 2670 7.489757 TGCACTTAAATTTGTACCAAGTCAAAC 59.510 33.333 0.00 0.00 36.58 2.93
2612 2671 7.704899 GCACTTAAATTTGTACCAAGTCAAACT 59.295 33.333 0.00 0.00 36.58 2.66
2613 2672 9.581099 CACTTAAATTTGTACCAAGTCAAACTT 57.419 29.630 0.00 0.00 39.39 2.66
2616 2675 9.930693 TTAAATTTGTACCAAGTCAAACTTTGT 57.069 25.926 0.00 2.65 36.03 2.83
2618 2677 9.930693 AAATTTGTACCAAGTCAAACTTTGTAA 57.069 25.926 5.61 0.00 37.84 2.41
2619 2678 9.930693 AATTTGTACCAAGTCAAACTTTGTAAA 57.069 25.926 5.61 0.00 37.84 2.01
2620 2679 9.930693 ATTTGTACCAAGTCAAACTTTGTAAAA 57.069 25.926 5.61 4.62 37.84 1.52
2621 2680 9.930693 TTTGTACCAAGTCAAACTTTGTAAAAT 57.069 25.926 7.24 0.00 37.84 1.82
2622 2681 9.930693 TTGTACCAAGTCAAACTTTGTAAAATT 57.069 25.926 5.61 0.00 37.84 1.82
2623 2682 9.930693 TGTACCAAGTCAAACTTTGTAAAATTT 57.069 25.926 5.61 0.00 37.84 1.82
2662 2721 9.601217 AGAGAATACATGAACATTTACAGTACC 57.399 33.333 0.00 0.00 0.00 3.34
2663 2722 9.378551 GAGAATACATGAACATTTACAGTACCA 57.621 33.333 0.00 0.00 0.00 3.25
2664 2723 9.383519 AGAATACATGAACATTTACAGTACCAG 57.616 33.333 0.00 0.00 0.00 4.00
2665 2724 9.378551 GAATACATGAACATTTACAGTACCAGA 57.621 33.333 0.00 0.00 0.00 3.86
2666 2725 9.905713 AATACATGAACATTTACAGTACCAGAT 57.094 29.630 0.00 0.00 0.00 2.90
2669 2728 9.330063 ACATGAACATTTACAGTACCAGATATG 57.670 33.333 0.00 0.00 0.00 1.78
2670 2729 8.777413 CATGAACATTTACAGTACCAGATATGG 58.223 37.037 4.39 4.39 0.00 2.74
2671 2730 7.279615 TGAACATTTACAGTACCAGATATGGG 58.720 38.462 11.86 0.00 0.00 4.00
2672 2731 6.824958 ACATTTACAGTACCAGATATGGGT 57.175 37.500 11.86 1.16 42.48 4.51
2673 2732 7.208064 ACATTTACAGTACCAGATATGGGTT 57.792 36.000 11.86 0.00 39.85 4.11
2674 2733 7.054124 ACATTTACAGTACCAGATATGGGTTG 58.946 38.462 11.86 8.25 39.85 3.77
2675 2734 3.560636 ACAGTACCAGATATGGGTTGC 57.439 47.619 11.86 0.00 39.85 4.17
2676 2735 2.172717 ACAGTACCAGATATGGGTTGCC 59.827 50.000 11.86 0.00 39.85 4.52
2677 2736 2.439507 CAGTACCAGATATGGGTTGCCT 59.560 50.000 11.86 0.00 39.85 4.75
2678 2737 3.646162 CAGTACCAGATATGGGTTGCCTA 59.354 47.826 11.86 0.00 39.85 3.93
2679 2738 4.102524 CAGTACCAGATATGGGTTGCCTAA 59.897 45.833 11.86 0.00 39.85 2.69
2680 2739 4.724798 AGTACCAGATATGGGTTGCCTAAA 59.275 41.667 11.86 0.00 39.85 1.85
2681 2740 4.601406 ACCAGATATGGGTTGCCTAAAA 57.399 40.909 11.86 0.00 34.10 1.52
2682 2741 4.941713 ACCAGATATGGGTTGCCTAAAAA 58.058 39.130 11.86 0.00 34.10 1.94
2683 2742 5.528337 ACCAGATATGGGTTGCCTAAAAAT 58.472 37.500 11.86 0.00 34.10 1.82
2684 2743 6.678547 ACCAGATATGGGTTGCCTAAAAATA 58.321 36.000 11.86 0.00 34.10 1.40
2685 2744 7.305246 ACCAGATATGGGTTGCCTAAAAATAT 58.695 34.615 11.86 0.00 34.10 1.28
2686 2745 8.452868 ACCAGATATGGGTTGCCTAAAAATATA 58.547 33.333 11.86 0.00 34.10 0.86
2687 2746 9.479549 CCAGATATGGGTTGCCTAAAAATATAT 57.520 33.333 0.00 0.00 0.00 0.86
2756 2815 8.782137 ATATTTTGTAAGGATTTGGCCATAGT 57.218 30.769 6.09 0.00 0.00 2.12
2757 2816 6.926630 TTTTGTAAGGATTTGGCCATAGTT 57.073 33.333 6.09 0.00 0.00 2.24
2758 2817 6.926630 TTTGTAAGGATTTGGCCATAGTTT 57.073 33.333 6.09 0.42 0.00 2.66
2759 2818 8.423906 TTTTGTAAGGATTTGGCCATAGTTTA 57.576 30.769 6.09 0.00 0.00 2.01
2760 2819 8.602472 TTTGTAAGGATTTGGCCATAGTTTAT 57.398 30.769 6.09 0.00 0.00 1.40
2761 2820 9.702253 TTTGTAAGGATTTGGCCATAGTTTATA 57.298 29.630 6.09 0.00 0.00 0.98
2762 2821 9.875708 TTGTAAGGATTTGGCCATAGTTTATAT 57.124 29.630 6.09 0.00 0.00 0.86
2773 2832 9.747898 TGGCCATAGTTTATATATAAAGGTTGG 57.252 33.333 22.06 22.06 33.31 3.77
2774 2833 8.683615 GGCCATAGTTTATATATAAAGGTTGGC 58.316 37.037 30.68 30.68 42.85 4.52
2775 2834 9.462606 GCCATAGTTTATATATAAAGGTTGGCT 57.537 33.333 30.89 21.31 41.82 4.75
2785 2844 7.961326 ATATAAAGGTTGGCTGAAGACAAAT 57.039 32.000 0.00 0.00 45.92 2.32
2786 2845 4.590850 AAAGGTTGGCTGAAGACAAATC 57.409 40.909 0.00 0.00 45.92 2.17
2787 2846 3.515602 AGGTTGGCTGAAGACAAATCT 57.484 42.857 0.00 0.00 45.92 2.40
2788 2847 4.640771 AGGTTGGCTGAAGACAAATCTA 57.359 40.909 0.00 0.00 45.92 1.98
2789 2848 4.985538 AGGTTGGCTGAAGACAAATCTAA 58.014 39.130 0.00 0.00 45.92 2.10
2790 2849 5.574188 AGGTTGGCTGAAGACAAATCTAAT 58.426 37.500 0.00 0.00 45.92 1.73
2791 2850 6.721318 AGGTTGGCTGAAGACAAATCTAATA 58.279 36.000 0.00 0.00 45.92 0.98
2792 2851 7.349598 AGGTTGGCTGAAGACAAATCTAATAT 58.650 34.615 0.00 0.00 45.92 1.28
2793 2852 7.284034 AGGTTGGCTGAAGACAAATCTAATATG 59.716 37.037 0.00 0.00 45.92 1.78
2794 2853 6.624352 TGGCTGAAGACAAATCTAATATGC 57.376 37.500 0.00 0.00 33.57 3.14
2795 2854 6.121590 TGGCTGAAGACAAATCTAATATGCA 58.878 36.000 0.00 0.00 33.57 3.96
2796 2855 6.038603 TGGCTGAAGACAAATCTAATATGCAC 59.961 38.462 0.00 0.00 33.57 4.57
2797 2856 6.261826 GGCTGAAGACAAATCTAATATGCACT 59.738 38.462 0.00 0.00 33.57 4.40
2798 2857 7.442364 GGCTGAAGACAAATCTAATATGCACTA 59.558 37.037 0.00 0.00 33.57 2.74
2799 2858 8.997323 GCTGAAGACAAATCTAATATGCACTAT 58.003 33.333 0.00 0.00 33.57 2.12
2814 2873 7.653713 AATATGCACTATATTATGGCGTAGAGC 59.346 37.037 0.00 0.00 39.59 4.09
2867 2926 8.432110 AACCAAAATATGAAAAGTTGTGAACC 57.568 30.769 0.00 0.00 0.00 3.62
2868 2927 7.791029 ACCAAAATATGAAAAGTTGTGAACCT 58.209 30.769 0.00 0.00 0.00 3.50
2869 2928 8.264347 ACCAAAATATGAAAAGTTGTGAACCTT 58.736 29.630 0.00 0.00 0.00 3.50
2870 2929 9.757227 CCAAAATATGAAAAGTTGTGAACCTTA 57.243 29.630 0.00 0.00 0.00 2.69
2877 2936 8.300495 TGAAAAGTTGTGAACCTTAAAAACAC 57.700 30.769 0.00 0.00 0.00 3.32
2878 2937 7.926555 TGAAAAGTTGTGAACCTTAAAAACACA 59.073 29.630 0.00 0.00 39.22 3.72
2879 2938 8.664211 AAAAGTTGTGAACCTTAAAAACACAA 57.336 26.923 0.00 0.00 45.03 3.33
2883 2942 7.659652 TTGTGAACCTTAAAAACACAAAAGG 57.340 32.000 0.00 0.00 44.53 3.11
2900 2959 7.014092 ACAAAAGGTTGTGTATGCAAAATTG 57.986 32.000 0.00 0.00 46.40 2.32
2901 2960 6.038050 ACAAAAGGTTGTGTATGCAAAATTGG 59.962 34.615 0.00 0.00 46.40 3.16
2902 2961 3.663025 AGGTTGTGTATGCAAAATTGGC 58.337 40.909 0.00 0.00 0.00 4.52
2903 2962 3.070734 AGGTTGTGTATGCAAAATTGGCA 59.929 39.130 0.00 0.00 46.66 4.92
2904 2963 3.812053 GGTTGTGTATGCAAAATTGGCAA 59.188 39.130 0.68 0.68 45.60 4.52
2905 2964 4.455190 GGTTGTGTATGCAAAATTGGCAAT 59.545 37.500 6.96 6.96 45.60 3.56
2906 2965 5.641209 GGTTGTGTATGCAAAATTGGCAATA 59.359 36.000 14.05 0.00 45.60 1.90
2907 2966 6.402011 GGTTGTGTATGCAAAATTGGCAATAC 60.402 38.462 14.05 6.62 45.60 1.89
2908 2967 6.035368 TGTGTATGCAAAATTGGCAATACT 57.965 33.333 14.05 0.72 45.60 2.12
2909 2968 6.462500 TGTGTATGCAAAATTGGCAATACTT 58.538 32.000 14.05 7.37 45.60 2.24
2910 2969 7.606349 TGTGTATGCAAAATTGGCAATACTTA 58.394 30.769 14.05 4.04 45.60 2.24
2911 2970 8.256605 TGTGTATGCAAAATTGGCAATACTTAT 58.743 29.630 14.05 7.49 45.60 1.73
2912 2971 8.755018 GTGTATGCAAAATTGGCAATACTTATC 58.245 33.333 14.05 6.37 45.60 1.75
2913 2972 8.473219 TGTATGCAAAATTGGCAATACTTATCA 58.527 29.630 14.05 11.00 45.60 2.15
2914 2973 9.311916 GTATGCAAAATTGGCAATACTTATCAA 57.688 29.630 14.05 0.00 45.60 2.57
2915 2974 8.967664 ATGCAAAATTGGCAATACTTATCAAT 57.032 26.923 14.05 0.00 45.60 2.57
2916 2975 8.789825 TGCAAAATTGGCAATACTTATCAATT 57.210 26.923 14.05 0.00 38.54 2.32
2917 2976 9.228949 TGCAAAATTGGCAATACTTATCAATTT 57.771 25.926 14.05 4.15 44.67 1.82
2942 3001 8.532977 TTTTTGGGTAACTACACGAATAGTAC 57.467 34.615 0.00 0.00 33.26 2.73
2943 3002 6.832520 TTGGGTAACTACACGAATAGTACA 57.167 37.500 0.00 0.00 34.18 2.90
2944 3003 7.408756 TTGGGTAACTACACGAATAGTACAT 57.591 36.000 0.00 0.00 34.18 2.29
2945 3004 8.518430 TTGGGTAACTACACGAATAGTACATA 57.482 34.615 0.00 0.00 34.18 2.29
2946 3005 8.518430 TGGGTAACTACACGAATAGTACATAA 57.482 34.615 0.00 0.00 34.18 1.90
2947 3006 8.965819 TGGGTAACTACACGAATAGTACATAAA 58.034 33.333 0.00 0.00 34.18 1.40
2948 3007 9.237846 GGGTAACTACACGAATAGTACATAAAC 57.762 37.037 0.00 0.00 34.18 2.01
2952 3011 9.918630 AACTACACGAATAGTACATAAACTTGT 57.081 29.630 0.00 0.00 34.18 3.16
2953 3012 9.565213 ACTACACGAATAGTACATAAACTTGTC 57.435 33.333 0.00 0.00 33.50 3.18
2954 3013 9.563898 CTACACGAATAGTACATAAACTTGTCA 57.436 33.333 0.00 0.00 0.00 3.58
2955 3014 8.997621 ACACGAATAGTACATAAACTTGTCAT 57.002 30.769 0.00 0.00 0.00 3.06
2967 3026 9.905713 ACATAAACTTGTCATATATGTCCAGTT 57.094 29.630 17.73 17.73 33.18 3.16
2971 3030 8.964476 AACTTGTCATATATGTCCAGTTTAGG 57.036 34.615 17.73 0.70 0.00 2.69
2972 3031 7.509546 ACTTGTCATATATGTCCAGTTTAGGG 58.490 38.462 12.42 0.00 0.00 3.53
2973 3032 5.865085 TGTCATATATGTCCAGTTTAGGGC 58.135 41.667 12.42 0.00 0.00 5.19
2979 3038 1.559682 TGTCCAGTTTAGGGCATCTCC 59.440 52.381 0.00 0.00 38.62 3.71
2980 3039 1.559682 GTCCAGTTTAGGGCATCTCCA 59.440 52.381 0.00 0.00 36.21 3.86
2981 3040 2.026262 GTCCAGTTTAGGGCATCTCCAA 60.026 50.000 0.00 0.00 36.21 3.53
2982 3041 2.852449 TCCAGTTTAGGGCATCTCCAAT 59.148 45.455 0.00 0.00 36.21 3.16
2983 3042 2.954318 CCAGTTTAGGGCATCTCCAATG 59.046 50.000 0.00 0.00 36.21 2.82
2984 3043 2.360165 CAGTTTAGGGCATCTCCAATGC 59.640 50.000 1.40 1.40 43.85 3.56
2990 3049 1.818555 GCATCTCCAATGCCAACCC 59.181 57.895 0.00 0.00 39.01 4.11
2991 3050 0.971959 GCATCTCCAATGCCAACCCA 60.972 55.000 0.00 0.00 39.01 4.51
2992 3051 1.108776 CATCTCCAATGCCAACCCAG 58.891 55.000 0.00 0.00 0.00 4.45
2993 3052 1.002069 ATCTCCAATGCCAACCCAGA 58.998 50.000 0.00 0.00 0.00 3.86
2994 3053 0.776810 TCTCCAATGCCAACCCAGAA 59.223 50.000 0.00 0.00 0.00 3.02
2995 3054 1.146774 TCTCCAATGCCAACCCAGAAA 59.853 47.619 0.00 0.00 0.00 2.52
2996 3055 1.273327 CTCCAATGCCAACCCAGAAAC 59.727 52.381 0.00 0.00 0.00 2.78
2997 3056 0.321346 CCAATGCCAACCCAGAAACC 59.679 55.000 0.00 0.00 0.00 3.27
2998 3057 1.341080 CAATGCCAACCCAGAAACCT 58.659 50.000 0.00 0.00 0.00 3.50
2999 3058 1.273327 CAATGCCAACCCAGAAACCTC 59.727 52.381 0.00 0.00 0.00 3.85
3000 3059 0.779997 ATGCCAACCCAGAAACCTCT 59.220 50.000 0.00 0.00 0.00 3.69
3001 3060 0.110486 TGCCAACCCAGAAACCTCTC 59.890 55.000 0.00 0.00 0.00 3.20
3002 3061 0.955919 GCCAACCCAGAAACCTCTCG 60.956 60.000 0.00 0.00 0.00 4.04
3003 3062 0.955919 CCAACCCAGAAACCTCTCGC 60.956 60.000 0.00 0.00 0.00 5.03
3004 3063 0.250295 CAACCCAGAAACCTCTCGCA 60.250 55.000 0.00 0.00 0.00 5.10
3005 3064 0.472471 AACCCAGAAACCTCTCGCAA 59.528 50.000 0.00 0.00 0.00 4.85
3006 3065 0.250338 ACCCAGAAACCTCTCGCAAC 60.250 55.000 0.00 0.00 0.00 4.17
3007 3066 0.955919 CCCAGAAACCTCTCGCAACC 60.956 60.000 0.00 0.00 0.00 3.77
3008 3067 1.291877 CCAGAAACCTCTCGCAACCG 61.292 60.000 0.00 0.00 0.00 4.44
3009 3068 0.600255 CAGAAACCTCTCGCAACCGT 60.600 55.000 0.00 0.00 35.54 4.83
3010 3069 0.319641 AGAAACCTCTCGCAACCGTC 60.320 55.000 0.00 0.00 35.54 4.79
3011 3070 1.289800 GAAACCTCTCGCAACCGTCC 61.290 60.000 0.00 0.00 35.54 4.79
3012 3071 3.569049 AACCTCTCGCAACCGTCCG 62.569 63.158 0.00 0.00 35.54 4.79
3013 3072 4.796231 CCTCTCGCAACCGTCCGG 62.796 72.222 3.76 3.76 42.03 5.14
3014 3073 3.744719 CTCTCGCAACCGTCCGGA 61.745 66.667 13.54 0.00 38.96 5.14
3015 3074 3.966026 CTCTCGCAACCGTCCGGAC 62.966 68.421 25.28 25.28 38.96 4.79
3023 3082 4.430765 CCGTCCGGACCGTGGAAG 62.431 72.222 28.52 12.44 37.23 3.46
3025 3084 4.754667 GTCCGGACCGTGGAAGCC 62.755 72.222 24.75 0.00 37.23 4.35
3027 3086 4.096003 CCGGACCGTGGAAGCCAT 62.096 66.667 13.94 0.00 35.28 4.40
3028 3087 2.511600 CGGACCGTGGAAGCCATC 60.512 66.667 5.48 0.00 35.28 3.51
3037 3096 2.746277 GAAGCCATCCAACGCGGT 60.746 61.111 12.47 0.00 35.57 5.68
3038 3097 2.746277 AAGCCATCCAACGCGGTC 60.746 61.111 12.47 0.00 35.57 4.79
3039 3098 4.778143 AGCCATCCAACGCGGTCC 62.778 66.667 12.47 0.00 35.57 4.46
3040 3099 4.778143 GCCATCCAACGCGGTCCT 62.778 66.667 12.47 0.00 35.57 3.85
3041 3100 2.819595 CCATCCAACGCGGTCCTG 60.820 66.667 12.47 0.00 35.57 3.86
3042 3101 2.047274 CATCCAACGCGGTCCTGT 60.047 61.111 12.47 0.00 35.57 4.00
3043 3102 1.216977 CATCCAACGCGGTCCTGTA 59.783 57.895 12.47 0.00 35.57 2.74
3044 3103 0.179084 CATCCAACGCGGTCCTGTAT 60.179 55.000 12.47 0.00 35.57 2.29
3045 3104 0.104304 ATCCAACGCGGTCCTGTATC 59.896 55.000 12.47 0.00 35.57 2.24
3046 3105 1.876714 CCAACGCGGTCCTGTATCG 60.877 63.158 12.47 0.00 33.70 2.92
3047 3106 1.876714 CAACGCGGTCCTGTATCGG 60.877 63.158 12.47 0.00 30.14 4.18
3048 3107 2.345760 AACGCGGTCCTGTATCGGT 61.346 57.895 12.47 0.00 30.14 4.69
3049 3108 1.880819 AACGCGGTCCTGTATCGGTT 61.881 55.000 12.47 0.00 30.14 4.44
3050 3109 1.588139 CGCGGTCCTGTATCGGTTC 60.588 63.158 0.00 0.00 30.14 3.62
3051 3110 1.588139 GCGGTCCTGTATCGGTTCG 60.588 63.158 0.00 0.00 30.14 3.95
3052 3111 1.588139 CGGTCCTGTATCGGTTCGC 60.588 63.158 0.00 0.00 0.00 4.70
3053 3112 1.514087 GGTCCTGTATCGGTTCGCA 59.486 57.895 0.00 0.00 0.00 5.10
3054 3113 0.108520 GGTCCTGTATCGGTTCGCAA 60.109 55.000 0.00 0.00 0.00 4.85
3055 3114 0.997196 GTCCTGTATCGGTTCGCAAC 59.003 55.000 0.00 0.00 0.00 4.17
3056 3115 0.457166 TCCTGTATCGGTTCGCAACG 60.457 55.000 0.00 0.00 0.00 4.10
3057 3116 1.343821 CTGTATCGGTTCGCAACGC 59.656 57.895 0.00 0.00 0.00 4.84
3073 3132 2.968697 GCGGTCCGGACGTGTTTT 60.969 61.111 27.68 0.00 0.00 2.43
3074 3133 2.946752 GCGGTCCGGACGTGTTTTC 61.947 63.158 27.68 11.35 0.00 2.29
3075 3134 1.300388 CGGTCCGGACGTGTTTTCT 60.300 57.895 27.68 0.00 0.00 2.52
3076 3135 0.877213 CGGTCCGGACGTGTTTTCTT 60.877 55.000 27.68 0.00 0.00 2.52
3077 3136 1.302366 GGTCCGGACGTGTTTTCTTT 58.698 50.000 27.68 0.00 0.00 2.52
3078 3137 1.003223 GGTCCGGACGTGTTTTCTTTG 60.003 52.381 27.68 0.00 0.00 2.77
3079 3138 1.003223 GTCCGGACGTGTTTTCTTTGG 60.003 52.381 20.85 0.00 0.00 3.28
3080 3139 1.134461 TCCGGACGTGTTTTCTTTGGA 60.134 47.619 0.00 0.00 0.00 3.53
3081 3140 1.671845 CCGGACGTGTTTTCTTTGGAA 59.328 47.619 0.00 0.00 0.00 3.53
3082 3141 2.097791 CCGGACGTGTTTTCTTTGGAAA 59.902 45.455 0.00 0.00 39.38 3.13
3083 3142 3.427773 CCGGACGTGTTTTCTTTGGAAAA 60.428 43.478 0.00 0.55 45.62 2.29
3093 3152 6.597832 TTTTCTTTGGAAAACTGGAGACAA 57.402 33.333 0.55 0.00 43.76 3.18
3094 3153 6.597832 TTTCTTTGGAAAACTGGAGACAAA 57.402 33.333 0.00 0.00 38.00 2.83
3095 3154 5.576447 TCTTTGGAAAACTGGAGACAAAC 57.424 39.130 0.00 0.00 42.06 2.93
3096 3155 5.013547 TCTTTGGAAAACTGGAGACAAACA 58.986 37.500 0.00 0.00 42.06 2.83
3097 3156 5.656416 TCTTTGGAAAACTGGAGACAAACAT 59.344 36.000 0.00 0.00 42.06 2.71
3098 3157 4.916983 TGGAAAACTGGAGACAAACATG 57.083 40.909 0.00 0.00 42.06 3.21
3099 3158 3.636300 TGGAAAACTGGAGACAAACATGG 59.364 43.478 0.00 0.00 42.06 3.66
3100 3159 3.005791 GGAAAACTGGAGACAAACATGGG 59.994 47.826 0.00 0.00 42.06 4.00
3101 3160 2.292828 AACTGGAGACAAACATGGGG 57.707 50.000 0.00 0.00 42.06 4.96
3102 3161 0.405585 ACTGGAGACAAACATGGGGG 59.594 55.000 0.00 0.00 42.06 5.40
3117 3176 2.541177 GGGGGATTAGTGGGAGTCC 58.459 63.158 0.00 0.00 0.00 3.85
3118 3177 1.408453 GGGGGATTAGTGGGAGTCCG 61.408 65.000 2.26 0.00 35.24 4.79
3119 3178 1.408453 GGGGATTAGTGGGAGTCCGG 61.408 65.000 2.26 0.00 35.24 5.14
3120 3179 0.398098 GGGATTAGTGGGAGTCCGGA 60.398 60.000 0.00 0.00 35.24 5.14
3121 3180 0.751452 GGATTAGTGGGAGTCCGGAC 59.249 60.000 27.67 27.67 35.24 4.79
3122 3181 1.481871 GATTAGTGGGAGTCCGGACA 58.518 55.000 35.00 13.13 35.24 4.02
3123 3182 1.136500 GATTAGTGGGAGTCCGGACAC 59.864 57.143 35.00 28.67 35.24 3.67
3124 3183 1.246056 TTAGTGGGAGTCCGGACACG 61.246 60.000 35.00 0.00 38.78 4.49
3125 3184 2.128290 TAGTGGGAGTCCGGACACGA 62.128 60.000 35.00 21.57 44.60 4.35
3126 3185 2.675423 TGGGAGTCCGGACACGAG 60.675 66.667 35.00 0.00 44.60 4.18
3127 3186 2.360852 GGGAGTCCGGACACGAGA 60.361 66.667 35.00 0.00 44.60 4.04
3128 3187 1.975407 GGGAGTCCGGACACGAGAA 60.975 63.158 35.00 0.00 44.60 2.87
3129 3188 1.530013 GGGAGTCCGGACACGAGAAA 61.530 60.000 35.00 0.00 44.60 2.52
3130 3189 0.388263 GGAGTCCGGACACGAGAAAC 60.388 60.000 35.00 12.19 44.60 2.78
3131 3190 0.728466 GAGTCCGGACACGAGAAACG 60.728 60.000 35.00 0.00 44.60 3.60
3143 3202 2.637595 CGAGAAACGTCGCTCTATACC 58.362 52.381 13.59 0.00 37.22 2.73
3144 3203 2.601741 CGAGAAACGTCGCTCTATACCC 60.602 54.545 13.59 0.00 37.22 3.69
3145 3204 1.680207 AGAAACGTCGCTCTATACCCC 59.320 52.381 0.00 0.00 0.00 4.95
3146 3205 1.680207 GAAACGTCGCTCTATACCCCT 59.320 52.381 0.00 0.00 0.00 4.79
3147 3206 1.030457 AACGTCGCTCTATACCCCTG 58.970 55.000 0.00 0.00 0.00 4.45
3148 3207 0.822532 ACGTCGCTCTATACCCCTGG 60.823 60.000 0.00 0.00 0.00 4.45
3149 3208 1.666580 GTCGCTCTATACCCCTGGC 59.333 63.158 0.00 0.00 0.00 4.85
3150 3209 1.533273 TCGCTCTATACCCCTGGCC 60.533 63.158 0.00 0.00 0.00 5.36
3151 3210 2.584391 CGCTCTATACCCCTGGCCC 61.584 68.421 0.00 0.00 0.00 5.80
3152 3211 2.584391 GCTCTATACCCCTGGCCCG 61.584 68.421 0.00 0.00 0.00 6.13
3153 3212 2.525877 TCTATACCCCTGGCCCGC 60.526 66.667 0.00 0.00 0.00 6.13
3154 3213 3.637273 CTATACCCCTGGCCCGCC 61.637 72.222 0.00 0.00 0.00 6.13
3162 3221 4.676951 CTGGCCCGCCCAAAAGGA 62.677 66.667 0.00 0.00 44.81 3.36
3163 3222 4.226095 TGGCCCGCCCAAAAGGAA 62.226 61.111 0.00 0.00 41.82 3.36
3164 3223 3.381983 GGCCCGCCCAAAAGGAAG 61.382 66.667 0.00 0.00 38.24 3.46
3165 3224 3.381983 GCCCGCCCAAAAGGAAGG 61.382 66.667 0.00 0.00 38.24 3.46
3166 3225 2.117423 CCCGCCCAAAAGGAAGGT 59.883 61.111 0.00 0.00 38.24 3.50
3167 3226 2.275380 CCCGCCCAAAAGGAAGGTG 61.275 63.158 0.00 0.00 38.24 4.00
3168 3227 2.275380 CCGCCCAAAAGGAAGGTGG 61.275 63.158 0.00 0.00 44.49 4.61
3169 3228 1.228429 CGCCCAAAAGGAAGGTGGA 60.228 57.895 0.00 0.00 38.24 4.02
3170 3229 1.244019 CGCCCAAAAGGAAGGTGGAG 61.244 60.000 0.00 0.00 38.24 3.86
3171 3230 1.536073 GCCCAAAAGGAAGGTGGAGC 61.536 60.000 0.00 0.00 38.24 4.70
3172 3231 0.900182 CCCAAAAGGAAGGTGGAGCC 60.900 60.000 0.00 0.00 38.24 4.70
3173 3232 1.244019 CCAAAAGGAAGGTGGAGCCG 61.244 60.000 0.00 0.00 43.70 5.52
3174 3233 1.074951 AAAAGGAAGGTGGAGCCGG 59.925 57.895 0.00 0.00 43.70 6.13
3175 3234 3.569200 AAAGGAAGGTGGAGCCGGC 62.569 63.158 21.89 21.89 43.70 6.13
3178 3237 4.021925 GAAGGTGGAGCCGGCACT 62.022 66.667 31.54 15.24 43.70 4.40
3179 3238 2.606519 AAGGTGGAGCCGGCACTA 60.607 61.111 31.54 19.13 43.70 2.74
3180 3239 1.972660 GAAGGTGGAGCCGGCACTAT 61.973 60.000 31.54 7.63 43.70 2.12
3181 3240 1.562672 AAGGTGGAGCCGGCACTATT 61.563 55.000 31.54 9.89 43.70 1.73
3182 3241 1.819632 GGTGGAGCCGGCACTATTG 60.820 63.158 31.54 0.00 0.00 1.90
3183 3242 1.078426 GTGGAGCCGGCACTATTGT 60.078 57.895 31.54 5.22 0.00 2.71
3184 3243 0.177141 GTGGAGCCGGCACTATTGTA 59.823 55.000 31.54 2.40 0.00 2.41
3185 3244 0.464036 TGGAGCCGGCACTATTGTAG 59.536 55.000 31.54 0.00 0.00 2.74
3186 3245 0.880718 GGAGCCGGCACTATTGTAGC 60.881 60.000 31.54 2.63 0.00 3.58
3187 3246 0.179084 GAGCCGGCACTATTGTAGCA 60.179 55.000 31.54 0.00 0.00 3.49
3188 3247 0.469917 AGCCGGCACTATTGTAGCAT 59.530 50.000 31.54 0.00 0.00 3.79
3189 3248 0.868406 GCCGGCACTATTGTAGCATC 59.132 55.000 24.80 0.00 0.00 3.91
3190 3249 1.512926 CCGGCACTATTGTAGCATCC 58.487 55.000 0.00 0.00 0.00 3.51
3191 3250 1.512926 CGGCACTATTGTAGCATCCC 58.487 55.000 0.00 0.00 0.00 3.85
3192 3251 1.202639 CGGCACTATTGTAGCATCCCA 60.203 52.381 0.00 0.00 0.00 4.37
3193 3252 2.222027 GGCACTATTGTAGCATCCCAC 58.778 52.381 0.00 0.00 0.00 4.61
3194 3253 2.421388 GGCACTATTGTAGCATCCCACA 60.421 50.000 0.00 0.00 0.00 4.17
3195 3254 2.614057 GCACTATTGTAGCATCCCACAC 59.386 50.000 0.00 0.00 0.00 3.82
3196 3255 3.682718 GCACTATTGTAGCATCCCACACT 60.683 47.826 0.00 0.00 0.00 3.55
3197 3256 3.873361 CACTATTGTAGCATCCCACACTG 59.127 47.826 0.00 0.00 0.00 3.66
3198 3257 3.519510 ACTATTGTAGCATCCCACACTGT 59.480 43.478 0.00 0.00 0.00 3.55
3199 3258 2.949177 TTGTAGCATCCCACACTGTT 57.051 45.000 0.00 0.00 0.00 3.16
3200 3259 2.949177 TGTAGCATCCCACACTGTTT 57.051 45.000 0.00 0.00 0.00 2.83
3201 3260 3.222173 TGTAGCATCCCACACTGTTTT 57.778 42.857 0.00 0.00 0.00 2.43
3202 3261 3.146066 TGTAGCATCCCACACTGTTTTC 58.854 45.455 0.00 0.00 0.00 2.29
3203 3262 2.363306 AGCATCCCACACTGTTTTCA 57.637 45.000 0.00 0.00 0.00 2.69
3204 3263 1.956477 AGCATCCCACACTGTTTTCAC 59.044 47.619 0.00 0.00 0.00 3.18
3205 3264 1.334960 GCATCCCACACTGTTTTCACG 60.335 52.381 0.00 0.00 0.00 4.35
3206 3265 0.951558 ATCCCACACTGTTTTCACGC 59.048 50.000 0.00 0.00 0.00 5.34
3207 3266 1.098712 TCCCACACTGTTTTCACGCC 61.099 55.000 0.00 0.00 0.00 5.68
3208 3267 1.380403 CCCACACTGTTTTCACGCCA 61.380 55.000 0.00 0.00 0.00 5.69
3209 3268 0.453793 CCACACTGTTTTCACGCCAA 59.546 50.000 0.00 0.00 0.00 4.52
3210 3269 1.135257 CCACACTGTTTTCACGCCAAA 60.135 47.619 0.00 0.00 0.00 3.28
3211 3270 2.600731 CACACTGTTTTCACGCCAAAA 58.399 42.857 0.00 0.00 0.00 2.44
3212 3271 3.186119 CACACTGTTTTCACGCCAAAAT 58.814 40.909 0.00 0.00 0.00 1.82
3213 3272 3.242712 CACACTGTTTTCACGCCAAAATC 59.757 43.478 0.00 0.00 0.00 2.17
3214 3273 2.794350 CACTGTTTTCACGCCAAAATCC 59.206 45.455 0.00 0.00 0.00 3.01
3215 3274 2.693074 ACTGTTTTCACGCCAAAATCCT 59.307 40.909 0.00 0.00 0.00 3.24
3216 3275 3.243401 ACTGTTTTCACGCCAAAATCCTC 60.243 43.478 0.00 0.00 0.00 3.71
3217 3276 2.035321 TGTTTTCACGCCAAAATCCTCC 59.965 45.455 0.00 0.00 0.00 4.30
3218 3277 1.988293 TTTCACGCCAAAATCCTCCA 58.012 45.000 0.00 0.00 0.00 3.86
3219 3278 1.243902 TTCACGCCAAAATCCTCCAC 58.756 50.000 0.00 0.00 0.00 4.02
3220 3279 0.400213 TCACGCCAAAATCCTCCACT 59.600 50.000 0.00 0.00 0.00 4.00
3221 3280 1.202879 TCACGCCAAAATCCTCCACTT 60.203 47.619 0.00 0.00 0.00 3.16
3222 3281 1.200020 CACGCCAAAATCCTCCACTTC 59.800 52.381 0.00 0.00 0.00 3.01
3223 3282 1.073923 ACGCCAAAATCCTCCACTTCT 59.926 47.619 0.00 0.00 0.00 2.85
3224 3283 1.740025 CGCCAAAATCCTCCACTTCTC 59.260 52.381 0.00 0.00 0.00 2.87
3225 3284 2.616510 CGCCAAAATCCTCCACTTCTCT 60.617 50.000 0.00 0.00 0.00 3.10
3226 3285 3.425659 GCCAAAATCCTCCACTTCTCTT 58.574 45.455 0.00 0.00 0.00 2.85
3227 3286 3.441922 GCCAAAATCCTCCACTTCTCTTC 59.558 47.826 0.00 0.00 0.00 2.87
3228 3287 4.809007 GCCAAAATCCTCCACTTCTCTTCT 60.809 45.833 0.00 0.00 0.00 2.85
3229 3288 5.320277 CCAAAATCCTCCACTTCTCTTCTT 58.680 41.667 0.00 0.00 0.00 2.52
3230 3289 5.414144 CCAAAATCCTCCACTTCTCTTCTTC 59.586 44.000 0.00 0.00 0.00 2.87
3231 3290 4.835284 AATCCTCCACTTCTCTTCTTCC 57.165 45.455 0.00 0.00 0.00 3.46
3232 3291 3.260269 TCCTCCACTTCTCTTCTTCCA 57.740 47.619 0.00 0.00 0.00 3.53
3233 3292 3.796111 TCCTCCACTTCTCTTCTTCCAT 58.204 45.455 0.00 0.00 0.00 3.41
3234 3293 4.171234 TCCTCCACTTCTCTTCTTCCATT 58.829 43.478 0.00 0.00 0.00 3.16
3235 3294 4.223923 TCCTCCACTTCTCTTCTTCCATTC 59.776 45.833 0.00 0.00 0.00 2.67
3236 3295 4.512484 CTCCACTTCTCTTCTTCCATTCC 58.488 47.826 0.00 0.00 0.00 3.01
3237 3296 3.264450 TCCACTTCTCTTCTTCCATTCCC 59.736 47.826 0.00 0.00 0.00 3.97
3238 3297 3.615155 CACTTCTCTTCTTCCATTCCCC 58.385 50.000 0.00 0.00 0.00 4.81
3239 3298 2.237392 ACTTCTCTTCTTCCATTCCCCG 59.763 50.000 0.00 0.00 0.00 5.73
3240 3299 0.541863 TCTCTTCTTCCATTCCCCGC 59.458 55.000 0.00 0.00 0.00 6.13
3241 3300 0.464554 CTCTTCTTCCATTCCCCGCC 60.465 60.000 0.00 0.00 0.00 6.13
3242 3301 1.819632 CTTCTTCCATTCCCCGCCG 60.820 63.158 0.00 0.00 0.00 6.46
3243 3302 3.987954 TTCTTCCATTCCCCGCCGC 62.988 63.158 0.00 0.00 0.00 6.53
3244 3303 4.489771 CTTCCATTCCCCGCCGCT 62.490 66.667 0.00 0.00 0.00 5.52
3245 3304 4.483243 TTCCATTCCCCGCCGCTC 62.483 66.667 0.00 0.00 0.00 5.03
3247 3306 4.918201 CCATTCCCCGCCGCTCTC 62.918 72.222 0.00 0.00 0.00 3.20
3248 3307 4.918201 CATTCCCCGCCGCTCTCC 62.918 72.222 0.00 0.00 0.00 3.71
3257 3316 2.897350 CCGCTCTCCGCCCAATTC 60.897 66.667 0.00 0.00 35.03 2.17
3258 3317 2.187946 CGCTCTCCGCCCAATTCT 59.812 61.111 0.00 0.00 34.21 2.40
3259 3318 1.450312 CGCTCTCCGCCCAATTCTT 60.450 57.895 0.00 0.00 34.21 2.52
3260 3319 1.709147 CGCTCTCCGCCCAATTCTTG 61.709 60.000 0.00 0.00 34.21 3.02
3261 3320 1.997928 GCTCTCCGCCCAATTCTTGC 61.998 60.000 0.00 0.00 0.00 4.01
3262 3321 0.393537 CTCTCCGCCCAATTCTTGCT 60.394 55.000 0.00 0.00 0.00 3.91
3263 3322 0.392998 TCTCCGCCCAATTCTTGCTC 60.393 55.000 0.00 0.00 0.00 4.26
3264 3323 0.393537 CTCCGCCCAATTCTTGCTCT 60.394 55.000 0.00 0.00 0.00 4.09
3265 3324 0.038166 TCCGCCCAATTCTTGCTCTT 59.962 50.000 0.00 0.00 0.00 2.85
3266 3325 0.890683 CCGCCCAATTCTTGCTCTTT 59.109 50.000 0.00 0.00 0.00 2.52
3267 3326 1.273327 CCGCCCAATTCTTGCTCTTTT 59.727 47.619 0.00 0.00 0.00 2.27
3268 3327 2.599659 CGCCCAATTCTTGCTCTTTTC 58.400 47.619 0.00 0.00 0.00 2.29
3269 3328 2.672195 CGCCCAATTCTTGCTCTTTTCC 60.672 50.000 0.00 0.00 0.00 3.13
3270 3329 2.354103 GCCCAATTCTTGCTCTTTTCCC 60.354 50.000 0.00 0.00 0.00 3.97
3271 3330 2.234661 CCCAATTCTTGCTCTTTTCCCC 59.765 50.000 0.00 0.00 0.00 4.81
3272 3331 2.234661 CCAATTCTTGCTCTTTTCCCCC 59.765 50.000 0.00 0.00 0.00 5.40
3273 3332 2.899256 CAATTCTTGCTCTTTTCCCCCA 59.101 45.455 0.00 0.00 0.00 4.96
3274 3333 1.995376 TTCTTGCTCTTTTCCCCCAC 58.005 50.000 0.00 0.00 0.00 4.61
3275 3334 0.112412 TCTTGCTCTTTTCCCCCACC 59.888 55.000 0.00 0.00 0.00 4.61
3276 3335 0.900182 CTTGCTCTTTTCCCCCACCC 60.900 60.000 0.00 0.00 0.00 4.61
3277 3336 1.368268 TTGCTCTTTTCCCCCACCCT 61.368 55.000 0.00 0.00 0.00 4.34
3278 3337 1.000771 GCTCTTTTCCCCCACCCTC 60.001 63.158 0.00 0.00 0.00 4.30
3279 3338 1.501654 GCTCTTTTCCCCCACCCTCT 61.502 60.000 0.00 0.00 0.00 3.69
3280 3339 0.621082 CTCTTTTCCCCCACCCTCTC 59.379 60.000 0.00 0.00 0.00 3.20
3281 3340 0.845102 TCTTTTCCCCCACCCTCTCC 60.845 60.000 0.00 0.00 0.00 3.71
3282 3341 0.846870 CTTTTCCCCCACCCTCTCCT 60.847 60.000 0.00 0.00 0.00 3.69
3283 3342 0.404346 TTTTCCCCCACCCTCTCCTT 60.404 55.000 0.00 0.00 0.00 3.36
3284 3343 0.845102 TTTCCCCCACCCTCTCCTTC 60.845 60.000 0.00 0.00 0.00 3.46
3285 3344 2.692741 CCCCCACCCTCTCCTTCC 60.693 72.222 0.00 0.00 0.00 3.46
3286 3345 2.456840 CCCCACCCTCTCCTTCCT 59.543 66.667 0.00 0.00 0.00 3.36
3287 3346 1.229984 CCCCACCCTCTCCTTCCTT 60.230 63.158 0.00 0.00 0.00 3.36
3288 3347 1.275421 CCCCACCCTCTCCTTCCTTC 61.275 65.000 0.00 0.00 0.00 3.46
3289 3348 0.252927 CCCACCCTCTCCTTCCTTCT 60.253 60.000 0.00 0.00 0.00 2.85
3290 3349 0.908198 CCACCCTCTCCTTCCTTCTG 59.092 60.000 0.00 0.00 0.00 3.02
3291 3350 0.251634 CACCCTCTCCTTCCTTCTGC 59.748 60.000 0.00 0.00 0.00 4.26
3292 3351 0.118144 ACCCTCTCCTTCCTTCTGCT 59.882 55.000 0.00 0.00 0.00 4.24
3293 3352 0.540923 CCCTCTCCTTCCTTCTGCTG 59.459 60.000 0.00 0.00 0.00 4.41
3294 3353 0.107752 CCTCTCCTTCCTTCTGCTGC 60.108 60.000 0.00 0.00 0.00 5.25
3295 3354 0.903942 CTCTCCTTCCTTCTGCTGCT 59.096 55.000 0.00 0.00 0.00 4.24
3296 3355 0.612229 TCTCCTTCCTTCTGCTGCTG 59.388 55.000 0.00 0.00 0.00 4.41
3297 3356 0.612229 CTCCTTCCTTCTGCTGCTGA 59.388 55.000 5.03 5.03 0.00 4.26
3298 3357 0.322975 TCCTTCCTTCTGCTGCTGAC 59.677 55.000 8.84 0.00 0.00 3.51
3299 3358 0.035881 CCTTCCTTCTGCTGCTGACA 59.964 55.000 8.84 0.84 0.00 3.58
3300 3359 1.155042 CTTCCTTCTGCTGCTGACAC 58.845 55.000 8.84 0.00 0.00 3.67
3301 3360 0.469494 TTCCTTCTGCTGCTGACACA 59.531 50.000 8.84 0.00 0.00 3.72
3302 3361 0.689055 TCCTTCTGCTGCTGACACAT 59.311 50.000 8.84 0.00 0.00 3.21
3303 3362 0.803117 CCTTCTGCTGCTGACACATG 59.197 55.000 8.84 0.00 0.00 3.21
3304 3363 0.803117 CTTCTGCTGCTGACACATGG 59.197 55.000 8.84 0.00 0.00 3.66
3305 3364 0.397564 TTCTGCTGCTGACACATGGA 59.602 50.000 8.84 0.00 0.00 3.41
3306 3365 0.397564 TCTGCTGCTGACACATGGAA 59.602 50.000 5.03 0.00 0.00 3.53
3307 3366 0.520404 CTGCTGCTGACACATGGAAC 59.480 55.000 0.00 0.00 0.00 3.62
3308 3367 0.890542 TGCTGCTGACACATGGAACC 60.891 55.000 0.00 0.00 0.00 3.62
3309 3368 1.915614 GCTGCTGACACATGGAACCG 61.916 60.000 0.00 0.00 0.00 4.44
3310 3369 0.603707 CTGCTGACACATGGAACCGT 60.604 55.000 0.00 0.00 0.00 4.83
3311 3370 0.602638 TGCTGACACATGGAACCGTC 60.603 55.000 0.00 0.00 0.00 4.79
3312 3371 1.626654 GCTGACACATGGAACCGTCG 61.627 60.000 0.00 0.00 0.00 5.12
3313 3372 1.005512 TGACACATGGAACCGTCGG 60.006 57.895 10.48 10.48 0.00 4.79
3314 3373 1.290955 GACACATGGAACCGTCGGA 59.709 57.895 20.51 0.00 0.00 4.55
3315 3374 0.736325 GACACATGGAACCGTCGGAG 60.736 60.000 20.51 2.85 0.00 4.63
3316 3375 1.183030 ACACATGGAACCGTCGGAGA 61.183 55.000 20.51 0.00 0.00 3.71
3317 3376 0.037697 CACATGGAACCGTCGGAGAA 60.038 55.000 20.51 0.37 39.69 2.87
3318 3377 0.037605 ACATGGAACCGTCGGAGAAC 60.038 55.000 20.51 5.69 39.69 3.01
3319 3378 0.739813 CATGGAACCGTCGGAGAACC 60.740 60.000 20.51 14.77 39.69 3.62
3320 3379 0.903454 ATGGAACCGTCGGAGAACCT 60.903 55.000 20.51 0.00 39.69 3.50
3321 3380 0.251297 TGGAACCGTCGGAGAACCTA 60.251 55.000 20.51 4.12 39.69 3.08
3322 3381 1.109609 GGAACCGTCGGAGAACCTAT 58.890 55.000 20.51 0.00 39.69 2.57
3323 3382 1.066757 GGAACCGTCGGAGAACCTATC 59.933 57.143 20.51 2.86 39.69 2.08
3324 3383 0.737219 AACCGTCGGAGAACCTATCG 59.263 55.000 20.51 0.00 39.69 2.92
3325 3384 1.099879 ACCGTCGGAGAACCTATCGG 61.100 60.000 20.51 0.00 39.69 4.18
3326 3385 0.816825 CCGTCGGAGAACCTATCGGA 60.817 60.000 4.91 0.00 39.69 4.55
3327 3386 0.587285 CGTCGGAGAACCTATCGGAG 59.413 60.000 0.00 0.00 39.69 4.63
3328 3387 1.809271 CGTCGGAGAACCTATCGGAGA 60.809 57.143 0.00 0.00 39.69 3.71
3329 3388 2.506444 GTCGGAGAACCTATCGGAGAT 58.494 52.381 0.00 0.00 39.88 2.75
3330 3389 2.226912 GTCGGAGAACCTATCGGAGATG 59.773 54.545 0.00 0.00 39.88 2.90
3331 3390 1.542030 CGGAGAACCTATCGGAGATGG 59.458 57.143 0.00 0.00 45.12 3.51
3332 3391 2.814469 CGGAGAACCTATCGGAGATGGA 60.814 54.545 0.00 0.00 45.12 3.41
3333 3392 2.823154 GGAGAACCTATCGGAGATGGAG 59.177 54.545 0.00 0.00 45.12 3.86
3334 3393 2.230266 GAGAACCTATCGGAGATGGAGC 59.770 54.545 0.00 0.00 45.12 4.70
3335 3394 2.158385 AGAACCTATCGGAGATGGAGCT 60.158 50.000 0.00 0.00 45.12 4.09
3336 3395 1.626686 ACCTATCGGAGATGGAGCTG 58.373 55.000 0.00 0.00 45.12 4.24
3337 3396 0.894141 CCTATCGGAGATGGAGCTGG 59.106 60.000 0.00 0.00 45.12 4.85
3338 3397 1.626686 CTATCGGAGATGGAGCTGGT 58.373 55.000 0.00 0.00 45.12 4.00
3339 3398 1.271934 CTATCGGAGATGGAGCTGGTG 59.728 57.143 0.00 0.00 45.12 4.17
3340 3399 1.406065 ATCGGAGATGGAGCTGGTGG 61.406 60.000 0.00 0.00 45.12 4.61
3341 3400 2.060383 CGGAGATGGAGCTGGTGGA 61.060 63.158 0.00 0.00 0.00 4.02
3342 3401 1.828768 GGAGATGGAGCTGGTGGAG 59.171 63.158 0.00 0.00 0.00 3.86
3343 3402 1.694133 GGAGATGGAGCTGGTGGAGG 61.694 65.000 0.00 0.00 0.00 4.30
3344 3403 0.980231 GAGATGGAGCTGGTGGAGGT 60.980 60.000 0.00 0.00 34.09 3.85
3345 3404 1.222936 GATGGAGCTGGTGGAGGTG 59.777 63.158 0.00 0.00 30.42 4.00
3346 3405 2.883267 GATGGAGCTGGTGGAGGTGC 62.883 65.000 0.00 0.00 40.75 5.01
3347 3406 4.416738 GGAGCTGGTGGAGGTGCC 62.417 72.222 0.00 0.00 34.59 5.01
3348 3407 4.767255 GAGCTGGTGGAGGTGCCG 62.767 72.222 0.00 0.00 40.66 5.69
3350 3409 4.329545 GCTGGTGGAGGTGCCGAA 62.330 66.667 0.00 0.00 40.66 4.30
3351 3410 2.046892 CTGGTGGAGGTGCCGAAG 60.047 66.667 0.00 0.00 40.66 3.79
3366 3425 2.726555 CGAAGGATTTGAGCATGACG 57.273 50.000 0.00 0.00 0.00 4.35
3367 3426 1.267732 CGAAGGATTTGAGCATGACGC 60.268 52.381 0.00 0.00 42.91 5.19
3376 3435 2.434185 GCATGACGCTCACCCGAA 60.434 61.111 0.00 0.00 37.77 4.30
3377 3436 2.032634 GCATGACGCTCACCCGAAA 61.033 57.895 0.00 0.00 37.77 3.46
3378 3437 1.970917 GCATGACGCTCACCCGAAAG 61.971 60.000 0.00 0.00 37.77 2.62
3379 3438 0.389817 CATGACGCTCACCCGAAAGA 60.390 55.000 0.00 0.00 0.00 2.52
3380 3439 0.537188 ATGACGCTCACCCGAAAGAT 59.463 50.000 0.00 0.00 0.00 2.40
3381 3440 0.108804 TGACGCTCACCCGAAAGATC 60.109 55.000 0.00 0.00 0.00 2.75
3382 3441 0.108804 GACGCTCACCCGAAAGATCA 60.109 55.000 0.00 0.00 0.00 2.92
3383 3442 0.108615 ACGCTCACCCGAAAGATCAG 60.109 55.000 0.00 0.00 0.00 2.90
3384 3443 1.424493 CGCTCACCCGAAAGATCAGC 61.424 60.000 0.00 0.00 0.00 4.26
3385 3444 0.107945 GCTCACCCGAAAGATCAGCT 60.108 55.000 0.00 0.00 0.00 4.24
3386 3445 1.933247 CTCACCCGAAAGATCAGCTC 58.067 55.000 0.00 0.00 0.00 4.09
3387 3446 1.205655 CTCACCCGAAAGATCAGCTCA 59.794 52.381 0.00 0.00 0.00 4.26
3388 3447 1.623311 TCACCCGAAAGATCAGCTCAA 59.377 47.619 0.00 0.00 0.00 3.02
3389 3448 1.734465 CACCCGAAAGATCAGCTCAAC 59.266 52.381 0.00 0.00 0.00 3.18
3390 3449 1.002366 CCCGAAAGATCAGCTCAACG 58.998 55.000 0.00 0.00 0.00 4.10
3391 3450 1.404181 CCCGAAAGATCAGCTCAACGA 60.404 52.381 0.00 0.00 0.00 3.85
3392 3451 2.544685 CCGAAAGATCAGCTCAACGAT 58.455 47.619 0.00 0.00 0.00 3.73
3393 3452 2.283617 CCGAAAGATCAGCTCAACGATG 59.716 50.000 0.00 0.00 0.00 3.84
3394 3453 2.285486 CGAAAGATCAGCTCAACGATGC 60.285 50.000 0.00 0.00 0.00 3.91
3395 3454 1.284657 AAGATCAGCTCAACGATGCG 58.715 50.000 0.00 0.00 0.00 4.73
3396 3455 0.174389 AGATCAGCTCAACGATGCGT 59.826 50.000 0.00 0.00 43.97 5.24
3397 3456 1.405463 AGATCAGCTCAACGATGCGTA 59.595 47.619 0.00 0.00 39.99 4.42
3398 3457 2.159240 AGATCAGCTCAACGATGCGTAA 60.159 45.455 0.00 0.00 39.99 3.18
3399 3458 2.073117 TCAGCTCAACGATGCGTAAA 57.927 45.000 0.00 0.00 39.99 2.01
3400 3459 1.724623 TCAGCTCAACGATGCGTAAAC 59.275 47.619 0.00 0.00 39.99 2.01
3401 3460 1.726791 CAGCTCAACGATGCGTAAACT 59.273 47.619 0.00 0.00 39.99 2.66
3402 3461 1.993370 AGCTCAACGATGCGTAAACTC 59.007 47.619 0.00 0.00 39.99 3.01
3403 3462 1.724623 GCTCAACGATGCGTAAACTCA 59.275 47.619 0.00 0.00 39.99 3.41
3404 3463 2.472397 GCTCAACGATGCGTAAACTCAC 60.472 50.000 0.00 0.00 39.99 3.51
3405 3464 2.063266 TCAACGATGCGTAAACTCACC 58.937 47.619 0.00 0.00 39.99 4.02
3406 3465 1.795872 CAACGATGCGTAAACTCACCA 59.204 47.619 0.00 0.00 39.99 4.17
3407 3466 1.425412 ACGATGCGTAAACTCACCAC 58.575 50.000 0.00 0.00 38.73 4.16
3408 3467 0.365523 CGATGCGTAAACTCACCACG 59.634 55.000 0.00 0.00 38.66 4.94
3409 3468 1.425412 GATGCGTAAACTCACCACGT 58.575 50.000 0.00 0.00 37.95 4.49
3410 3469 1.389106 GATGCGTAAACTCACCACGTC 59.611 52.381 0.00 0.00 37.95 4.34
3411 3470 0.102663 TGCGTAAACTCACCACGTCA 59.897 50.000 0.00 0.00 37.95 4.35
3412 3471 1.210870 GCGTAAACTCACCACGTCAA 58.789 50.000 0.00 0.00 37.95 3.18
3413 3472 1.593933 GCGTAAACTCACCACGTCAAA 59.406 47.619 0.00 0.00 37.95 2.69
3414 3473 2.348218 GCGTAAACTCACCACGTCAAAG 60.348 50.000 0.00 0.00 37.95 2.77
3415 3474 3.117794 CGTAAACTCACCACGTCAAAGA 58.882 45.455 0.00 0.00 0.00 2.52
3416 3475 3.181774 CGTAAACTCACCACGTCAAAGAG 59.818 47.826 0.00 0.00 0.00 2.85
3417 3476 3.536956 AAACTCACCACGTCAAAGAGA 57.463 42.857 9.89 0.00 0.00 3.10
3418 3477 3.536956 AACTCACCACGTCAAAGAGAA 57.463 42.857 9.89 0.00 0.00 2.87
3419 3478 3.753294 ACTCACCACGTCAAAGAGAAT 57.247 42.857 9.89 0.00 0.00 2.40
3420 3479 3.393800 ACTCACCACGTCAAAGAGAATG 58.606 45.455 9.89 0.00 0.00 2.67
3421 3480 2.143122 TCACCACGTCAAAGAGAATGC 58.857 47.619 0.00 0.00 0.00 3.56
3422 3481 1.197721 CACCACGTCAAAGAGAATGCC 59.802 52.381 0.00 0.00 0.00 4.40
3423 3482 0.443869 CCACGTCAAAGAGAATGCCG 59.556 55.000 0.00 0.00 0.00 5.69
3424 3483 0.179215 CACGTCAAAGAGAATGCCGC 60.179 55.000 0.00 0.00 0.00 6.53
3425 3484 0.602638 ACGTCAAAGAGAATGCCGCA 60.603 50.000 0.00 0.00 0.00 5.69
3426 3485 0.516877 CGTCAAAGAGAATGCCGCAA 59.483 50.000 0.00 0.00 0.00 4.85
3427 3486 1.069296 CGTCAAAGAGAATGCCGCAAA 60.069 47.619 0.00 0.00 0.00 3.68
3428 3487 2.589014 GTCAAAGAGAATGCCGCAAAG 58.411 47.619 0.00 0.00 0.00 2.77
3429 3488 1.541147 TCAAAGAGAATGCCGCAAAGG 59.459 47.619 0.00 0.00 44.97 3.11
3430 3489 1.541147 CAAAGAGAATGCCGCAAAGGA 59.459 47.619 0.00 0.00 45.00 3.36
3431 3490 1.457346 AAGAGAATGCCGCAAAGGAG 58.543 50.000 0.00 0.00 45.00 3.69
3432 3491 0.393537 AGAGAATGCCGCAAAGGAGG 60.394 55.000 0.00 0.00 45.00 4.30
3433 3492 0.392998 GAGAATGCCGCAAAGGAGGA 60.393 55.000 0.00 0.00 45.00 3.71
3434 3493 0.393537 AGAATGCCGCAAAGGAGGAG 60.394 55.000 0.00 0.00 45.00 3.69
3435 3494 0.392998 GAATGCCGCAAAGGAGGAGA 60.393 55.000 0.00 0.00 45.00 3.71
3436 3495 0.038166 AATGCCGCAAAGGAGGAGAA 59.962 50.000 0.00 0.00 45.00 2.87
3437 3496 0.393537 ATGCCGCAAAGGAGGAGAAG 60.394 55.000 0.00 0.00 45.00 2.85
3438 3497 1.296715 GCCGCAAAGGAGGAGAAGA 59.703 57.895 0.00 0.00 45.00 2.87
3439 3498 0.107459 GCCGCAAAGGAGGAGAAGAT 60.107 55.000 0.00 0.00 45.00 2.40
3440 3499 1.946745 CCGCAAAGGAGGAGAAGATC 58.053 55.000 0.00 0.00 45.00 2.75
3441 3500 1.208052 CCGCAAAGGAGGAGAAGATCA 59.792 52.381 0.00 0.00 45.00 2.92
3442 3501 2.355108 CCGCAAAGGAGGAGAAGATCAA 60.355 50.000 0.00 0.00 45.00 2.57
3443 3502 2.935201 CGCAAAGGAGGAGAAGATCAAG 59.065 50.000 0.00 0.00 0.00 3.02
3444 3503 3.368843 CGCAAAGGAGGAGAAGATCAAGA 60.369 47.826 0.00 0.00 0.00 3.02
3445 3504 4.583871 GCAAAGGAGGAGAAGATCAAGAA 58.416 43.478 0.00 0.00 0.00 2.52
3446 3505 4.635324 GCAAAGGAGGAGAAGATCAAGAAG 59.365 45.833 0.00 0.00 0.00 2.85
3447 3506 5.802821 GCAAAGGAGGAGAAGATCAAGAAGT 60.803 44.000 0.00 0.00 0.00 3.01
3448 3507 5.419239 AAGGAGGAGAAGATCAAGAAGTG 57.581 43.478 0.00 0.00 0.00 3.16
3449 3508 3.774216 AGGAGGAGAAGATCAAGAAGTGG 59.226 47.826 0.00 0.00 0.00 4.00
3450 3509 3.517500 GGAGGAGAAGATCAAGAAGTGGT 59.482 47.826 0.00 0.00 0.00 4.16
3451 3510 4.019771 GGAGGAGAAGATCAAGAAGTGGTT 60.020 45.833 0.00 0.00 0.00 3.67
3452 3511 4.904241 AGGAGAAGATCAAGAAGTGGTTG 58.096 43.478 0.00 0.00 0.00 3.77
3453 3512 4.006319 GGAGAAGATCAAGAAGTGGTTGG 58.994 47.826 0.00 0.00 0.00 3.77
3454 3513 3.416156 AGAAGATCAAGAAGTGGTTGGC 58.584 45.455 0.00 0.00 0.00 4.52
3455 3514 2.206576 AGATCAAGAAGTGGTTGGCC 57.793 50.000 0.00 0.00 0.00 5.36
3456 3515 0.804989 GATCAAGAAGTGGTTGGCCG 59.195 55.000 0.00 0.00 37.67 6.13
3457 3516 1.244019 ATCAAGAAGTGGTTGGCCGC 61.244 55.000 0.00 0.00 45.35 6.53
3458 3517 2.597510 AAGAAGTGGTTGGCCGCC 60.598 61.111 1.04 1.04 46.14 6.13
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 0.816825 CGGAAGGCACCTCCATGATG 60.817 60.000 0.00 0.00 37.29 3.07
1 2 0.982852 TCGGAAGGCACCTCCATGAT 60.983 55.000 0.00 0.00 37.29 2.45
5 6 3.706373 GCTCGGAAGGCACCTCCA 61.706 66.667 0.00 0.00 37.29 3.86
6 7 4.475135 GGCTCGGAAGGCACCTCC 62.475 72.222 0.00 0.00 46.99 4.30
13 14 1.377333 GGAACCAAGGCTCGGAAGG 60.377 63.158 0.00 0.00 0.00 3.46
14 15 0.250727 TTGGAACCAAGGCTCGGAAG 60.251 55.000 0.00 0.00 0.00 3.46
15 16 0.404040 ATTGGAACCAAGGCTCGGAA 59.596 50.000 11.88 0.00 39.47 4.30
16 17 0.322456 CATTGGAACCAAGGCTCGGA 60.322 55.000 11.88 0.00 39.47 4.55
17 18 0.609131 ACATTGGAACCAAGGCTCGG 60.609 55.000 16.42 0.00 40.83 4.63
18 19 0.523072 CACATTGGAACCAAGGCTCG 59.477 55.000 16.42 3.92 40.83 5.03
19 20 0.890683 CCACATTGGAACCAAGGCTC 59.109 55.000 16.42 0.00 40.96 4.70
20 21 0.188342 ACCACATTGGAACCAAGGCT 59.812 50.000 16.42 3.53 40.96 4.58
21 22 1.047801 AACCACATTGGAACCAAGGC 58.952 50.000 16.42 0.00 40.96 4.35
22 23 2.035832 GACAACCACATTGGAACCAAGG 59.964 50.000 15.19 15.19 40.96 3.61
23 24 2.287547 CGACAACCACATTGGAACCAAG 60.288 50.000 11.88 6.88 40.96 3.61
24 25 1.678627 CGACAACCACATTGGAACCAA 59.321 47.619 8.75 8.75 40.96 3.67
25 26 1.313772 CGACAACCACATTGGAACCA 58.686 50.000 0.00 0.00 40.96 3.67
26 27 0.596082 CCGACAACCACATTGGAACC 59.404 55.000 0.00 0.00 40.96 3.62
27 28 1.600023 TCCGACAACCACATTGGAAC 58.400 50.000 0.00 0.00 40.96 3.62
28 29 2.350057 TTCCGACAACCACATTGGAA 57.650 45.000 0.00 0.00 40.96 3.53
29 30 1.950909 GTTTCCGACAACCACATTGGA 59.049 47.619 0.00 0.00 40.96 3.53
30 31 1.000717 GGTTTCCGACAACCACATTGG 60.001 52.381 10.05 0.00 45.12 3.16
31 32 2.415697 GGTTTCCGACAACCACATTG 57.584 50.000 10.05 0.00 45.12 2.82
37 38 0.949397 GACCAAGGTTTCCGACAACC 59.051 55.000 7.46 7.46 46.02 3.77
38 39 1.871676 GAGACCAAGGTTTCCGACAAC 59.128 52.381 0.00 0.00 0.00 3.32
39 40 1.539496 CGAGACCAAGGTTTCCGACAA 60.539 52.381 4.40 0.00 0.00 3.18
40 41 0.032952 CGAGACCAAGGTTTCCGACA 59.967 55.000 4.40 0.00 0.00 4.35
41 42 0.316204 TCGAGACCAAGGTTTCCGAC 59.684 55.000 4.40 0.00 0.00 4.79
42 43 0.601558 CTCGAGACCAAGGTTTCCGA 59.398 55.000 6.58 7.53 0.00 4.55
43 44 0.389948 CCTCGAGACCAAGGTTTCCG 60.390 60.000 15.71 3.94 0.00 4.30
44 45 0.036294 CCCTCGAGACCAAGGTTTCC 60.036 60.000 15.71 0.00 0.00 3.13
45 46 0.685660 ACCCTCGAGACCAAGGTTTC 59.314 55.000 15.71 0.00 0.00 2.78
46 47 0.396811 CACCCTCGAGACCAAGGTTT 59.603 55.000 15.71 0.00 0.00 3.27
47 48 1.481056 CCACCCTCGAGACCAAGGTT 61.481 60.000 15.71 0.00 0.00 3.50
48 49 1.913762 CCACCCTCGAGACCAAGGT 60.914 63.158 15.71 9.39 0.00 3.50
49 50 2.982130 CCACCCTCGAGACCAAGG 59.018 66.667 15.71 8.66 0.00 3.61
50 51 2.266055 GCCACCCTCGAGACCAAG 59.734 66.667 15.71 0.00 0.00 3.61
51 52 3.691342 CGCCACCCTCGAGACCAA 61.691 66.667 15.71 0.00 0.00 3.67
76 77 3.515286 CAGCTTGCCCGATGCCAG 61.515 66.667 0.00 0.00 40.16 4.85
93 94 3.373565 CAAGAACCTTGCCGGGGC 61.374 66.667 2.18 1.86 42.35 5.80
94 95 3.373565 GCAAGAACCTTGCCGGGG 61.374 66.667 18.04 0.00 39.38 5.73
99 100 3.373565 CCCCGGCAAGAACCTTGC 61.374 66.667 19.97 19.97 44.22 4.01
100 101 3.373565 GCCCCGGCAAGAACCTTG 61.374 66.667 0.00 2.54 41.49 3.61
101 102 4.678743 GGCCCCGGCAAGAACCTT 62.679 66.667 8.23 0.00 44.11 3.50
104 105 4.397832 TACGGCCCCGGCAAGAAC 62.398 66.667 11.83 0.00 44.69 3.01
105 106 4.090588 CTACGGCCCCGGCAAGAA 62.091 66.667 11.83 0.00 44.69 2.52
107 108 4.530857 CTCTACGGCCCCGGCAAG 62.531 72.222 11.83 3.49 44.69 4.01
134 135 2.677875 CCCTGGCAAGACCCTTGC 60.678 66.667 19.97 19.97 44.22 4.01
135 136 2.036256 CCCCTGGCAAGACCCTTG 59.964 66.667 0.00 2.54 37.83 3.61
136 137 1.778383 TTCCCCTGGCAAGACCCTT 60.778 57.895 0.00 0.00 37.83 3.95
137 138 2.121506 TTCCCCTGGCAAGACCCT 60.122 61.111 0.00 0.00 37.83 4.34
138 139 2.035783 GTTCCCCTGGCAAGACCC 59.964 66.667 0.00 0.00 37.83 4.46
139 140 2.035783 GGTTCCCCTGGCAAGACC 59.964 66.667 0.00 0.00 39.84 3.85
140 141 2.035783 GGGTTCCCCTGGCAAGAC 59.964 66.667 0.00 0.00 41.34 3.01
141 142 2.451493 TGGGTTCCCCTGGCAAGA 60.451 61.111 5.34 0.00 45.70 3.02
142 143 2.283173 GTGGGTTCCCCTGGCAAG 60.283 66.667 5.34 0.00 45.70 4.01
143 144 3.909651 GGTGGGTTCCCCTGGCAA 61.910 66.667 5.34 0.00 45.70 4.52
144 145 4.938756 AGGTGGGTTCCCCTGGCA 62.939 66.667 5.34 0.00 45.70 4.92
145 146 4.048470 GAGGTGGGTTCCCCTGGC 62.048 72.222 5.34 0.00 45.70 4.85
146 147 3.717294 CGAGGTGGGTTCCCCTGG 61.717 72.222 5.34 0.00 45.70 4.45
147 148 4.410400 GCGAGGTGGGTTCCCCTG 62.410 72.222 5.34 0.00 45.70 4.45
151 152 4.097361 GAGGGCGAGGTGGGTTCC 62.097 72.222 0.00 0.00 0.00 3.62
152 153 2.593956 AAGAGGGCGAGGTGGGTTC 61.594 63.158 0.00 0.00 0.00 3.62
153 154 2.529389 AAGAGGGCGAGGTGGGTT 60.529 61.111 0.00 0.00 0.00 4.11
154 155 3.322466 CAAGAGGGCGAGGTGGGT 61.322 66.667 0.00 0.00 0.00 4.51
155 156 4.785453 GCAAGAGGGCGAGGTGGG 62.785 72.222 0.00 0.00 0.00 4.61
156 157 3.672295 GAGCAAGAGGGCGAGGTGG 62.672 68.421 0.00 0.00 39.27 4.61
157 158 2.125350 GAGCAAGAGGGCGAGGTG 60.125 66.667 0.00 0.00 39.27 4.00
158 159 1.893919 GAAGAGCAAGAGGGCGAGGT 61.894 60.000 0.00 0.00 39.27 3.85
159 160 1.153469 GAAGAGCAAGAGGGCGAGG 60.153 63.158 0.00 0.00 39.27 4.63
160 161 1.518133 CGAAGAGCAAGAGGGCGAG 60.518 63.158 0.00 0.00 39.27 5.03
161 162 2.276116 ACGAAGAGCAAGAGGGCGA 61.276 57.895 0.00 0.00 39.27 5.54
162 163 2.097038 CACGAAGAGCAAGAGGGCG 61.097 63.158 0.00 0.00 39.27 6.13
163 164 1.004440 ACACGAAGAGCAAGAGGGC 60.004 57.895 0.00 0.00 0.00 5.19
164 165 0.605589 AGACACGAAGAGCAAGAGGG 59.394 55.000 0.00 0.00 0.00 4.30
165 166 1.543802 AGAGACACGAAGAGCAAGAGG 59.456 52.381 0.00 0.00 0.00 3.69
166 167 2.030363 ACAGAGACACGAAGAGCAAGAG 60.030 50.000 0.00 0.00 0.00 2.85
167 168 1.957177 ACAGAGACACGAAGAGCAAGA 59.043 47.619 0.00 0.00 0.00 3.02
168 169 2.030363 AGACAGAGACACGAAGAGCAAG 60.030 50.000 0.00 0.00 0.00 4.01
169 170 1.957177 AGACAGAGACACGAAGAGCAA 59.043 47.619 0.00 0.00 0.00 3.91
170 171 1.610363 AGACAGAGACACGAAGAGCA 58.390 50.000 0.00 0.00 0.00 4.26
171 172 2.323959 CAAGACAGAGACACGAAGAGC 58.676 52.381 0.00 0.00 0.00 4.09
172 173 2.924454 GCCAAGACAGAGACACGAAGAG 60.924 54.545 0.00 0.00 0.00 2.85
173 174 1.000163 GCCAAGACAGAGACACGAAGA 60.000 52.381 0.00 0.00 0.00 2.87
174 175 1.423395 GCCAAGACAGAGACACGAAG 58.577 55.000 0.00 0.00 0.00 3.79
175 176 0.318699 CGCCAAGACAGAGACACGAA 60.319 55.000 0.00 0.00 0.00 3.85
176 177 1.285950 CGCCAAGACAGAGACACGA 59.714 57.895 0.00 0.00 0.00 4.35
177 178 0.597637 AACGCCAAGACAGAGACACG 60.598 55.000 0.00 0.00 0.00 4.49
178 179 0.861837 CAACGCCAAGACAGAGACAC 59.138 55.000 0.00 0.00 0.00 3.67
179 180 0.880278 GCAACGCCAAGACAGAGACA 60.880 55.000 0.00 0.00 0.00 3.41
180 181 0.601311 AGCAACGCCAAGACAGAGAC 60.601 55.000 0.00 0.00 0.00 3.36
181 182 0.106708 AAGCAACGCCAAGACAGAGA 59.893 50.000 0.00 0.00 0.00 3.10
182 183 0.947244 AAAGCAACGCCAAGACAGAG 59.053 50.000 0.00 0.00 0.00 3.35
183 184 0.662619 CAAAGCAACGCCAAGACAGA 59.337 50.000 0.00 0.00 0.00 3.41
184 185 0.662619 TCAAAGCAACGCCAAGACAG 59.337 50.000 0.00 0.00 0.00 3.51
185 186 0.380378 GTCAAAGCAACGCCAAGACA 59.620 50.000 0.00 0.00 0.00 3.41
186 187 0.317854 GGTCAAAGCAACGCCAAGAC 60.318 55.000 0.00 0.00 0.00 3.01
187 188 1.781025 CGGTCAAAGCAACGCCAAGA 61.781 55.000 0.00 0.00 0.00 3.02
188 189 1.370414 CGGTCAAAGCAACGCCAAG 60.370 57.895 0.00 0.00 0.00 3.61
189 190 2.718731 CGGTCAAAGCAACGCCAA 59.281 55.556 0.00 0.00 0.00 4.52
190 191 3.959975 GCGGTCAAAGCAACGCCA 61.960 61.111 0.00 0.00 45.70 5.69
193 194 1.370414 CAAGGCGGTCAAAGCAACG 60.370 57.895 0.00 0.00 36.08 4.10
194 195 0.594796 CACAAGGCGGTCAAAGCAAC 60.595 55.000 0.00 0.00 36.08 4.17
195 196 1.732917 CACAAGGCGGTCAAAGCAA 59.267 52.632 0.00 0.00 36.08 3.91
196 197 2.192861 CCACAAGGCGGTCAAAGCA 61.193 57.895 0.00 0.00 36.08 3.91
197 198 2.644992 CCACAAGGCGGTCAAAGC 59.355 61.111 0.00 0.00 0.00 3.51
207 208 0.035056 AGGGAATCGAAGCCACAAGG 60.035 55.000 8.89 0.00 38.23 3.61
208 209 1.089920 CAGGGAATCGAAGCCACAAG 58.910 55.000 8.89 0.00 0.00 3.16
209 210 0.960364 GCAGGGAATCGAAGCCACAA 60.960 55.000 8.89 0.00 0.00 3.33
210 211 1.377202 GCAGGGAATCGAAGCCACA 60.377 57.895 8.89 0.00 0.00 4.17
211 212 2.115291 GGCAGGGAATCGAAGCCAC 61.115 63.158 8.89 0.00 44.59 5.01
212 213 2.272146 GGCAGGGAATCGAAGCCA 59.728 61.111 8.89 0.00 44.59 4.75
213 214 2.517166 GGGCAGGGAATCGAAGCC 60.517 66.667 0.00 0.00 44.48 4.35
214 215 2.517166 GGGGCAGGGAATCGAAGC 60.517 66.667 0.00 0.00 0.00 3.86
215 216 1.153086 CAGGGGCAGGGAATCGAAG 60.153 63.158 0.00 0.00 0.00 3.79
216 217 2.998097 CAGGGGCAGGGAATCGAA 59.002 61.111 0.00 0.00 0.00 3.71
217 218 3.797353 GCAGGGGCAGGGAATCGA 61.797 66.667 0.00 0.00 40.72 3.59
218 219 4.883354 GGCAGGGGCAGGGAATCG 62.883 72.222 0.00 0.00 43.71 3.34
219 220 4.529731 GGGCAGGGGCAGGGAATC 62.530 72.222 0.00 0.00 43.71 2.52
225 226 3.711059 CTTAGCAGGGCAGGGGCAG 62.711 68.421 0.00 0.00 43.71 4.85
226 227 3.731728 CTTAGCAGGGCAGGGGCA 61.732 66.667 0.00 0.00 43.71 5.36
228 229 4.864334 CGCTTAGCAGGGCAGGGG 62.864 72.222 4.70 0.00 0.00 4.79
229 230 4.101448 ACGCTTAGCAGGGCAGGG 62.101 66.667 4.70 0.00 36.39 4.45
230 231 2.821366 CACGCTTAGCAGGGCAGG 60.821 66.667 4.70 0.00 36.39 4.85
231 232 2.821366 CCACGCTTAGCAGGGCAG 60.821 66.667 4.70 0.00 36.39 4.85
235 236 4.760047 ACGGCCACGCTTAGCAGG 62.760 66.667 2.24 6.68 46.04 4.85
236 237 3.490759 CACGGCCACGCTTAGCAG 61.491 66.667 2.24 0.00 46.04 4.24
269 270 2.332654 CCCTTACTTGTGCACGGGC 61.333 63.158 13.13 0.34 41.68 6.13
270 271 1.674322 CCCCTTACTTGTGCACGGG 60.674 63.158 16.05 16.05 0.00 5.28
271 272 0.322322 TACCCCTTACTTGTGCACGG 59.678 55.000 13.13 10.15 0.00 4.94
272 273 1.270412 TGTACCCCTTACTTGTGCACG 60.270 52.381 13.13 0.65 0.00 5.34
273 274 2.554370 TGTACCCCTTACTTGTGCAC 57.446 50.000 10.75 10.75 0.00 4.57
274 275 3.482436 CTTTGTACCCCTTACTTGTGCA 58.518 45.455 0.00 0.00 0.00 4.57
275 276 2.817844 CCTTTGTACCCCTTACTTGTGC 59.182 50.000 0.00 0.00 0.00 4.57
276 277 4.202430 ACTCCTTTGTACCCCTTACTTGTG 60.202 45.833 0.00 0.00 0.00 3.33
277 278 3.978672 ACTCCTTTGTACCCCTTACTTGT 59.021 43.478 0.00 0.00 0.00 3.16
278 279 4.324267 CACTCCTTTGTACCCCTTACTTG 58.676 47.826 0.00 0.00 0.00 3.16
279 280 3.244805 GCACTCCTTTGTACCCCTTACTT 60.245 47.826 0.00 0.00 0.00 2.24
280 281 2.305052 GCACTCCTTTGTACCCCTTACT 59.695 50.000 0.00 0.00 0.00 2.24
281 282 2.617276 GGCACTCCTTTGTACCCCTTAC 60.617 54.545 0.00 0.00 0.00 2.34
282 283 1.631898 GGCACTCCTTTGTACCCCTTA 59.368 52.381 0.00 0.00 0.00 2.69
283 284 0.404426 GGCACTCCTTTGTACCCCTT 59.596 55.000 0.00 0.00 0.00 3.95
284 285 1.498176 GGGCACTCCTTTGTACCCCT 61.498 60.000 0.00 0.00 37.52 4.79
285 286 1.001269 GGGCACTCCTTTGTACCCC 60.001 63.158 0.00 0.00 37.52 4.95
286 287 1.001269 GGGGCACTCCTTTGTACCC 60.001 63.158 0.00 0.00 41.69 3.69
287 288 0.322546 CAGGGGCACTCCTTTGTACC 60.323 60.000 0.00 0.00 34.31 3.34
288 289 0.960861 GCAGGGGCACTCCTTTGTAC 60.961 60.000 0.00 0.00 40.72 2.90
289 290 1.133809 AGCAGGGGCACTCCTTTGTA 61.134 55.000 0.00 0.00 44.61 2.41
290 291 2.011617 AAGCAGGGGCACTCCTTTGT 62.012 55.000 0.00 0.00 44.61 2.83
291 292 0.829182 AAAGCAGGGGCACTCCTTTG 60.829 55.000 4.52 0.00 44.61 2.77
292 293 0.777446 TAAAGCAGGGGCACTCCTTT 59.223 50.000 11.05 11.05 44.61 3.11
293 294 0.329596 CTAAAGCAGGGGCACTCCTT 59.670 55.000 0.00 0.00 44.61 3.36
294 295 0.842467 ACTAAAGCAGGGGCACTCCT 60.842 55.000 0.00 0.00 44.61 3.69
295 296 0.909623 TACTAAAGCAGGGGCACTCC 59.090 55.000 0.00 0.00 44.61 3.85
296 297 1.278127 TGTACTAAAGCAGGGGCACTC 59.722 52.381 0.00 0.00 44.61 3.51
297 298 1.003233 GTGTACTAAAGCAGGGGCACT 59.997 52.381 0.00 0.00 44.61 4.40
298 299 1.450025 GTGTACTAAAGCAGGGGCAC 58.550 55.000 0.00 0.00 44.61 5.01
299 300 0.326927 GGTGTACTAAAGCAGGGGCA 59.673 55.000 0.00 0.00 44.61 5.36
300 301 0.618981 AGGTGTACTAAAGCAGGGGC 59.381 55.000 0.00 0.00 41.61 5.80
301 302 1.679032 GCAGGTGTACTAAAGCAGGGG 60.679 57.143 0.00 0.00 0.00 4.79
302 303 1.003118 TGCAGGTGTACTAAAGCAGGG 59.997 52.381 0.00 0.00 0.00 4.45
303 304 2.076863 GTGCAGGTGTACTAAAGCAGG 58.923 52.381 0.00 0.00 32.03 4.85
304 305 2.076863 GGTGCAGGTGTACTAAAGCAG 58.923 52.381 0.00 0.00 32.03 4.24
305 306 1.606994 CGGTGCAGGTGTACTAAAGCA 60.607 52.381 0.00 0.00 0.00 3.91
306 307 1.076332 CGGTGCAGGTGTACTAAAGC 58.924 55.000 0.00 0.00 0.00 3.51
307 308 2.334838 GTCGGTGCAGGTGTACTAAAG 58.665 52.381 0.00 0.00 0.00 1.85
308 309 1.001181 GGTCGGTGCAGGTGTACTAAA 59.999 52.381 0.00 0.00 0.00 1.85
309 310 0.604578 GGTCGGTGCAGGTGTACTAA 59.395 55.000 0.00 0.00 0.00 2.24
310 311 0.540133 TGGTCGGTGCAGGTGTACTA 60.540 55.000 0.00 0.00 0.00 1.82
311 312 1.816863 CTGGTCGGTGCAGGTGTACT 61.817 60.000 0.00 0.00 0.00 2.73
312 313 1.374252 CTGGTCGGTGCAGGTGTAC 60.374 63.158 0.00 0.00 0.00 2.90
313 314 2.579657 CCTGGTCGGTGCAGGTGTA 61.580 63.158 0.00 0.00 0.00 2.90
314 315 3.941188 CCTGGTCGGTGCAGGTGT 61.941 66.667 0.00 0.00 0.00 4.16
322 323 1.255667 ACTTCATACGCCTGGTCGGT 61.256 55.000 13.50 4.41 34.25 4.69
323 324 0.806102 CACTTCATACGCCTGGTCGG 60.806 60.000 13.50 0.00 0.00 4.79
324 325 0.172578 TCACTTCATACGCCTGGTCG 59.827 55.000 8.60 8.60 0.00 4.79
325 326 1.641577 GTCACTTCATACGCCTGGTC 58.358 55.000 0.00 0.00 0.00 4.02
326 327 0.249398 GGTCACTTCATACGCCTGGT 59.751 55.000 0.00 0.00 0.00 4.00
327 328 0.806102 CGGTCACTTCATACGCCTGG 60.806 60.000 0.00 0.00 0.00 4.45
328 329 0.108804 ACGGTCACTTCATACGCCTG 60.109 55.000 0.00 0.00 0.00 4.85
329 330 0.172803 GACGGTCACTTCATACGCCT 59.827 55.000 2.62 0.00 0.00 5.52
330 331 0.172803 AGACGGTCACTTCATACGCC 59.827 55.000 11.27 0.00 0.00 5.68
331 332 1.269166 CAGACGGTCACTTCATACGC 58.731 55.000 11.27 0.00 0.00 4.42
332 333 1.269166 GCAGACGGTCACTTCATACG 58.731 55.000 11.27 0.00 0.00 3.06
333 334 1.067142 TGGCAGACGGTCACTTCATAC 60.067 52.381 11.27 0.00 0.00 2.39
334 335 1.262417 TGGCAGACGGTCACTTCATA 58.738 50.000 11.27 0.00 0.00 2.15
335 336 2.057830 TGGCAGACGGTCACTTCAT 58.942 52.632 11.27 0.00 0.00 2.57
336 337 3.544772 TGGCAGACGGTCACTTCA 58.455 55.556 11.27 0.53 0.00 3.02
344 345 0.171455 GACTAGACTGTGGCAGACGG 59.829 60.000 0.00 0.00 35.18 4.79
345 346 0.171455 GGACTAGACTGTGGCAGACG 59.829 60.000 0.00 0.00 35.18 4.18
346 347 1.257743 TGGACTAGACTGTGGCAGAC 58.742 55.000 0.00 0.00 35.18 3.51
347 348 2.009681 TTGGACTAGACTGTGGCAGA 57.990 50.000 0.00 0.00 35.18 4.26
348 349 3.340814 AATTGGACTAGACTGTGGCAG 57.659 47.619 0.00 0.00 37.52 4.85
349 350 3.788227 AAATTGGACTAGACTGTGGCA 57.212 42.857 0.00 0.00 0.00 4.92
350 351 9.209175 CTATATAAAATTGGACTAGACTGTGGC 57.791 37.037 0.00 0.00 0.00 5.01
351 352 9.712305 CCTATATAAAATTGGACTAGACTGTGG 57.288 37.037 0.00 0.00 0.00 4.17
391 392 5.107133 AGAACGAACGATATTTCATCCGTT 58.893 37.500 0.00 0.00 46.15 4.44
392 393 4.679662 AGAACGAACGATATTTCATCCGT 58.320 39.130 0.14 0.00 36.77 4.69
393 394 6.362551 ACATAGAACGAACGATATTTCATCCG 59.637 38.462 0.14 0.00 0.00 4.18
394 395 7.639162 ACATAGAACGAACGATATTTCATCC 57.361 36.000 0.14 0.00 0.00 3.51
404 405 9.356433 TGAACATAATTTACATAGAACGAACGA 57.644 29.630 0.14 0.00 0.00 3.85
405 406 9.961266 TTGAACATAATTTACATAGAACGAACG 57.039 29.630 0.00 0.00 0.00 3.95
424 425 8.007716 CGACGTAATTCACTTAAGTTTGAACAT 58.992 33.333 5.07 3.80 34.61 2.71
425 426 7.010367 ACGACGTAATTCACTTAAGTTTGAACA 59.990 33.333 5.07 0.00 34.61 3.18
426 427 7.317269 CACGACGTAATTCACTTAAGTTTGAAC 59.683 37.037 5.07 0.54 34.61 3.18
427 428 7.010367 ACACGACGTAATTCACTTAAGTTTGAA 59.990 33.333 5.07 8.14 33.01 2.69
428 429 6.476380 ACACGACGTAATTCACTTAAGTTTGA 59.524 34.615 5.07 0.00 33.01 2.69
429 430 6.642917 ACACGACGTAATTCACTTAAGTTTG 58.357 36.000 5.07 0.00 33.01 2.93
430 431 6.833342 ACACGACGTAATTCACTTAAGTTT 57.167 33.333 5.07 0.57 33.01 2.66
431 432 6.833342 AACACGACGTAATTCACTTAAGTT 57.167 33.333 5.07 0.00 33.01 2.66
432 433 6.833342 AAACACGACGTAATTCACTTAAGT 57.167 33.333 1.12 1.12 35.15 2.24
433 434 7.115378 AGGTAAACACGACGTAATTCACTTAAG 59.885 37.037 0.00 0.00 0.00 1.85
434 435 6.922957 AGGTAAACACGACGTAATTCACTTAA 59.077 34.615 0.00 0.00 0.00 1.85
435 436 6.363088 CAGGTAAACACGACGTAATTCACTTA 59.637 38.462 0.00 0.00 0.00 2.24
436 437 5.176223 CAGGTAAACACGACGTAATTCACTT 59.824 40.000 0.00 0.00 0.00 3.16
437 438 4.682860 CAGGTAAACACGACGTAATTCACT 59.317 41.667 0.00 0.00 0.00 3.41
438 439 4.681025 TCAGGTAAACACGACGTAATTCAC 59.319 41.667 0.00 0.00 0.00 3.18
439 440 4.869215 TCAGGTAAACACGACGTAATTCA 58.131 39.130 0.00 0.00 0.00 2.57
440 441 5.827568 TTCAGGTAAACACGACGTAATTC 57.172 39.130 0.00 0.00 0.00 2.17
441 442 6.647895 AGATTTCAGGTAAACACGACGTAATT 59.352 34.615 0.00 1.17 0.00 1.40
442 443 6.090358 CAGATTTCAGGTAAACACGACGTAAT 59.910 38.462 0.00 0.00 0.00 1.89
443 444 5.403166 CAGATTTCAGGTAAACACGACGTAA 59.597 40.000 0.00 0.00 0.00 3.18
444 445 4.919168 CAGATTTCAGGTAAACACGACGTA 59.081 41.667 0.00 0.00 0.00 3.57
445 446 3.739300 CAGATTTCAGGTAAACACGACGT 59.261 43.478 0.00 0.00 0.00 4.34
446 447 3.122948 CCAGATTTCAGGTAAACACGACG 59.877 47.826 0.00 0.00 0.00 5.12
447 448 4.062991 ACCAGATTTCAGGTAAACACGAC 58.937 43.478 0.00 0.00 33.70 4.34
448 449 4.345859 ACCAGATTTCAGGTAAACACGA 57.654 40.909 0.00 0.00 33.70 4.35
449 450 5.212194 CAAACCAGATTTCAGGTAAACACG 58.788 41.667 0.00 0.00 34.43 4.49
450 451 4.982295 GCAAACCAGATTTCAGGTAAACAC 59.018 41.667 0.00 0.00 34.43 3.32
451 452 4.892934 AGCAAACCAGATTTCAGGTAAACA 59.107 37.500 0.00 0.00 34.43 2.83
452 453 5.453567 AGCAAACCAGATTTCAGGTAAAC 57.546 39.130 0.00 0.00 34.43 2.01
453 454 7.589958 TTTAGCAAACCAGATTTCAGGTAAA 57.410 32.000 0.00 0.00 34.43 2.01
454 455 7.589958 TTTTAGCAAACCAGATTTCAGGTAA 57.410 32.000 0.00 0.00 34.43 2.85
455 456 7.775053 ATTTTAGCAAACCAGATTTCAGGTA 57.225 32.000 0.00 0.00 34.43 3.08
456 457 6.670695 ATTTTAGCAAACCAGATTTCAGGT 57.329 33.333 0.00 0.00 37.34 4.00
457 458 7.442062 ACAAATTTTAGCAAACCAGATTTCAGG 59.558 33.333 0.00 0.00 0.00 3.86
458 459 8.369218 ACAAATTTTAGCAAACCAGATTTCAG 57.631 30.769 0.00 0.00 0.00 3.02
459 460 9.995003 ATACAAATTTTAGCAAACCAGATTTCA 57.005 25.926 0.00 0.00 0.00 2.69
461 462 9.218440 CCATACAAATTTTAGCAAACCAGATTT 57.782 29.630 0.00 0.00 0.00 2.17
462 463 7.823799 CCCATACAAATTTTAGCAAACCAGATT 59.176 33.333 0.00 0.00 0.00 2.40
463 464 7.180051 TCCCATACAAATTTTAGCAAACCAGAT 59.820 33.333 0.00 0.00 0.00 2.90
464 465 6.495181 TCCCATACAAATTTTAGCAAACCAGA 59.505 34.615 0.00 0.00 0.00 3.86
465 466 6.696411 TCCCATACAAATTTTAGCAAACCAG 58.304 36.000 0.00 0.00 0.00 4.00
466 467 6.672266 TCCCATACAAATTTTAGCAAACCA 57.328 33.333 0.00 0.00 0.00 3.67
467 468 7.413988 GCATTCCCATACAAATTTTAGCAAACC 60.414 37.037 0.00 0.00 0.00 3.27
468 469 7.463544 GCATTCCCATACAAATTTTAGCAAAC 58.536 34.615 0.00 0.00 0.00 2.93
469 470 6.312426 CGCATTCCCATACAAATTTTAGCAAA 59.688 34.615 0.00 0.00 0.00 3.68
470 471 5.809562 CGCATTCCCATACAAATTTTAGCAA 59.190 36.000 0.00 0.00 0.00 3.91
471 472 5.105554 ACGCATTCCCATACAAATTTTAGCA 60.106 36.000 0.00 0.00 0.00 3.49
472 473 5.231991 CACGCATTCCCATACAAATTTTAGC 59.768 40.000 0.00 0.00 0.00 3.09
473 474 6.253298 CACACGCATTCCCATACAAATTTTAG 59.747 38.462 0.00 0.00 0.00 1.85
474 475 6.071896 TCACACGCATTCCCATACAAATTTTA 60.072 34.615 0.00 0.00 0.00 1.52
475 476 4.928615 CACACGCATTCCCATACAAATTTT 59.071 37.500 0.00 0.00 0.00 1.82
476 477 4.219507 TCACACGCATTCCCATACAAATTT 59.780 37.500 0.00 0.00 0.00 1.82
477 478 3.761218 TCACACGCATTCCCATACAAATT 59.239 39.130 0.00 0.00 0.00 1.82
478 479 3.351740 TCACACGCATTCCCATACAAAT 58.648 40.909 0.00 0.00 0.00 2.32
479 480 2.746904 CTCACACGCATTCCCATACAAA 59.253 45.455 0.00 0.00 0.00 2.83
480 481 2.355197 CTCACACGCATTCCCATACAA 58.645 47.619 0.00 0.00 0.00 2.41
481 482 2.011548 GCTCACACGCATTCCCATACA 61.012 52.381 0.00 0.00 0.00 2.29
482 483 0.657840 GCTCACACGCATTCCCATAC 59.342 55.000 0.00 0.00 0.00 2.39
483 484 0.251634 TGCTCACACGCATTCCCATA 59.748 50.000 0.00 0.00 34.44 2.74
484 485 1.002257 TGCTCACACGCATTCCCAT 60.002 52.632 0.00 0.00 34.44 4.00
485 486 1.965930 GTGCTCACACGCATTCCCA 60.966 57.895 0.00 0.00 42.62 4.37
486 487 2.870372 GTGCTCACACGCATTCCC 59.130 61.111 0.00 0.00 42.62 3.97
494 495 2.860735 GACCATCTAATCGTGCTCACAC 59.139 50.000 0.69 0.00 43.76 3.82
495 496 2.479560 CGACCATCTAATCGTGCTCACA 60.480 50.000 0.69 0.00 33.63 3.58
496 497 2.120232 CGACCATCTAATCGTGCTCAC 58.880 52.381 0.00 0.00 33.63 3.51
497 498 1.067060 CCGACCATCTAATCGTGCTCA 59.933 52.381 0.00 0.00 36.60 4.26
498 499 1.772182 CCGACCATCTAATCGTGCTC 58.228 55.000 0.00 0.00 36.60 4.26
499 500 0.249489 GCCGACCATCTAATCGTGCT 60.249 55.000 0.00 0.00 36.60 4.40
500 501 0.249489 AGCCGACCATCTAATCGTGC 60.249 55.000 0.00 0.00 36.60 5.34
501 502 1.603172 GGAGCCGACCATCTAATCGTG 60.603 57.143 0.00 0.00 36.60 4.35
502 503 0.674534 GGAGCCGACCATCTAATCGT 59.325 55.000 0.00 0.00 36.60 3.73
503 504 0.038159 GGGAGCCGACCATCTAATCG 60.038 60.000 0.00 0.00 38.08 3.34
504 505 1.001406 CAGGGAGCCGACCATCTAATC 59.999 57.143 0.00 0.00 0.00 1.75
505 506 1.051812 CAGGGAGCCGACCATCTAAT 58.948 55.000 0.00 0.00 0.00 1.73
506 507 0.032515 TCAGGGAGCCGACCATCTAA 60.033 55.000 0.00 0.00 0.00 2.10
507 508 0.188587 ATCAGGGAGCCGACCATCTA 59.811 55.000 0.00 0.00 0.00 1.98
508 509 0.188587 TATCAGGGAGCCGACCATCT 59.811 55.000 0.00 0.00 0.00 2.90
509 510 1.048601 TTATCAGGGAGCCGACCATC 58.951 55.000 0.00 0.00 0.00 3.51
510 511 1.507140 TTTATCAGGGAGCCGACCAT 58.493 50.000 0.00 0.00 0.00 3.55
511 512 1.507140 ATTTATCAGGGAGCCGACCA 58.493 50.000 0.00 0.00 0.00 4.02
512 513 2.222027 CAATTTATCAGGGAGCCGACC 58.778 52.381 0.00 0.00 0.00 4.79
513 514 2.872858 GACAATTTATCAGGGAGCCGAC 59.127 50.000 0.00 0.00 0.00 4.79
514 515 2.158813 GGACAATTTATCAGGGAGCCGA 60.159 50.000 0.00 0.00 0.00 5.54
515 516 2.222027 GGACAATTTATCAGGGAGCCG 58.778 52.381 0.00 0.00 0.00 5.52
516 517 2.222027 CGGACAATTTATCAGGGAGCC 58.778 52.381 0.00 0.00 0.00 4.70
517 518 2.158813 TCCGGACAATTTATCAGGGAGC 60.159 50.000 0.00 0.00 32.76 4.70
518 519 3.467803 GTCCGGACAATTTATCAGGGAG 58.532 50.000 29.75 0.00 32.76 4.30
519 520 2.159014 CGTCCGGACAATTTATCAGGGA 60.159 50.000 32.80 0.00 32.76 4.20
520 521 2.210116 CGTCCGGACAATTTATCAGGG 58.790 52.381 32.80 9.25 32.76 4.45
521 522 1.597663 GCGTCCGGACAATTTATCAGG 59.402 52.381 32.80 14.16 33.14 3.86
522 523 1.257936 CGCGTCCGGACAATTTATCAG 59.742 52.381 32.80 14.88 0.00 2.90
523 524 1.282817 CGCGTCCGGACAATTTATCA 58.717 50.000 32.80 0.00 0.00 2.15
524 525 1.283736 ACGCGTCCGGACAATTTATC 58.716 50.000 32.80 11.70 39.22 1.75
525 526 1.662122 GAACGCGTCCGGACAATTTAT 59.338 47.619 32.80 14.16 39.22 1.40
526 527 1.070038 GAACGCGTCCGGACAATTTA 58.930 50.000 32.80 0.00 39.22 1.40
527 528 1.864176 GAACGCGTCCGGACAATTT 59.136 52.632 32.80 21.17 39.22 1.82
528 529 2.377310 CGAACGCGTCCGGACAATT 61.377 57.895 32.80 22.55 39.22 2.32
529 530 2.807895 CGAACGCGTCCGGACAAT 60.808 61.111 32.80 15.45 39.22 2.71
540 541 0.372334 ATGTATTTGTCCGCGAACGC 59.628 50.000 8.23 9.20 38.22 4.84
541 542 2.159761 ACAATGTATTTGTCCGCGAACG 60.160 45.455 8.23 0.00 45.55 3.95
542 543 3.465122 ACAATGTATTTGTCCGCGAAC 57.535 42.857 8.23 0.00 45.55 3.95
551 552 6.683715 ACCCTTAAAACGGACAATGTATTTG 58.316 36.000 0.00 0.00 41.36 2.32
552 553 6.490721 TGACCCTTAAAACGGACAATGTATTT 59.509 34.615 0.00 0.00 0.00 1.40
553 554 6.005198 TGACCCTTAAAACGGACAATGTATT 58.995 36.000 0.00 0.00 0.00 1.89
554 555 5.562635 TGACCCTTAAAACGGACAATGTAT 58.437 37.500 0.00 0.00 0.00 2.29
555 556 4.970711 TGACCCTTAAAACGGACAATGTA 58.029 39.130 0.00 0.00 0.00 2.29
556 557 3.822940 TGACCCTTAAAACGGACAATGT 58.177 40.909 0.00 0.00 0.00 2.71
557 558 4.839668 TTGACCCTTAAAACGGACAATG 57.160 40.909 0.00 0.00 30.51 2.82
558 559 4.830600 ACATTGACCCTTAAAACGGACAAT 59.169 37.500 7.37 7.37 42.62 2.71
559 560 4.208746 ACATTGACCCTTAAAACGGACAA 58.791 39.130 0.00 0.00 38.00 3.18
560 561 3.822940 ACATTGACCCTTAAAACGGACA 58.177 40.909 0.00 0.00 0.00 4.02
561 562 4.542735 CAACATTGACCCTTAAAACGGAC 58.457 43.478 0.00 0.00 0.00 4.79
562 563 3.570550 CCAACATTGACCCTTAAAACGGA 59.429 43.478 0.00 0.00 0.00 4.69
563 564 3.570550 TCCAACATTGACCCTTAAAACGG 59.429 43.478 0.00 0.00 0.00 4.44
564 565 4.839668 TCCAACATTGACCCTTAAAACG 57.160 40.909 0.00 0.00 0.00 3.60
565 566 6.073276 GCATTTCCAACATTGACCCTTAAAAC 60.073 38.462 0.00 0.00 0.00 2.43
566 567 5.994668 GCATTTCCAACATTGACCCTTAAAA 59.005 36.000 0.00 0.00 0.00 1.52
567 568 5.306678 AGCATTTCCAACATTGACCCTTAAA 59.693 36.000 0.00 0.00 0.00 1.52
568 569 4.837860 AGCATTTCCAACATTGACCCTTAA 59.162 37.500 0.00 0.00 0.00 1.85
569 570 4.415596 AGCATTTCCAACATTGACCCTTA 58.584 39.130 0.00 0.00 0.00 2.69
570 571 3.242011 AGCATTTCCAACATTGACCCTT 58.758 40.909 0.00 0.00 0.00 3.95
571 572 2.827921 GAGCATTTCCAACATTGACCCT 59.172 45.455 0.00 0.00 0.00 4.34
572 573 2.827921 AGAGCATTTCCAACATTGACCC 59.172 45.455 0.00 0.00 0.00 4.46
573 574 4.525912 AAGAGCATTTCCAACATTGACC 57.474 40.909 0.00 0.00 0.00 4.02
574 575 6.624423 ACATAAGAGCATTTCCAACATTGAC 58.376 36.000 0.00 0.00 0.00 3.18
575 576 6.127647 GGACATAAGAGCATTTCCAACATTGA 60.128 38.462 0.00 0.00 0.00 2.57
576 577 6.038356 GGACATAAGAGCATTTCCAACATTG 58.962 40.000 0.00 0.00 0.00 2.82
577 578 5.716228 TGGACATAAGAGCATTTCCAACATT 59.284 36.000 0.00 0.00 32.96 2.71
578 579 5.126061 GTGGACATAAGAGCATTTCCAACAT 59.874 40.000 0.00 0.00 36.71 2.71
579 580 4.458989 GTGGACATAAGAGCATTTCCAACA 59.541 41.667 0.00 0.00 36.71 3.33
580 581 4.702131 AGTGGACATAAGAGCATTTCCAAC 59.298 41.667 0.00 0.00 36.71 3.77
581 582 4.922206 AGTGGACATAAGAGCATTTCCAA 58.078 39.130 0.00 0.00 36.71 3.53
582 583 4.574674 AGTGGACATAAGAGCATTTCCA 57.425 40.909 0.00 0.00 33.37 3.53
583 584 7.573968 ATTAAGTGGACATAAGAGCATTTCC 57.426 36.000 0.00 0.00 0.00 3.13
588 589 9.679661 TCAAATTATTAAGTGGACATAAGAGCA 57.320 29.630 0.00 0.00 0.00 4.26
594 595 9.878667 TCTCGTTCAAATTATTAAGTGGACATA 57.121 29.630 3.49 0.00 0.00 2.29
595 596 8.786826 TCTCGTTCAAATTATTAAGTGGACAT 57.213 30.769 3.49 0.00 0.00 3.06
596 597 7.876068 ACTCTCGTTCAAATTATTAAGTGGACA 59.124 33.333 3.49 0.00 0.00 4.02
597 598 8.169268 CACTCTCGTTCAAATTATTAAGTGGAC 58.831 37.037 0.00 0.00 0.00 4.02
598 599 7.148474 GCACTCTCGTTCAAATTATTAAGTGGA 60.148 37.037 0.00 0.00 32.94 4.02
599 600 6.961554 GCACTCTCGTTCAAATTATTAAGTGG 59.038 38.462 0.00 0.00 32.94 4.00
600 601 7.743104 AGCACTCTCGTTCAAATTATTAAGTG 58.257 34.615 0.00 0.00 34.87 3.16
601 602 7.064728 GGAGCACTCTCGTTCAAATTATTAAGT 59.935 37.037 0.00 0.00 40.26 2.24
602 603 7.278868 AGGAGCACTCTCGTTCAAATTATTAAG 59.721 37.037 0.00 0.00 40.26 1.85
603 604 7.064609 CAGGAGCACTCTCGTTCAAATTATTAA 59.935 37.037 0.00 0.00 40.26 1.40
604 605 6.535150 CAGGAGCACTCTCGTTCAAATTATTA 59.465 38.462 0.00 0.00 40.26 0.98
605 606 5.352569 CAGGAGCACTCTCGTTCAAATTATT 59.647 40.000 0.00 0.00 40.26 1.40
606 607 4.872691 CAGGAGCACTCTCGTTCAAATTAT 59.127 41.667 0.00 0.00 40.26 1.28
607 608 4.245660 CAGGAGCACTCTCGTTCAAATTA 58.754 43.478 0.00 0.00 40.26 1.40
608 609 3.070018 CAGGAGCACTCTCGTTCAAATT 58.930 45.455 0.00 0.00 40.26 1.82
609 610 2.693069 CAGGAGCACTCTCGTTCAAAT 58.307 47.619 0.00 0.00 40.26 2.32
610 611 1.873903 GCAGGAGCACTCTCGTTCAAA 60.874 52.381 0.00 0.00 40.26 2.69
611 612 0.319900 GCAGGAGCACTCTCGTTCAA 60.320 55.000 0.00 0.00 40.26 2.69
612 613 1.290324 GCAGGAGCACTCTCGTTCA 59.710 57.895 0.00 0.00 40.26 3.18
613 614 4.177229 GCAGGAGCACTCTCGTTC 57.823 61.111 0.00 0.00 40.26 3.95
623 624 2.923121 TCCACATTAAGATGCAGGAGC 58.077 47.619 0.00 0.00 36.44 4.70
624 625 5.183713 TGTTTTCCACATTAAGATGCAGGAG 59.816 40.000 0.00 0.00 40.05 3.69
625 626 5.076182 TGTTTTCCACATTAAGATGCAGGA 58.924 37.500 0.00 0.00 38.35 3.86
626 627 5.389859 TGTTTTCCACATTAAGATGCAGG 57.610 39.130 0.00 0.00 36.72 4.85
627 628 5.808540 CCATGTTTTCCACATTAAGATGCAG 59.191 40.000 0.00 0.00 44.40 4.41
628 629 5.337410 CCCATGTTTTCCACATTAAGATGCA 60.337 40.000 0.00 0.00 44.40 3.96
629 630 5.111293 CCCATGTTTTCCACATTAAGATGC 58.889 41.667 0.00 0.00 44.40 3.91
630 631 5.187576 ACCCCATGTTTTCCACATTAAGATG 59.812 40.000 0.00 0.00 44.40 2.90
631 632 5.341169 ACCCCATGTTTTCCACATTAAGAT 58.659 37.500 0.00 0.00 44.40 2.40
632 633 4.746466 ACCCCATGTTTTCCACATTAAGA 58.254 39.130 0.00 0.00 44.40 2.10
633 634 5.478679 TGTACCCCATGTTTTCCACATTAAG 59.521 40.000 0.00 0.00 44.40 1.85
634 635 5.394738 TGTACCCCATGTTTTCCACATTAA 58.605 37.500 0.00 0.00 44.40 1.40
635 636 4.999310 TGTACCCCATGTTTTCCACATTA 58.001 39.130 0.00 0.00 44.40 1.90
636 637 3.850752 TGTACCCCATGTTTTCCACATT 58.149 40.909 0.00 0.00 44.40 2.71
638 639 3.181428 TGATGTACCCCATGTTTTCCACA 60.181 43.478 0.00 0.00 40.71 4.17
639 640 3.426615 TGATGTACCCCATGTTTTCCAC 58.573 45.455 0.00 0.00 32.56 4.02
640 641 3.816398 TGATGTACCCCATGTTTTCCA 57.184 42.857 0.00 0.00 32.56 3.53
641 642 5.301805 CCTAATGATGTACCCCATGTTTTCC 59.698 44.000 0.00 0.00 32.56 3.13
642 643 5.221244 GCCTAATGATGTACCCCATGTTTTC 60.221 44.000 0.00 0.00 32.56 2.29
643 644 4.649218 GCCTAATGATGTACCCCATGTTTT 59.351 41.667 0.00 0.00 32.56 2.43
644 645 4.215109 GCCTAATGATGTACCCCATGTTT 58.785 43.478 0.00 0.00 32.56 2.83
645 646 3.204158 TGCCTAATGATGTACCCCATGTT 59.796 43.478 0.00 0.00 32.56 2.71
646 647 2.782925 TGCCTAATGATGTACCCCATGT 59.217 45.455 0.00 0.00 32.56 3.21
647 648 3.415212 CTGCCTAATGATGTACCCCATG 58.585 50.000 0.00 0.00 32.56 3.66
648 649 2.224867 GCTGCCTAATGATGTACCCCAT 60.225 50.000 0.00 0.00 36.13 4.00
649 650 1.142870 GCTGCCTAATGATGTACCCCA 59.857 52.381 0.00 0.00 0.00 4.96
650 651 1.142870 TGCTGCCTAATGATGTACCCC 59.857 52.381 0.00 0.00 0.00 4.95
651 652 2.638480 TGCTGCCTAATGATGTACCC 57.362 50.000 0.00 0.00 0.00 3.69
652 653 3.743521 TCATGCTGCCTAATGATGTACC 58.256 45.455 0.00 0.00 0.00 3.34
653 654 5.954296 ATTCATGCTGCCTAATGATGTAC 57.046 39.130 0.00 0.00 33.01 2.90
654 655 9.910267 ATATTATTCATGCTGCCTAATGATGTA 57.090 29.630 0.00 0.00 33.01 2.29
655 656 8.818622 ATATTATTCATGCTGCCTAATGATGT 57.181 30.769 0.00 0.00 33.01 3.06
656 657 9.731819 GAATATTATTCATGCTGCCTAATGATG 57.268 33.333 10.84 0.00 33.01 3.07
657 658 9.696572 AGAATATTATTCATGCTGCCTAATGAT 57.303 29.630 16.68 0.00 33.01 2.45
658 659 8.953313 CAGAATATTATTCATGCTGCCTAATGA 58.047 33.333 16.68 0.00 0.00 2.57
659 660 8.737175 ACAGAATATTATTCATGCTGCCTAATG 58.263 33.333 16.68 5.97 0.00 1.90
660 661 8.737175 CACAGAATATTATTCATGCTGCCTAAT 58.263 33.333 16.68 0.00 0.00 1.73
661 662 7.938490 TCACAGAATATTATTCATGCTGCCTAA 59.062 33.333 16.68 0.00 0.00 2.69
662 663 7.452562 TCACAGAATATTATTCATGCTGCCTA 58.547 34.615 16.68 0.00 0.00 3.93
663 664 6.301486 TCACAGAATATTATTCATGCTGCCT 58.699 36.000 16.68 0.00 0.00 4.75
664 665 6.564709 TCACAGAATATTATTCATGCTGCC 57.435 37.500 16.68 0.00 0.00 4.85
678 679 9.778741 ACTTCTCAACTTGTATTTCACAGAATA 57.221 29.630 0.00 0.00 38.72 1.75
679 680 8.682936 ACTTCTCAACTTGTATTTCACAGAAT 57.317 30.769 0.00 0.00 38.72 2.40
680 681 7.226720 GGACTTCTCAACTTGTATTTCACAGAA 59.773 37.037 0.00 0.00 38.72 3.02
681 682 6.706270 GGACTTCTCAACTTGTATTTCACAGA 59.294 38.462 0.00 0.00 38.72 3.41
682 683 6.346919 CGGACTTCTCAACTTGTATTTCACAG 60.347 42.308 0.00 0.00 38.72 3.66
683 684 5.465390 CGGACTTCTCAACTTGTATTTCACA 59.535 40.000 0.00 0.00 34.51 3.58
684 685 5.614887 GCGGACTTCTCAACTTGTATTTCAC 60.615 44.000 0.00 0.00 0.00 3.18
685 686 4.451096 GCGGACTTCTCAACTTGTATTTCA 59.549 41.667 0.00 0.00 0.00 2.69
686 687 4.434330 CGCGGACTTCTCAACTTGTATTTC 60.434 45.833 0.00 0.00 0.00 2.17
687 688 3.432252 CGCGGACTTCTCAACTTGTATTT 59.568 43.478 0.00 0.00 0.00 1.40
688 689 2.993899 CGCGGACTTCTCAACTTGTATT 59.006 45.455 0.00 0.00 0.00 1.89
689 690 2.029290 ACGCGGACTTCTCAACTTGTAT 60.029 45.455 12.47 0.00 0.00 2.29
690 691 1.338973 ACGCGGACTTCTCAACTTGTA 59.661 47.619 12.47 0.00 0.00 2.41
691 692 0.104304 ACGCGGACTTCTCAACTTGT 59.896 50.000 12.47 0.00 0.00 3.16
692 693 0.508641 CACGCGGACTTCTCAACTTG 59.491 55.000 12.47 0.00 0.00 3.16
693 694 1.222115 GCACGCGGACTTCTCAACTT 61.222 55.000 12.47 0.00 0.00 2.66
694 695 1.664965 GCACGCGGACTTCTCAACT 60.665 57.895 12.47 0.00 0.00 3.16
695 696 1.495584 TTGCACGCGGACTTCTCAAC 61.496 55.000 12.47 0.00 0.00 3.18
696 697 0.812014 TTTGCACGCGGACTTCTCAA 60.812 50.000 12.47 0.44 0.00 3.02
697 698 1.221466 CTTTGCACGCGGACTTCTCA 61.221 55.000 12.47 0.00 0.00 3.27
698 699 1.222115 ACTTTGCACGCGGACTTCTC 61.222 55.000 12.47 0.00 0.00 2.87
699 700 1.222115 GACTTTGCACGCGGACTTCT 61.222 55.000 12.47 0.00 0.00 2.85
700 701 1.204312 GACTTTGCACGCGGACTTC 59.796 57.895 12.47 0.00 0.00 3.01
701 702 1.522806 TGACTTTGCACGCGGACTT 60.523 52.632 12.47 0.00 0.00 3.01
702 703 2.108157 TGACTTTGCACGCGGACT 59.892 55.556 12.47 0.00 0.00 3.85
703 704 1.841663 ATGTGACTTTGCACGCGGAC 61.842 55.000 12.47 1.50 41.63 4.79
704 705 0.319986 TATGTGACTTTGCACGCGGA 60.320 50.000 12.47 0.00 41.63 5.54
705 706 0.179225 GTATGTGACTTTGCACGCGG 60.179 55.000 12.47 0.00 41.63 6.46
706 707 0.516322 CGTATGTGACTTTGCACGCG 60.516 55.000 3.53 3.53 41.63 6.01
707 708 0.511221 ACGTATGTGACTTTGCACGC 59.489 50.000 0.00 0.00 41.63 5.34
708 709 2.727278 TGTACGTATGTGACTTTGCACG 59.273 45.455 0.00 0.00 41.63 5.34
709 710 3.122948 CCTGTACGTATGTGACTTTGCAC 59.877 47.826 0.00 0.00 39.22 4.57
710 711 3.322369 CCTGTACGTATGTGACTTTGCA 58.678 45.455 0.00 0.00 0.00 4.08
711 712 2.093783 GCCTGTACGTATGTGACTTTGC 59.906 50.000 0.00 0.00 0.00 3.68
712 713 2.344441 CGCCTGTACGTATGTGACTTTG 59.656 50.000 0.00 0.00 0.00 2.77
713 714 2.029649 ACGCCTGTACGTATGTGACTTT 60.030 45.455 0.00 0.00 46.19 2.66
714 715 1.542915 ACGCCTGTACGTATGTGACTT 59.457 47.619 0.00 0.00 46.19 3.01
715 716 1.171308 ACGCCTGTACGTATGTGACT 58.829 50.000 0.00 0.00 46.19 3.41
716 717 2.830772 TACGCCTGTACGTATGTGAC 57.169 50.000 0.00 0.00 46.19 3.67
743 744 2.688364 TAGTGCATGAGCGACGATAG 57.312 50.000 0.00 0.00 46.23 2.08
744 745 3.308530 CAATAGTGCATGAGCGACGATA 58.691 45.455 0.00 0.00 46.23 2.92
745 746 2.130395 CAATAGTGCATGAGCGACGAT 58.870 47.619 0.00 0.00 46.23 3.73
746 747 1.559831 CAATAGTGCATGAGCGACGA 58.440 50.000 0.00 0.00 46.23 4.20
757 758 7.710910 TGGAACAACGATTTTTGCAATAGTGC 61.711 38.462 8.51 8.51 44.39 4.40
758 759 5.689514 TGGAACAACGATTTTTGCAATAGTG 59.310 36.000 0.00 0.00 31.92 2.74
759 760 5.837437 TGGAACAACGATTTTTGCAATAGT 58.163 33.333 0.00 0.00 31.92 2.12
760 761 5.164061 GCTGGAACAACGATTTTTGCAATAG 60.164 40.000 0.00 0.00 38.70 1.73
761 762 4.683781 GCTGGAACAACGATTTTTGCAATA 59.316 37.500 0.00 0.00 38.70 1.90
762 763 3.494251 GCTGGAACAACGATTTTTGCAAT 59.506 39.130 0.00 0.00 38.70 3.56
763 764 2.863137 GCTGGAACAACGATTTTTGCAA 59.137 40.909 0.00 0.00 38.70 4.08
764 765 2.100584 AGCTGGAACAACGATTTTTGCA 59.899 40.909 0.00 0.00 38.70 4.08
765 766 2.742774 AGCTGGAACAACGATTTTTGC 58.257 42.857 0.00 0.00 38.70 3.68
766 767 5.356882 TCTAGCTGGAACAACGATTTTTG 57.643 39.130 0.00 0.00 38.70 2.44
767 768 5.619981 GCATCTAGCTGGAACAACGATTTTT 60.620 40.000 3.02 0.00 38.70 1.94
768 769 4.142600 GCATCTAGCTGGAACAACGATTTT 60.143 41.667 3.02 0.00 38.70 1.82
769 770 3.375299 GCATCTAGCTGGAACAACGATTT 59.625 43.478 3.02 0.00 38.70 2.17
770 771 2.939103 GCATCTAGCTGGAACAACGATT 59.061 45.455 3.02 0.00 38.70 3.34
771 772 2.555199 GCATCTAGCTGGAACAACGAT 58.445 47.619 3.02 0.00 38.70 3.73
772 773 1.405526 GGCATCTAGCTGGAACAACGA 60.406 52.381 3.02 0.00 44.79 3.85
773 774 1.009829 GGCATCTAGCTGGAACAACG 58.990 55.000 3.02 0.00 44.79 4.10
774 775 1.383523 GGGCATCTAGCTGGAACAAC 58.616 55.000 3.02 0.00 44.79 3.32
775 776 0.255890 GGGGCATCTAGCTGGAACAA 59.744 55.000 3.02 0.00 44.79 2.83
776 777 0.913934 TGGGGCATCTAGCTGGAACA 60.914 55.000 3.02 0.00 44.79 3.18
777 778 0.475906 ATGGGGCATCTAGCTGGAAC 59.524 55.000 3.02 0.00 44.79 3.62
778 779 0.767375 GATGGGGCATCTAGCTGGAA 59.233 55.000 3.02 0.00 44.79 3.53
779 780 0.400381 TGATGGGGCATCTAGCTGGA 60.400 55.000 0.82 0.82 44.79 3.86
780 781 0.036448 CTGATGGGGCATCTAGCTGG 59.964 60.000 0.00 0.00 44.79 4.85
781 782 0.605860 GCTGATGGGGCATCTAGCTG 60.606 60.000 0.00 0.00 44.79 4.24
782 783 0.767446 AGCTGATGGGGCATCTAGCT 60.767 55.000 4.30 4.30 43.36 3.32
783 784 0.110104 AAGCTGATGGGGCATCTAGC 59.890 55.000 1.76 1.76 41.06 3.42
784 785 2.611473 CGTAAGCTGATGGGGCATCTAG 60.611 54.545 0.00 0.00 41.06 2.43
785 786 1.344438 CGTAAGCTGATGGGGCATCTA 59.656 52.381 0.00 0.00 41.06 1.98
786 787 0.107456 CGTAAGCTGATGGGGCATCT 59.893 55.000 0.00 0.00 41.06 2.90
787 788 0.106708 TCGTAAGCTGATGGGGCATC 59.893 55.000 0.00 0.00 38.18 3.91
788 789 0.179045 GTCGTAAGCTGATGGGGCAT 60.179 55.000 0.00 0.00 37.18 4.40
789 790 1.220749 GTCGTAAGCTGATGGGGCA 59.779 57.895 0.00 0.00 37.18 5.36
790 791 1.883084 CGTCGTAAGCTGATGGGGC 60.883 63.158 0.00 0.00 37.18 5.80
791 792 0.108329 AACGTCGTAAGCTGATGGGG 60.108 55.000 0.00 0.00 37.18 4.96
792 793 2.190981 GTAACGTCGTAAGCTGATGGG 58.809 52.381 0.00 0.00 37.18 4.00
793 794 1.844357 CGTAACGTCGTAAGCTGATGG 59.156 52.381 0.00 0.00 37.18 3.51
794 795 2.512885 ACGTAACGTCGTAAGCTGATG 58.487 47.619 0.00 0.00 42.35 3.07
795 796 2.907910 ACGTAACGTCGTAAGCTGAT 57.092 45.000 0.00 0.00 42.35 2.90
796 797 4.340894 AATACGTAACGTCGTAAGCTGA 57.659 40.909 12.69 0.00 46.63 4.26
797 798 4.790140 AGAAATACGTAACGTCGTAAGCTG 59.210 41.667 12.69 0.00 46.63 4.24
798 799 4.974591 AGAAATACGTAACGTCGTAAGCT 58.025 39.130 12.69 8.09 46.63 3.74
799 800 4.203160 GGAGAAATACGTAACGTCGTAAGC 59.797 45.833 12.69 6.31 46.63 3.09
800 801 4.730521 GGGAGAAATACGTAACGTCGTAAG 59.269 45.833 12.69 0.00 46.63 2.34
801 802 4.155099 TGGGAGAAATACGTAACGTCGTAA 59.845 41.667 12.69 0.00 46.63 3.18
803 804 2.487762 TGGGAGAAATACGTAACGTCGT 59.512 45.455 7.48 7.48 45.97 4.34
804 805 3.135414 TGGGAGAAATACGTAACGTCG 57.865 47.619 0.00 0.00 41.54 5.12
805 806 6.211515 ACATATGGGAGAAATACGTAACGTC 58.788 40.000 7.80 0.00 41.54 4.34
806 807 6.152932 ACATATGGGAGAAATACGTAACGT 57.847 37.500 7.80 0.00 44.35 3.99
807 808 6.477688 ACAACATATGGGAGAAATACGTAACG 59.522 38.462 7.80 0.00 0.00 3.18
808 809 7.781548 ACAACATATGGGAGAAATACGTAAC 57.218 36.000 7.80 0.00 0.00 2.50
809 810 8.795842 AAACAACATATGGGAGAAATACGTAA 57.204 30.769 7.80 0.00 0.00 3.18
810 811 8.041919 TGAAACAACATATGGGAGAAATACGTA 58.958 33.333 7.80 0.00 0.00 3.57
811 812 6.882140 TGAAACAACATATGGGAGAAATACGT 59.118 34.615 7.80 0.00 0.00 3.57
812 813 7.315247 TGAAACAACATATGGGAGAAATACG 57.685 36.000 7.80 0.00 0.00 3.06
816 817 9.270640 CAAAATTGAAACAACATATGGGAGAAA 57.729 29.630 7.80 0.00 0.00 2.52
817 818 8.428063 ACAAAATTGAAACAACATATGGGAGAA 58.572 29.630 7.80 0.00 0.00 2.87
818 819 7.961351 ACAAAATTGAAACAACATATGGGAGA 58.039 30.769 7.80 0.00 0.00 3.71
819 820 7.062138 CGACAAAATTGAAACAACATATGGGAG 59.938 37.037 7.80 0.00 0.00 4.30
820 821 6.865726 CGACAAAATTGAAACAACATATGGGA 59.134 34.615 7.80 0.00 0.00 4.37
821 822 6.865726 TCGACAAAATTGAAACAACATATGGG 59.134 34.615 7.80 1.27 0.00 4.00
822 823 7.865875 TCGACAAAATTGAAACAACATATGG 57.134 32.000 7.80 0.00 0.00 2.74
823 824 8.427012 CCTTCGACAAAATTGAAACAACATATG 58.573 33.333 0.00 0.00 29.77 1.78
824 825 8.356657 TCCTTCGACAAAATTGAAACAACATAT 58.643 29.630 0.00 0.00 29.77 1.78
825 826 7.646130 GTCCTTCGACAAAATTGAAACAACATA 59.354 33.333 0.00 0.00 38.99 2.29
826 827 6.475402 GTCCTTCGACAAAATTGAAACAACAT 59.525 34.615 0.00 0.00 38.99 2.71
827 828 5.802956 GTCCTTCGACAAAATTGAAACAACA 59.197 36.000 0.00 0.00 38.99 3.33
828 829 5.802956 TGTCCTTCGACAAAATTGAAACAAC 59.197 36.000 0.00 0.00 46.09 3.32
829 830 5.955488 TGTCCTTCGACAAAATTGAAACAA 58.045 33.333 0.00 0.00 46.09 2.83
830 831 5.568685 TGTCCTTCGACAAAATTGAAACA 57.431 34.783 0.00 0.00 46.09 2.83
860 861 7.341769 TCCTTTCTTGTCCTTTTCTCATTGAAA 59.658 33.333 0.00 0.00 42.33 2.69
861 862 6.833416 TCCTTTCTTGTCCTTTTCTCATTGAA 59.167 34.615 0.00 0.00 0.00 2.69
862 863 6.364701 TCCTTTCTTGTCCTTTTCTCATTGA 58.635 36.000 0.00 0.00 0.00 2.57
863 864 6.264067 ACTCCTTTCTTGTCCTTTTCTCATTG 59.736 38.462 0.00 0.00 0.00 2.82
864 865 6.368805 ACTCCTTTCTTGTCCTTTTCTCATT 58.631 36.000 0.00 0.00 0.00 2.57
865 866 5.946486 ACTCCTTTCTTGTCCTTTTCTCAT 58.054 37.500 0.00 0.00 0.00 2.90
866 867 5.373812 ACTCCTTTCTTGTCCTTTTCTCA 57.626 39.130 0.00 0.00 0.00 3.27
867 868 5.009110 CCAACTCCTTTCTTGTCCTTTTCTC 59.991 44.000 0.00 0.00 0.00 2.87
868 869 4.889995 CCAACTCCTTTCTTGTCCTTTTCT 59.110 41.667 0.00 0.00 0.00 2.52
869 870 4.499865 GCCAACTCCTTTCTTGTCCTTTTC 60.500 45.833 0.00 0.00 0.00 2.29
870 871 3.384789 GCCAACTCCTTTCTTGTCCTTTT 59.615 43.478 0.00 0.00 0.00 2.27
871 872 2.959030 GCCAACTCCTTTCTTGTCCTTT 59.041 45.455 0.00 0.00 0.00 3.11
872 873 2.587522 GCCAACTCCTTTCTTGTCCTT 58.412 47.619 0.00 0.00 0.00 3.36
873 874 1.202940 GGCCAACTCCTTTCTTGTCCT 60.203 52.381 0.00 0.00 0.00 3.85
874 875 1.248486 GGCCAACTCCTTTCTTGTCC 58.752 55.000 0.00 0.00 0.00 4.02
875 876 1.202940 AGGGCCAACTCCTTTCTTGTC 60.203 52.381 6.18 0.00 0.00 3.18
876 877 0.853530 AGGGCCAACTCCTTTCTTGT 59.146 50.000 6.18 0.00 0.00 3.16
877 878 1.615392 CAAGGGCCAACTCCTTTCTTG 59.385 52.381 6.18 1.21 42.25 3.02
878 879 2.001076 CAAGGGCCAACTCCTTTCTT 57.999 50.000 6.18 0.00 42.25 2.52
879 880 0.540597 GCAAGGGCCAACTCCTTTCT 60.541 55.000 6.18 0.00 42.25 2.52
880 881 0.827507 TGCAAGGGCCAACTCCTTTC 60.828 55.000 6.18 0.00 42.25 2.62
881 882 1.115326 GTGCAAGGGCCAACTCCTTT 61.115 55.000 6.18 0.00 42.25 3.11
882 883 1.531602 GTGCAAGGGCCAACTCCTT 60.532 57.895 6.18 0.00 44.76 3.36
883 884 2.116125 GTGCAAGGGCCAACTCCT 59.884 61.111 6.18 0.00 40.13 3.69
884 885 2.203480 TGTGCAAGGGCCAACTCC 60.203 61.111 6.18 0.00 40.13 3.85
885 886 1.109323 AACTGTGCAAGGGCCAACTC 61.109 55.000 6.18 0.00 40.13 3.01
886 887 1.076044 AACTGTGCAAGGGCCAACT 60.076 52.632 6.18 0.00 40.13 3.16
887 888 1.067916 CAACTGTGCAAGGGCCAAC 59.932 57.895 6.18 0.00 40.13 3.77
888 889 2.132996 CCAACTGTGCAAGGGCCAA 61.133 57.895 6.18 0.00 40.13 4.52
889 890 2.521465 CCAACTGTGCAAGGGCCA 60.521 61.111 6.18 0.00 40.13 5.36
890 891 3.305516 CCCAACTGTGCAAGGGCC 61.306 66.667 0.00 0.00 40.13 5.80
891 892 2.203480 TCCCAACTGTGCAAGGGC 60.203 61.111 0.00 0.00 41.22 5.19
892 893 1.604593 CCTCCCAACTGTGCAAGGG 60.605 63.158 0.00 0.00 42.86 3.95
893 894 2.270986 GCCTCCCAACTGTGCAAGG 61.271 63.158 0.00 0.00 0.00 3.61
894 895 2.270986 GGCCTCCCAACTGTGCAAG 61.271 63.158 0.00 0.00 0.00 4.01
895 896 2.203480 GGCCTCCCAACTGTGCAA 60.203 61.111 0.00 0.00 0.00 4.08
896 897 2.296945 AAAGGCCTCCCAACTGTGCA 62.297 55.000 5.23 0.00 0.00 4.57
897 898 1.115326 AAAAGGCCTCCCAACTGTGC 61.115 55.000 5.23 0.00 0.00 4.57
898 899 2.162681 CTAAAAGGCCTCCCAACTGTG 58.837 52.381 5.23 0.00 0.00 3.66
899 900 2.062636 TCTAAAAGGCCTCCCAACTGT 58.937 47.619 5.23 0.00 0.00 3.55
900 901 2.879103 TCTAAAAGGCCTCCCAACTG 57.121 50.000 5.23 0.00 0.00 3.16
901 902 2.716969 ACTTCTAAAAGGCCTCCCAACT 59.283 45.455 5.23 0.00 36.78 3.16
902 903 3.156288 ACTTCTAAAAGGCCTCCCAAC 57.844 47.619 5.23 0.00 36.78 3.77
903 904 3.653836 TGTACTTCTAAAAGGCCTCCCAA 59.346 43.478 5.23 0.00 36.78 4.12
904 905 3.253220 TGTACTTCTAAAAGGCCTCCCA 58.747 45.455 5.23 0.00 36.78 4.37
905 906 3.875125 CTGTACTTCTAAAAGGCCTCCC 58.125 50.000 5.23 0.00 36.78 4.30
906 907 3.271729 GCTGTACTTCTAAAAGGCCTCC 58.728 50.000 5.23 0.00 36.78 4.30
907 908 3.939066 TGCTGTACTTCTAAAAGGCCTC 58.061 45.455 5.23 0.00 36.78 4.70
908 909 4.576330 ATGCTGTACTTCTAAAAGGCCT 57.424 40.909 0.00 0.00 36.78 5.19
909 910 4.700213 TGAATGCTGTACTTCTAAAAGGCC 59.300 41.667 0.00 0.00 36.78 5.19
910 911 5.412904 AGTGAATGCTGTACTTCTAAAAGGC 59.587 40.000 0.00 0.00 36.78 4.35
911 912 7.041098 ACAAGTGAATGCTGTACTTCTAAAAGG 60.041 37.037 0.00 0.00 36.78 3.11
912 913 7.865707 ACAAGTGAATGCTGTACTTCTAAAAG 58.134 34.615 0.00 0.00 38.54 2.27
913 914 7.801716 ACAAGTGAATGCTGTACTTCTAAAA 57.198 32.000 0.00 0.00 32.69 1.52
914 915 7.801716 AACAAGTGAATGCTGTACTTCTAAA 57.198 32.000 0.00 0.00 32.69 1.85
915 916 7.801716 AAACAAGTGAATGCTGTACTTCTAA 57.198 32.000 0.00 0.00 32.69 2.10
916 917 8.896320 TTAAACAAGTGAATGCTGTACTTCTA 57.104 30.769 0.00 0.00 32.69 2.10
917 918 7.801716 TTAAACAAGTGAATGCTGTACTTCT 57.198 32.000 0.00 0.00 32.69 2.85
918 919 8.850454 TTTTAAACAAGTGAATGCTGTACTTC 57.150 30.769 0.00 0.00 32.69 3.01
919 920 9.816354 ATTTTTAAACAAGTGAATGCTGTACTT 57.184 25.926 0.00 0.00 35.18 2.24
920 921 9.463443 GATTTTTAAACAAGTGAATGCTGTACT 57.537 29.630 0.00 0.00 0.00 2.73
921 922 9.463443 AGATTTTTAAACAAGTGAATGCTGTAC 57.537 29.630 0.00 0.00 0.00 2.90
922 923 9.677567 GAGATTTTTAAACAAGTGAATGCTGTA 57.322 29.630 0.00 0.00 0.00 2.74
923 924 7.653311 GGAGATTTTTAAACAAGTGAATGCTGT 59.347 33.333 0.00 0.00 0.00 4.40
924 925 7.116805 GGGAGATTTTTAAACAAGTGAATGCTG 59.883 37.037 0.00 0.00 0.00 4.41
925 926 7.154656 GGGAGATTTTTAAACAAGTGAATGCT 58.845 34.615 0.00 0.00 0.00 3.79
926 927 6.928492 TGGGAGATTTTTAAACAAGTGAATGC 59.072 34.615 0.00 0.00 0.00 3.56
927 928 7.599998 CCTGGGAGATTTTTAAACAAGTGAATG 59.400 37.037 0.00 0.00 0.00 2.67
928 929 7.670364 CCTGGGAGATTTTTAAACAAGTGAAT 58.330 34.615 0.00 0.00 0.00 2.57
929 930 6.462347 GCCTGGGAGATTTTTAAACAAGTGAA 60.462 38.462 0.00 0.00 0.00 3.18
930 931 5.010617 GCCTGGGAGATTTTTAAACAAGTGA 59.989 40.000 0.00 0.00 0.00 3.41
931 932 5.230182 GCCTGGGAGATTTTTAAACAAGTG 58.770 41.667 0.00 0.00 0.00 3.16
932 933 4.283467 GGCCTGGGAGATTTTTAAACAAGT 59.717 41.667 0.00 0.00 0.00 3.16
933 934 4.283212 TGGCCTGGGAGATTTTTAAACAAG 59.717 41.667 3.32 0.00 0.00 3.16
934 935 4.227197 TGGCCTGGGAGATTTTTAAACAA 58.773 39.130 3.32 0.00 0.00 2.83
935 936 3.850752 TGGCCTGGGAGATTTTTAAACA 58.149 40.909 3.32 0.00 0.00 2.83
936 937 5.178061 CAATGGCCTGGGAGATTTTTAAAC 58.822 41.667 3.32 0.00 0.00 2.01
937 938 4.224818 CCAATGGCCTGGGAGATTTTTAAA 59.775 41.667 3.32 0.00 32.32 1.52
938 939 3.774216 CCAATGGCCTGGGAGATTTTTAA 59.226 43.478 3.32 0.00 32.32 1.52
939 940 3.245948 ACCAATGGCCTGGGAGATTTTTA 60.246 43.478 15.16 0.00 41.16 1.52
940 941 2.190538 CCAATGGCCTGGGAGATTTTT 58.809 47.619 3.32 0.00 32.32 1.94
941 942 1.079323 ACCAATGGCCTGGGAGATTTT 59.921 47.619 15.16 0.00 41.16 1.82
942 943 0.712380 ACCAATGGCCTGGGAGATTT 59.288 50.000 15.16 0.00 41.16 2.17
943 944 0.259938 GACCAATGGCCTGGGAGATT 59.740 55.000 15.16 0.00 41.16 2.40
944 945 0.625683 AGACCAATGGCCTGGGAGAT 60.626 55.000 15.16 0.00 41.16 2.75
945 946 1.229951 AGACCAATGGCCTGGGAGA 60.230 57.895 15.16 0.00 41.16 3.71
946 947 1.225704 GAGACCAATGGCCTGGGAG 59.774 63.158 15.16 0.00 41.16 4.30
947 948 2.308722 GGAGACCAATGGCCTGGGA 61.309 63.158 15.16 0.00 41.16 4.37
948 949 2.276309 GAGGAGACCAATGGCCTGGG 62.276 65.000 15.16 10.72 41.16 4.45
949 950 1.225704 GAGGAGACCAATGGCCTGG 59.774 63.158 9.48 9.48 42.68 4.45
950 951 0.107312 CAGAGGAGACCAATGGCCTG 60.107 60.000 3.32 0.00 0.00 4.85
951 952 1.919600 GCAGAGGAGACCAATGGCCT 61.920 60.000 3.32 0.00 0.00 5.19
952 953 1.452833 GCAGAGGAGACCAATGGCC 60.453 63.158 0.00 0.00 0.00 5.36
953 954 0.106819 ATGCAGAGGAGACCAATGGC 60.107 55.000 0.00 0.00 0.00 4.40
954 955 1.676746 CATGCAGAGGAGACCAATGG 58.323 55.000 0.00 0.00 0.00 3.16
955 956 1.022735 GCATGCAGAGGAGACCAATG 58.977 55.000 14.21 0.00 0.00 2.82
956 957 0.622136 TGCATGCAGAGGAGACCAAT 59.378 50.000 18.46 0.00 0.00 3.16
957 958 0.321919 GTGCATGCAGAGGAGACCAA 60.322 55.000 23.41 0.00 0.00 3.67
958 959 1.297689 GTGCATGCAGAGGAGACCA 59.702 57.895 23.41 0.00 0.00 4.02
959 960 1.812922 CGTGCATGCAGAGGAGACC 60.813 63.158 23.41 5.54 0.00 3.85
960 961 0.173481 TACGTGCATGCAGAGGAGAC 59.827 55.000 23.41 6.37 0.00 3.36
961 962 0.894835 TTACGTGCATGCAGAGGAGA 59.105 50.000 23.41 5.65 0.00 3.71
962 963 1.394917 GTTTACGTGCATGCAGAGGAG 59.605 52.381 23.41 12.58 0.00 3.69
963 964 1.001974 AGTTTACGTGCATGCAGAGGA 59.998 47.619 23.41 12.65 0.00 3.71
969 970 1.801771 TGGTGTAGTTTACGTGCATGC 59.198 47.619 11.82 11.82 0.00 4.06
990 991 2.586425 CCTGAACTCATGTTGTTGGGT 58.414 47.619 10.54 0.00 36.39 4.51
1007 1009 1.138661 GGAGCTTGAGATCAGACCCTG 59.861 57.143 0.00 0.00 30.87 4.45
1008 1010 1.008206 AGGAGCTTGAGATCAGACCCT 59.992 52.381 0.00 0.00 30.87 4.34
1009 1011 1.412343 GAGGAGCTTGAGATCAGACCC 59.588 57.143 0.00 0.00 30.87 4.46
1015 1017 2.613133 GCAATGTGAGGAGCTTGAGATC 59.387 50.000 0.00 0.00 0.00 2.75
1025 1027 5.529581 TCGATTGTATAGCAATGTGAGGA 57.470 39.130 5.59 0.00 46.90 3.71
1031 1033 4.273235 TGGCAGTTCGATTGTATAGCAATG 59.727 41.667 5.59 0.00 46.90 2.82
1056 1058 0.748005 CAATTGGCCGGACGAGGATT 60.748 55.000 5.05 0.00 0.00 3.01
1067 1069 0.318614 CGTTGTGGTGACAATTGGCC 60.319 55.000 9.30 8.78 43.95 5.36
1110 1112 0.320073 CAAGCCATGGTGCACCTTTG 60.320 55.000 34.75 28.81 36.82 2.77
1115 1117 4.659480 CAACAAGCCATGGTGCAC 57.341 55.556 14.67 8.80 40.52 4.57
1130 1132 0.587768 CACAATCTCGTGTGCAGCAA 59.412 50.000 0.00 0.00 42.26 3.91
1170 1172 3.429547 CGACAAGAAGTAGGTGGATGAGG 60.430 52.174 0.00 0.00 0.00 3.86
1218 1220 0.831307 GACGGAGGGCAAGGTAGAAT 59.169 55.000 0.00 0.00 0.00 2.40
1230 1232 6.294620 GGAGATATACAGTTTTAGGACGGAGG 60.295 46.154 0.00 0.00 0.00 4.30
1241 1243 6.321690 AGCGTAGTCAAGGAGATATACAGTTT 59.678 38.462 0.00 0.00 0.00 2.66
1251 1253 1.257743 AGCAAGCGTAGTCAAGGAGA 58.742 50.000 0.00 0.00 0.00 3.71
1254 1256 1.079503 GGAAGCAAGCGTAGTCAAGG 58.920 55.000 0.00 0.00 0.00 3.61
1255 1257 1.795768 TGGAAGCAAGCGTAGTCAAG 58.204 50.000 0.00 0.00 0.00 3.02
1281 1283 5.596361 TGCCTTTGTGATTCTTAAGTTGGAA 59.404 36.000 1.63 0.00 0.00 3.53
1309 1311 0.734253 AGACGTTGATGCTCGAGTGC 60.734 55.000 15.13 1.33 0.00 4.40
1311 1313 1.131504 GAGAGACGTTGATGCTCGAGT 59.868 52.381 15.13 0.00 33.98 4.18
1391 1393 2.350522 GGACACATGTTTCATCGCTCT 58.649 47.619 13.73 0.00 0.00 4.09
1830 1832 3.195825 CCTTGGACCTAGAAGTCGACAAT 59.804 47.826 19.50 5.89 37.66 2.71
1885 1887 1.729131 CATTGTTTGCCGCGGTGAC 60.729 57.895 28.70 21.80 0.00 3.67
1902 1904 5.423886 TGATAAACACACCGATAAGCATCA 58.576 37.500 0.00 0.00 0.00 3.07
1904 1906 6.112734 TCTTGATAAACACACCGATAAGCAT 58.887 36.000 0.00 0.00 0.00 3.79
1911 1913 4.282449 TCTTCCTCTTGATAAACACACCGA 59.718 41.667 0.00 0.00 0.00 4.69
1948 1950 4.651962 GTCTTTAGAGAGAGCAACCCCTAT 59.348 45.833 0.00 0.00 31.07 2.57
1954 1956 6.045955 CCATAAGGTCTTTAGAGAGAGCAAC 58.954 44.000 6.82 0.00 44.50 4.17
1987 1989 4.389576 GGCCTTGAGTGCGTTGCG 62.390 66.667 0.00 0.00 0.00 4.85
1989 1991 1.164411 TATTGGCCTTGAGTGCGTTG 58.836 50.000 3.32 0.00 0.00 4.10
2015 2017 0.838987 TAGGACAAGAGGCCCGGTTT 60.839 55.000 0.00 0.00 0.00 3.27
2035 2037 2.822561 ACTTGAGAAGCTCTGATGTCGA 59.177 45.455 0.00 0.00 0.00 4.20
2068 2070 2.622436 GAGCACCTTTCTCGCTACATT 58.378 47.619 0.00 0.00 35.75 2.71
2073 2075 2.100879 AACGGAGCACCTTTCTCGCT 62.101 55.000 0.00 0.00 39.12 4.93
2093 2095 4.101585 GGATGTATGGTCTGATGTTCCTCA 59.898 45.833 0.00 0.00 0.00 3.86
2100 2102 3.137176 AGTTGGGGATGTATGGTCTGATG 59.863 47.826 0.00 0.00 0.00 3.07
2124 2126 5.201910 CAAAAATGCTCAAATGCAACACTG 58.798 37.500 0.00 0.00 46.61 3.66
2125 2127 4.260866 GCAAAAATGCTCAAATGCAACACT 60.261 37.500 0.00 0.00 46.61 3.55
2145 2147 1.543065 GCCCACCAACATGGATGCAA 61.543 55.000 2.85 0.00 43.02 4.08
2241 2243 1.463444 GTCGACTGGTTTCCAAATCGG 59.537 52.381 8.70 0.54 40.44 4.18
2262 2264 3.973206 AACTCATACCACACCGATGAA 57.027 42.857 0.00 0.00 0.00 2.57
2302 2304 5.534654 CCCTGTTACCTTTCTTCATCAAACA 59.465 40.000 0.00 0.00 0.00 2.83
2377 2379 7.334171 CACACATGAAGATGGTTCTATACACAA 59.666 37.037 0.00 0.00 33.39 3.33
2386 2388 2.489329 CACCCACACATGAAGATGGTTC 59.511 50.000 0.00 0.00 33.39 3.62
2405 2407 2.689034 AGCTAGCCCAGGGTCCAC 60.689 66.667 12.13 0.00 0.00 4.02
2430 2432 0.902531 AGATGTCCACTGGGTAACGG 59.097 55.000 0.00 0.00 34.93 4.44
2475 2477 8.941995 TGGATTATCTAGCAGTAGATGTTACT 57.058 34.615 5.89 0.00 44.42 2.24
2548 2607 9.800433 CATGGAAAGCACATTGTACATTAATAA 57.200 29.630 0.00 0.00 0.00 1.40
2549 2608 8.965819 ACATGGAAAGCACATTGTACATTAATA 58.034 29.630 0.00 0.00 0.00 0.98
2550 2609 7.839907 ACATGGAAAGCACATTGTACATTAAT 58.160 30.769 0.00 0.00 0.00 1.40
2551 2610 7.040132 TGACATGGAAAGCACATTGTACATTAA 60.040 33.333 0.00 0.00 0.00 1.40
2552 2611 6.432472 TGACATGGAAAGCACATTGTACATTA 59.568 34.615 0.00 0.00 0.00 1.90
2553 2612 5.243507 TGACATGGAAAGCACATTGTACATT 59.756 36.000 0.00 0.00 0.00 2.71
2554 2613 4.766373 TGACATGGAAAGCACATTGTACAT 59.234 37.500 0.00 0.00 0.00 2.29
2555 2614 4.140536 TGACATGGAAAGCACATTGTACA 58.859 39.130 0.00 0.00 0.00 2.90
2556 2615 4.764679 TGACATGGAAAGCACATTGTAC 57.235 40.909 0.00 0.00 0.00 2.90
2557 2616 5.781210 TTTGACATGGAAAGCACATTGTA 57.219 34.783 0.00 0.00 0.00 2.41
2558 2617 4.669206 TTTGACATGGAAAGCACATTGT 57.331 36.364 0.00 0.00 0.00 2.71
2559 2618 8.192774 ACTATATTTGACATGGAAAGCACATTG 58.807 33.333 0.00 0.00 0.00 2.82
2560 2619 8.192774 CACTATATTTGACATGGAAAGCACATT 58.807 33.333 0.00 0.00 0.00 2.71
2561 2620 7.682741 GCACTATATTTGACATGGAAAGCACAT 60.683 37.037 0.00 0.00 0.00 3.21
2562 2621 6.404623 GCACTATATTTGACATGGAAAGCACA 60.405 38.462 0.00 0.00 0.00 4.57
2563 2622 5.973565 GCACTATATTTGACATGGAAAGCAC 59.026 40.000 0.00 0.00 0.00 4.40
2564 2623 5.651576 TGCACTATATTTGACATGGAAAGCA 59.348 36.000 0.00 0.00 0.00 3.91
2565 2624 5.973565 GTGCACTATATTTGACATGGAAAGC 59.026 40.000 10.32 0.00 0.00 3.51
2566 2625 7.325660 AGTGCACTATATTTGACATGGAAAG 57.674 36.000 20.16 0.00 0.00 2.62
2567 2626 7.701539 AAGTGCACTATATTTGACATGGAAA 57.298 32.000 22.01 0.00 0.00 3.13
2568 2627 8.800370 TTAAGTGCACTATATTTGACATGGAA 57.200 30.769 22.01 0.00 0.00 3.53
2569 2628 8.800370 TTTAAGTGCACTATATTTGACATGGA 57.200 30.769 22.01 0.00 0.00 3.41
2592 2651 9.930693 TTACAAAGTTTGACTTGGTACAAATTT 57.069 25.926 22.23 0.00 42.57 1.82
2593 2652 9.930693 TTTACAAAGTTTGACTTGGTACAAATT 57.069 25.926 22.23 0.00 42.57 1.82
2594 2653 9.930693 TTTTACAAAGTTTGACTTGGTACAAAT 57.069 25.926 22.23 0.00 42.57 2.32
2595 2654 9.930693 ATTTTACAAAGTTTGACTTGGTACAAA 57.069 25.926 22.23 10.61 42.57 2.83
2596 2655 9.930693 AATTTTACAAAGTTTGACTTGGTACAA 57.069 25.926 22.23 8.04 42.57 2.41
2597 2656 9.930693 AAATTTTACAAAGTTTGACTTGGTACA 57.069 25.926 22.23 0.07 42.57 2.90
2636 2695 9.601217 GGTACTGTAAATGTTCATGTATTCTCT 57.399 33.333 0.00 0.00 0.00 3.10
2637 2696 9.378551 TGGTACTGTAAATGTTCATGTATTCTC 57.621 33.333 0.00 0.00 0.00 2.87
2638 2697 9.383519 CTGGTACTGTAAATGTTCATGTATTCT 57.616 33.333 0.00 0.00 0.00 2.40
2639 2698 9.378551 TCTGGTACTGTAAATGTTCATGTATTC 57.621 33.333 0.00 0.00 0.00 1.75
2640 2699 9.905713 ATCTGGTACTGTAAATGTTCATGTATT 57.094 29.630 0.00 0.00 0.00 1.89
2643 2702 9.330063 CATATCTGGTACTGTAAATGTTCATGT 57.670 33.333 0.00 0.00 0.00 3.21
2644 2703 8.777413 CCATATCTGGTACTGTAAATGTTCATG 58.223 37.037 0.00 0.00 37.79 3.07
2645 2704 7.939039 CCCATATCTGGTACTGTAAATGTTCAT 59.061 37.037 0.00 0.00 41.37 2.57
2646 2705 7.092623 ACCCATATCTGGTACTGTAAATGTTCA 60.093 37.037 0.00 0.00 41.37 3.18
2647 2706 7.280356 ACCCATATCTGGTACTGTAAATGTTC 58.720 38.462 0.00 0.00 41.37 3.18
2648 2707 7.208064 ACCCATATCTGGTACTGTAAATGTT 57.792 36.000 0.00 0.00 41.37 2.71
2649 2708 6.824958 ACCCATATCTGGTACTGTAAATGT 57.175 37.500 0.00 0.00 41.37 2.71
2650 2709 6.017109 GCAACCCATATCTGGTACTGTAAATG 60.017 42.308 0.00 0.00 41.37 2.32
2651 2710 6.062095 GCAACCCATATCTGGTACTGTAAAT 58.938 40.000 0.00 0.00 41.37 1.40
2652 2711 5.433526 GCAACCCATATCTGGTACTGTAAA 58.566 41.667 0.00 0.00 41.37 2.01
2653 2712 4.141574 GGCAACCCATATCTGGTACTGTAA 60.142 45.833 0.00 0.00 41.37 2.41
2654 2713 3.389983 GGCAACCCATATCTGGTACTGTA 59.610 47.826 0.00 0.00 41.37 2.74
2655 2714 2.172717 GGCAACCCATATCTGGTACTGT 59.827 50.000 0.00 0.00 41.37 3.55
2656 2715 2.439507 AGGCAACCCATATCTGGTACTG 59.560 50.000 0.00 0.00 41.37 2.74
2657 2716 2.776665 AGGCAACCCATATCTGGTACT 58.223 47.619 0.00 0.00 41.37 2.73
2658 2717 4.699925 TTAGGCAACCCATATCTGGTAC 57.300 45.455 0.00 0.00 41.37 3.34
2659 2718 5.718801 TTTTAGGCAACCCATATCTGGTA 57.281 39.130 0.00 0.00 41.37 3.25
2660 2719 4.601406 TTTTAGGCAACCCATATCTGGT 57.399 40.909 0.00 0.00 41.37 4.00
2661 2720 7.781324 ATATTTTTAGGCAACCCATATCTGG 57.219 36.000 0.00 0.00 42.73 3.86
2730 2789 9.875708 ACTATGGCCAAATCCTTACAAAATATA 57.124 29.630 10.96 0.00 0.00 0.86
2731 2790 8.782137 ACTATGGCCAAATCCTTACAAAATAT 57.218 30.769 10.96 0.00 0.00 1.28
2732 2791 8.602472 AACTATGGCCAAATCCTTACAAAATA 57.398 30.769 10.96 0.00 0.00 1.40
2733 2792 7.494922 AACTATGGCCAAATCCTTACAAAAT 57.505 32.000 10.96 0.00 0.00 1.82
2734 2793 6.926630 AACTATGGCCAAATCCTTACAAAA 57.073 33.333 10.96 0.00 0.00 2.44
2735 2794 6.926630 AAACTATGGCCAAATCCTTACAAA 57.073 33.333 10.96 0.00 0.00 2.83
2736 2795 9.875708 ATATAAACTATGGCCAAATCCTTACAA 57.124 29.630 10.96 0.00 0.00 2.41
2747 2806 9.747898 CCAACCTTTATATATAAACTATGGCCA 57.252 33.333 8.56 8.56 0.00 5.36
2748 2807 8.683615 GCCAACCTTTATATATAAACTATGGCC 58.316 37.037 28.83 20.13 39.68 5.36
2749 2808 9.462606 AGCCAACCTTTATATATAAACTATGGC 57.537 33.333 30.12 30.12 42.23 4.40
2759 2818 9.646522 ATTTGTCTTCAGCCAACCTTTATATAT 57.353 29.630 0.00 0.00 0.00 0.86
2760 2819 9.120538 GATTTGTCTTCAGCCAACCTTTATATA 57.879 33.333 0.00 0.00 0.00 0.86
2761 2820 7.836183 AGATTTGTCTTCAGCCAACCTTTATAT 59.164 33.333 0.00 0.00 0.00 0.86
2762 2821 7.175104 AGATTTGTCTTCAGCCAACCTTTATA 58.825 34.615 0.00 0.00 0.00 0.98
2763 2822 6.012745 AGATTTGTCTTCAGCCAACCTTTAT 58.987 36.000 0.00 0.00 0.00 1.40
2764 2823 5.385198 AGATTTGTCTTCAGCCAACCTTTA 58.615 37.500 0.00 0.00 0.00 1.85
2765 2824 4.218312 AGATTTGTCTTCAGCCAACCTTT 58.782 39.130 0.00 0.00 0.00 3.11
2766 2825 3.837355 AGATTTGTCTTCAGCCAACCTT 58.163 40.909 0.00 0.00 0.00 3.50
2767 2826 3.515602 AGATTTGTCTTCAGCCAACCT 57.484 42.857 0.00 0.00 0.00 3.50
2768 2827 5.904362 ATTAGATTTGTCTTCAGCCAACC 57.096 39.130 0.00 0.00 0.00 3.77
2769 2828 6.914757 GCATATTAGATTTGTCTTCAGCCAAC 59.085 38.462 0.00 0.00 0.00 3.77
2770 2829 6.602803 TGCATATTAGATTTGTCTTCAGCCAA 59.397 34.615 0.00 0.00 0.00 4.52
2771 2830 6.038603 GTGCATATTAGATTTGTCTTCAGCCA 59.961 38.462 0.00 0.00 0.00 4.75
2772 2831 6.261826 AGTGCATATTAGATTTGTCTTCAGCC 59.738 38.462 0.00 0.00 0.00 4.85
2773 2832 7.256756 AGTGCATATTAGATTTGTCTTCAGC 57.743 36.000 0.00 0.00 0.00 4.26
2788 2847 7.653713 GCTCTACGCCATAATATAGTGCATATT 59.346 37.037 0.00 0.00 41.68 1.28
2789 2848 7.148641 GCTCTACGCCATAATATAGTGCATAT 58.851 38.462 0.00 0.00 35.34 1.78
2790 2849 6.096282 TGCTCTACGCCATAATATAGTGCATA 59.904 38.462 0.00 0.00 38.53 3.14
2791 2850 5.105351 TGCTCTACGCCATAATATAGTGCAT 60.105 40.000 0.00 0.00 38.53 3.96
2792 2851 4.219725 TGCTCTACGCCATAATATAGTGCA 59.780 41.667 0.00 0.00 40.15 4.57
2793 2852 4.744570 TGCTCTACGCCATAATATAGTGC 58.255 43.478 0.00 0.00 38.05 4.40
2794 2853 8.972349 CATATTGCTCTACGCCATAATATAGTG 58.028 37.037 0.00 0.00 38.05 2.74
2795 2854 8.914011 TCATATTGCTCTACGCCATAATATAGT 58.086 33.333 0.00 0.00 38.05 2.12
2796 2855 9.920133 ATCATATTGCTCTACGCCATAATATAG 57.080 33.333 0.00 0.00 38.05 1.31
2800 2859 9.049523 CAATATCATATTGCTCTACGCCATAAT 57.950 33.333 4.41 0.00 38.05 1.28
2801 2860 8.040727 ACAATATCATATTGCTCTACGCCATAA 58.959 33.333 16.14 0.00 38.05 1.90
2802 2861 7.555965 ACAATATCATATTGCTCTACGCCATA 58.444 34.615 16.14 0.00 38.05 2.74
2803 2862 6.409704 ACAATATCATATTGCTCTACGCCAT 58.590 36.000 16.14 0.00 38.05 4.40
2804 2863 5.793817 ACAATATCATATTGCTCTACGCCA 58.206 37.500 16.14 0.00 38.05 5.69
2805 2864 9.186323 CTATACAATATCATATTGCTCTACGCC 57.814 37.037 16.14 0.00 38.05 5.68
2806 2865 9.737427 ACTATACAATATCATATTGCTCTACGC 57.263 33.333 16.14 0.00 39.77 4.42
2841 2900 8.888716 GGTTCACAACTTTTCATATTTTGGTTT 58.111 29.630 0.00 0.00 0.00 3.27
2842 2901 8.264347 AGGTTCACAACTTTTCATATTTTGGTT 58.736 29.630 0.00 0.00 0.00 3.67
2843 2902 7.791029 AGGTTCACAACTTTTCATATTTTGGT 58.209 30.769 0.00 0.00 0.00 3.67
2844 2903 8.661352 AAGGTTCACAACTTTTCATATTTTGG 57.339 30.769 0.00 0.00 0.00 3.28
2851 2910 8.931775 GTGTTTTTAAGGTTCACAACTTTTCAT 58.068 29.630 0.00 0.00 32.56 2.57
2852 2911 7.926555 TGTGTTTTTAAGGTTCACAACTTTTCA 59.073 29.630 0.00 0.00 36.34 2.69
2853 2912 8.300495 TGTGTTTTTAAGGTTCACAACTTTTC 57.700 30.769 0.00 0.00 36.34 2.29
2854 2913 8.664211 TTGTGTTTTTAAGGTTCACAACTTTT 57.336 26.923 0.00 0.00 41.77 2.27
2855 2914 8.664211 TTTGTGTTTTTAAGGTTCACAACTTT 57.336 26.923 8.23 0.00 44.71 2.66
2856 2915 8.664211 TTTTGTGTTTTTAAGGTTCACAACTT 57.336 26.923 8.23 0.00 44.71 2.66
2857 2916 7.386573 CCTTTTGTGTTTTTAAGGTTCACAACT 59.613 33.333 8.23 0.00 44.71 3.16
2858 2917 7.171848 ACCTTTTGTGTTTTTAAGGTTCACAAC 59.828 33.333 8.23 0.00 46.11 3.32
2859 2918 7.217906 ACCTTTTGTGTTTTTAAGGTTCACAA 58.782 30.769 0.00 0.00 46.11 3.33
2860 2919 6.760291 ACCTTTTGTGTTTTTAAGGTTCACA 58.240 32.000 0.00 0.00 46.11 3.58
2877 2936 6.428799 CCAATTTTGCATACACAACCTTTTG 58.571 36.000 0.00 0.00 38.83 2.44
2878 2937 5.008514 GCCAATTTTGCATACACAACCTTTT 59.991 36.000 0.00 0.00 0.00 2.27
2879 2938 4.514816 GCCAATTTTGCATACACAACCTTT 59.485 37.500 0.00 0.00 0.00 3.11
2880 2939 4.064388 GCCAATTTTGCATACACAACCTT 58.936 39.130 0.00 0.00 0.00 3.50
2881 2940 3.070734 TGCCAATTTTGCATACACAACCT 59.929 39.130 0.00 0.00 32.85 3.50
2882 2941 3.397482 TGCCAATTTTGCATACACAACC 58.603 40.909 0.00 0.00 32.85 3.77
2883 2942 5.610235 ATTGCCAATTTTGCATACACAAC 57.390 34.783 0.53 0.00 38.76 3.32
2884 2943 6.462500 AGTATTGCCAATTTTGCATACACAA 58.538 32.000 0.00 0.00 38.76 3.33
2885 2944 6.035368 AGTATTGCCAATTTTGCATACACA 57.965 33.333 0.00 0.00 38.76 3.72
2886 2945 6.966435 AAGTATTGCCAATTTTGCATACAC 57.034 33.333 0.00 0.76 38.76 2.90
2887 2946 8.473219 TGATAAGTATTGCCAATTTTGCATACA 58.527 29.630 0.00 0.00 38.76 2.29
2888 2947 8.870160 TGATAAGTATTGCCAATTTTGCATAC 57.130 30.769 0.00 5.99 38.76 2.39
2890 2949 8.967664 ATTGATAAGTATTGCCAATTTTGCAT 57.032 26.923 0.00 0.00 38.76 3.96
2891 2950 8.789825 AATTGATAAGTATTGCCAATTTTGCA 57.210 26.923 0.00 0.00 37.81 4.08
2917 2976 8.147058 TGTACTATTCGTGTAGTTACCCAAAAA 58.853 33.333 7.56 0.00 36.39 1.94
2918 2977 7.665690 TGTACTATTCGTGTAGTTACCCAAAA 58.334 34.615 7.56 0.00 36.39 2.44
2919 2978 7.225784 TGTACTATTCGTGTAGTTACCCAAA 57.774 36.000 7.56 0.00 36.39 3.28
2920 2979 6.832520 TGTACTATTCGTGTAGTTACCCAA 57.167 37.500 7.56 0.00 36.39 4.12
2921 2980 8.518430 TTATGTACTATTCGTGTAGTTACCCA 57.482 34.615 7.56 2.67 36.39 4.51
2922 2981 9.237846 GTTTATGTACTATTCGTGTAGTTACCC 57.762 37.037 7.56 0.00 36.39 3.69
2926 2985 9.918630 ACAAGTTTATGTACTATTCGTGTAGTT 57.081 29.630 7.56 0.00 36.39 2.24
2927 2986 9.565213 GACAAGTTTATGTACTATTCGTGTAGT 57.435 33.333 0.00 7.44 38.42 2.73
2928 2987 9.563898 TGACAAGTTTATGTACTATTCGTGTAG 57.436 33.333 0.00 0.00 32.57 2.74
2930 2989 8.997621 ATGACAAGTTTATGTACTATTCGTGT 57.002 30.769 0.00 0.00 32.57 4.49
2941 3000 9.905713 AACTGGACATATATGACAAGTTTATGT 57.094 29.630 23.89 9.15 41.61 2.29
2946 3005 7.993183 CCCTAAACTGGACATATATGACAAGTT 59.007 37.037 23.89 23.89 44.56 2.66
2947 3006 7.509546 CCCTAAACTGGACATATATGACAAGT 58.490 38.462 19.63 17.92 38.14 3.16
2948 3007 6.428159 GCCCTAAACTGGACATATATGACAAG 59.572 42.308 19.63 17.28 31.22 3.16
2949 3008 6.126623 TGCCCTAAACTGGACATATATGACAA 60.127 38.462 19.63 5.92 0.00 3.18
2950 3009 5.368230 TGCCCTAAACTGGACATATATGACA 59.632 40.000 19.63 15.18 0.00 3.58
2951 3010 5.865085 TGCCCTAAACTGGACATATATGAC 58.135 41.667 19.63 12.87 0.00 3.06
2952 3011 6.501805 AGATGCCCTAAACTGGACATATATGA 59.498 38.462 19.63 0.00 0.00 2.15
2953 3012 6.715280 AGATGCCCTAAACTGGACATATATG 58.285 40.000 11.29 11.29 0.00 1.78
2954 3013 6.069963 GGAGATGCCCTAAACTGGACATATAT 60.070 42.308 0.00 0.00 0.00 0.86
2955 3014 5.248477 GGAGATGCCCTAAACTGGACATATA 59.752 44.000 0.00 0.00 0.00 0.86
2956 3015 4.042187 GGAGATGCCCTAAACTGGACATAT 59.958 45.833 0.00 0.00 0.00 1.78
2957 3016 3.391296 GGAGATGCCCTAAACTGGACATA 59.609 47.826 0.00 0.00 0.00 2.29
2958 3017 2.173569 GGAGATGCCCTAAACTGGACAT 59.826 50.000 0.00 0.00 0.00 3.06
2959 3018 1.559682 GGAGATGCCCTAAACTGGACA 59.440 52.381 0.00 0.00 0.00 4.02
2960 3019 1.559682 TGGAGATGCCCTAAACTGGAC 59.440 52.381 0.00 0.00 34.97 4.02
2961 3020 1.965414 TGGAGATGCCCTAAACTGGA 58.035 50.000 0.00 0.00 34.97 3.86
2962 3021 2.806945 TTGGAGATGCCCTAAACTGG 57.193 50.000 0.00 0.00 34.97 4.00
2963 3022 2.360165 GCATTGGAGATGCCCTAAACTG 59.640 50.000 0.00 0.00 39.01 3.16
2964 3023 2.659428 GCATTGGAGATGCCCTAAACT 58.341 47.619 0.00 0.00 39.01 2.66
2972 3031 0.971959 TGGGTTGGCATTGGAGATGC 60.972 55.000 2.50 2.50 43.85 3.91
2973 3032 1.108776 CTGGGTTGGCATTGGAGATG 58.891 55.000 0.00 0.00 0.00 2.90
2974 3033 1.002069 TCTGGGTTGGCATTGGAGAT 58.998 50.000 0.00 0.00 0.00 2.75
2975 3034 0.776810 TTCTGGGTTGGCATTGGAGA 59.223 50.000 0.00 0.00 0.00 3.71
2976 3035 1.273327 GTTTCTGGGTTGGCATTGGAG 59.727 52.381 0.00 0.00 0.00 3.86
2977 3036 1.337118 GTTTCTGGGTTGGCATTGGA 58.663 50.000 0.00 0.00 0.00 3.53
2978 3037 0.321346 GGTTTCTGGGTTGGCATTGG 59.679 55.000 0.00 0.00 0.00 3.16
2979 3038 1.273327 GAGGTTTCTGGGTTGGCATTG 59.727 52.381 0.00 0.00 0.00 2.82
2980 3039 1.147817 AGAGGTTTCTGGGTTGGCATT 59.852 47.619 0.00 0.00 30.72 3.56
2981 3040 0.779997 AGAGGTTTCTGGGTTGGCAT 59.220 50.000 0.00 0.00 30.72 4.40
2982 3041 0.110486 GAGAGGTTTCTGGGTTGGCA 59.890 55.000 0.00 0.00 32.53 4.92
2983 3042 0.955919 CGAGAGGTTTCTGGGTTGGC 60.956 60.000 0.00 0.00 32.53 4.52
2984 3043 0.955919 GCGAGAGGTTTCTGGGTTGG 60.956 60.000 0.00 0.00 32.53 3.77
2985 3044 0.250295 TGCGAGAGGTTTCTGGGTTG 60.250 55.000 0.00 0.00 32.53 3.77
2986 3045 0.472471 TTGCGAGAGGTTTCTGGGTT 59.528 50.000 0.00 0.00 32.53 4.11
2987 3046 0.250338 GTTGCGAGAGGTTTCTGGGT 60.250 55.000 0.00 0.00 32.53 4.51
2988 3047 0.955919 GGTTGCGAGAGGTTTCTGGG 60.956 60.000 0.00 0.00 32.53 4.45
2989 3048 1.291877 CGGTTGCGAGAGGTTTCTGG 61.292 60.000 0.00 0.00 32.53 3.86
2990 3049 0.600255 ACGGTTGCGAGAGGTTTCTG 60.600 55.000 0.00 0.00 32.53 3.02
2991 3050 0.319641 GACGGTTGCGAGAGGTTTCT 60.320 55.000 0.00 0.00 36.01 2.52
2992 3051 1.289800 GGACGGTTGCGAGAGGTTTC 61.290 60.000 0.00 0.00 0.00 2.78
2993 3052 1.301479 GGACGGTTGCGAGAGGTTT 60.301 57.895 0.00 0.00 0.00 3.27
2994 3053 2.342648 GGACGGTTGCGAGAGGTT 59.657 61.111 0.00 0.00 0.00 3.50
2995 3054 4.052229 CGGACGGTTGCGAGAGGT 62.052 66.667 0.00 0.00 39.29 3.85
2996 3055 4.796231 CCGGACGGTTGCGAGAGG 62.796 72.222 0.00 0.00 39.29 3.69
2997 3056 3.744719 TCCGGACGGTTGCGAGAG 61.745 66.667 10.90 0.00 39.29 3.20
2998 3057 4.047059 GTCCGGACGGTTGCGAGA 62.047 66.667 20.85 0.00 39.29 4.04
3006 3065 4.430765 CTTCCACGGTCCGGACGG 62.431 72.222 33.41 33.41 37.61 4.79
3008 3067 4.754667 GGCTTCCACGGTCCGGAC 62.755 72.222 27.04 27.04 30.29 4.79
3010 3069 4.096003 ATGGCTTCCACGGTCCGG 62.096 66.667 17.28 0.00 35.80 5.14
3011 3070 2.511600 GATGGCTTCCACGGTCCG 60.512 66.667 10.48 10.48 35.80 4.79
3012 3071 2.124695 GGATGGCTTCCACGGTCC 60.125 66.667 14.15 0.00 44.74 4.46
3019 3078 3.508840 CCGCGTTGGATGGCTTCC 61.509 66.667 12.30 12.30 45.69 3.46
3020 3079 2.746277 ACCGCGTTGGATGGCTTC 60.746 61.111 4.92 0.00 42.00 3.86
3021 3080 2.746277 GACCGCGTTGGATGGCTT 60.746 61.111 4.92 0.00 42.00 4.35
3022 3081 4.778143 GGACCGCGTTGGATGGCT 62.778 66.667 4.92 0.00 42.00 4.75
3023 3082 4.778143 AGGACCGCGTTGGATGGC 62.778 66.667 4.92 0.00 42.00 4.40
3024 3083 2.233605 TACAGGACCGCGTTGGATGG 62.234 60.000 4.92 0.00 42.00 3.51
3025 3084 0.179084 ATACAGGACCGCGTTGGATG 60.179 55.000 4.92 0.00 42.00 3.51
3026 3085 0.104304 GATACAGGACCGCGTTGGAT 59.896 55.000 4.92 0.00 42.00 3.41
3027 3086 1.514087 GATACAGGACCGCGTTGGA 59.486 57.895 4.92 0.00 42.00 3.53
3028 3087 1.876714 CGATACAGGACCGCGTTGG 60.877 63.158 4.92 0.00 46.41 3.77
3029 3088 1.876714 CCGATACAGGACCGCGTTG 60.877 63.158 4.92 0.09 0.00 4.10
3030 3089 1.880819 AACCGATACAGGACCGCGTT 61.881 55.000 4.92 0.00 34.73 4.84
3031 3090 2.275547 GAACCGATACAGGACCGCGT 62.276 60.000 4.92 0.00 34.73 6.01
3032 3091 1.588139 GAACCGATACAGGACCGCG 60.588 63.158 0.00 0.00 34.73 6.46
3033 3092 1.588139 CGAACCGATACAGGACCGC 60.588 63.158 0.00 0.00 34.73 5.68
3034 3093 1.588139 GCGAACCGATACAGGACCG 60.588 63.158 0.00 0.00 34.66 4.79
3035 3094 0.108520 TTGCGAACCGATACAGGACC 60.109 55.000 0.00 0.00 34.73 4.46
3036 3095 0.997196 GTTGCGAACCGATACAGGAC 59.003 55.000 0.00 0.00 34.73 3.85
3037 3096 0.457166 CGTTGCGAACCGATACAGGA 60.457 55.000 0.00 0.00 34.73 3.86
3038 3097 1.995991 CGTTGCGAACCGATACAGG 59.004 57.895 0.00 0.00 37.30 4.00
3039 3098 1.343821 GCGTTGCGAACCGATACAG 59.656 57.895 0.00 0.00 0.00 2.74
3040 3099 3.465753 GCGTTGCGAACCGATACA 58.534 55.556 0.00 0.00 0.00 2.29
3056 3115 2.946752 GAAAACACGTCCGGACCGC 61.947 63.158 28.52 4.56 0.00 5.68
3057 3116 0.877213 AAGAAAACACGTCCGGACCG 60.877 55.000 28.52 23.77 0.00 4.79
3058 3117 1.003223 CAAAGAAAACACGTCCGGACC 60.003 52.381 28.52 12.61 0.00 4.46
3059 3118 1.003223 CCAAAGAAAACACGTCCGGAC 60.003 52.381 25.28 25.28 0.00 4.79
3060 3119 1.134461 TCCAAAGAAAACACGTCCGGA 60.134 47.619 0.00 0.00 0.00 5.14
3061 3120 1.301423 TCCAAAGAAAACACGTCCGG 58.699 50.000 0.00 0.00 0.00 5.14
3062 3121 3.408288 TTTCCAAAGAAAACACGTCCG 57.592 42.857 0.00 0.00 39.05 4.79
3071 3130 6.015010 TGTTTGTCTCCAGTTTTCCAAAGAAA 60.015 34.615 0.00 0.00 40.26 2.52
3072 3131 5.478679 TGTTTGTCTCCAGTTTTCCAAAGAA 59.521 36.000 0.00 0.00 0.00 2.52
3073 3132 5.013547 TGTTTGTCTCCAGTTTTCCAAAGA 58.986 37.500 0.00 0.00 0.00 2.52
3074 3133 5.323371 TGTTTGTCTCCAGTTTTCCAAAG 57.677 39.130 0.00 0.00 0.00 2.77
3075 3134 5.395103 CCATGTTTGTCTCCAGTTTTCCAAA 60.395 40.000 0.00 0.00 0.00 3.28
3076 3135 4.099266 CCATGTTTGTCTCCAGTTTTCCAA 59.901 41.667 0.00 0.00 0.00 3.53
3077 3136 3.636300 CCATGTTTGTCTCCAGTTTTCCA 59.364 43.478 0.00 0.00 0.00 3.53
3078 3137 3.005791 CCCATGTTTGTCTCCAGTTTTCC 59.994 47.826 0.00 0.00 0.00 3.13
3079 3138 3.005791 CCCCATGTTTGTCTCCAGTTTTC 59.994 47.826 0.00 0.00 0.00 2.29
3080 3139 2.965147 CCCCATGTTTGTCTCCAGTTTT 59.035 45.455 0.00 0.00 0.00 2.43
3081 3140 2.597455 CCCCATGTTTGTCTCCAGTTT 58.403 47.619 0.00 0.00 0.00 2.66
3082 3141 1.203050 CCCCCATGTTTGTCTCCAGTT 60.203 52.381 0.00 0.00 0.00 3.16
3083 3142 0.405585 CCCCCATGTTTGTCTCCAGT 59.594 55.000 0.00 0.00 0.00 4.00
3084 3143 3.271250 CCCCCATGTTTGTCTCCAG 57.729 57.895 0.00 0.00 0.00 3.86
3099 3158 1.408453 CGGACTCCCACTAATCCCCC 61.408 65.000 0.00 0.00 0.00 5.40
3100 3159 1.408453 CCGGACTCCCACTAATCCCC 61.408 65.000 0.00 0.00 0.00 4.81
3101 3160 0.398098 TCCGGACTCCCACTAATCCC 60.398 60.000 0.00 0.00 0.00 3.85
3102 3161 0.751452 GTCCGGACTCCCACTAATCC 59.249 60.000 27.64 0.00 0.00 3.01
3103 3162 1.136500 GTGTCCGGACTCCCACTAATC 59.864 57.143 33.39 4.70 0.00 1.75
3104 3163 1.192428 GTGTCCGGACTCCCACTAAT 58.808 55.000 33.39 0.00 0.00 1.73
3105 3164 1.246056 CGTGTCCGGACTCCCACTAA 61.246 60.000 33.39 9.59 0.00 2.24
3106 3165 1.676635 CGTGTCCGGACTCCCACTA 60.677 63.158 33.39 10.38 0.00 2.74
3107 3166 2.989824 CGTGTCCGGACTCCCACT 60.990 66.667 33.39 0.00 0.00 4.00
3108 3167 2.987547 TCGTGTCCGGACTCCCAC 60.988 66.667 33.39 22.20 33.95 4.61
3109 3168 2.675423 CTCGTGTCCGGACTCCCA 60.675 66.667 33.39 17.42 33.95 4.37
3110 3169 1.530013 TTTCTCGTGTCCGGACTCCC 61.530 60.000 33.39 20.13 33.95 4.30
3111 3170 0.388263 GTTTCTCGTGTCCGGACTCC 60.388 60.000 33.39 22.50 33.95 3.85
3112 3171 0.728466 CGTTTCTCGTGTCCGGACTC 60.728 60.000 33.39 28.39 34.52 3.36
3113 3172 1.285023 CGTTTCTCGTGTCCGGACT 59.715 57.895 33.39 0.00 34.52 3.85
3114 3173 3.838468 CGTTTCTCGTGTCCGGAC 58.162 61.111 28.17 28.17 34.52 4.79
3123 3182 2.601741 GGGTATAGAGCGACGTTTCTCG 60.602 54.545 7.19 1.73 46.00 4.04
3124 3183 2.287487 GGGGTATAGAGCGACGTTTCTC 60.287 54.545 9.23 9.23 0.00 2.87
3125 3184 1.680207 GGGGTATAGAGCGACGTTTCT 59.320 52.381 8.64 8.64 0.00 2.52
3126 3185 1.680207 AGGGGTATAGAGCGACGTTTC 59.320 52.381 0.00 0.00 0.00 2.78
3127 3186 1.407979 CAGGGGTATAGAGCGACGTTT 59.592 52.381 0.00 0.00 0.00 3.60
3128 3187 1.030457 CAGGGGTATAGAGCGACGTT 58.970 55.000 0.00 0.00 0.00 3.99
3129 3188 0.822532 CCAGGGGTATAGAGCGACGT 60.823 60.000 0.00 0.00 0.00 4.34
3130 3189 1.957562 CCAGGGGTATAGAGCGACG 59.042 63.158 0.00 0.00 0.00 5.12
3131 3190 1.666580 GCCAGGGGTATAGAGCGAC 59.333 63.158 0.00 0.00 0.00 5.19
3132 3191 1.533273 GGCCAGGGGTATAGAGCGA 60.533 63.158 0.00 0.00 0.00 4.93
3133 3192 2.584391 GGGCCAGGGGTATAGAGCG 61.584 68.421 4.39 0.00 0.00 5.03
3134 3193 2.584391 CGGGCCAGGGGTATAGAGC 61.584 68.421 4.39 0.00 0.00 4.09
3135 3194 2.584391 GCGGGCCAGGGGTATAGAG 61.584 68.421 4.39 0.00 0.00 2.43
3136 3195 2.525877 GCGGGCCAGGGGTATAGA 60.526 66.667 4.39 0.00 0.00 1.98
3137 3196 3.637273 GGCGGGCCAGGGGTATAG 61.637 72.222 4.39 0.00 35.81 1.31
3145 3204 4.676951 TCCTTTTGGGCGGGCCAG 62.677 66.667 23.18 12.05 40.87 4.85
3146 3205 4.226095 TTCCTTTTGGGCGGGCCA 62.226 61.111 20.63 20.63 40.87 5.36
3147 3206 3.381983 CTTCCTTTTGGGCGGGCC 61.382 66.667 14.65 14.65 40.87 5.80
3148 3207 3.381983 CCTTCCTTTTGGGCGGGC 61.382 66.667 0.00 0.00 40.87 6.13
3149 3208 2.117423 ACCTTCCTTTTGGGCGGG 59.883 61.111 0.00 0.00 40.87 6.13
3150 3209 2.275380 CCACCTTCCTTTTGGGCGG 61.275 63.158 0.00 0.00 40.87 6.13
3151 3210 1.228429 TCCACCTTCCTTTTGGGCG 60.228 57.895 0.00 0.00 40.87 6.13
3152 3211 1.536073 GCTCCACCTTCCTTTTGGGC 61.536 60.000 0.00 0.00 40.87 5.36
3153 3212 0.900182 GGCTCCACCTTCCTTTTGGG 60.900 60.000 0.00 0.00 36.25 4.12
3154 3213 1.244019 CGGCTCCACCTTCCTTTTGG 61.244 60.000 0.00 0.00 37.30 3.28
3155 3214 1.244019 CCGGCTCCACCTTCCTTTTG 61.244 60.000 0.00 0.00 35.61 2.44
3156 3215 1.074951 CCGGCTCCACCTTCCTTTT 59.925 57.895 0.00 0.00 35.61 2.27
3157 3216 2.757077 CCGGCTCCACCTTCCTTT 59.243 61.111 0.00 0.00 35.61 3.11
3158 3217 4.035102 GCCGGCTCCACCTTCCTT 62.035 66.667 22.15 0.00 35.61 3.36
3161 3220 1.972660 ATAGTGCCGGCTCCACCTTC 61.973 60.000 29.70 7.57 35.61 3.46
3162 3221 1.562672 AATAGTGCCGGCTCCACCTT 61.563 55.000 29.70 10.27 35.61 3.50
3163 3222 1.995626 AATAGTGCCGGCTCCACCT 60.996 57.895 29.70 16.81 35.61 4.00
3164 3223 1.819632 CAATAGTGCCGGCTCCACC 60.820 63.158 29.70 10.15 33.75 4.61
3165 3224 0.177141 TACAATAGTGCCGGCTCCAC 59.823 55.000 29.70 18.10 0.00 4.02
3166 3225 0.464036 CTACAATAGTGCCGGCTCCA 59.536 55.000 29.70 14.45 0.00 3.86
3167 3226 0.880718 GCTACAATAGTGCCGGCTCC 60.881 60.000 29.70 18.26 0.00 4.70
3168 3227 0.179084 TGCTACAATAGTGCCGGCTC 60.179 55.000 29.70 25.08 0.00 4.70
3169 3228 0.469917 ATGCTACAATAGTGCCGGCT 59.530 50.000 29.70 11.31 0.00 5.52
3170 3229 0.868406 GATGCTACAATAGTGCCGGC 59.132 55.000 22.73 22.73 0.00 6.13
3171 3230 1.512926 GGATGCTACAATAGTGCCGG 58.487 55.000 0.00 0.00 0.00 6.13
3172 3231 1.202639 TGGGATGCTACAATAGTGCCG 60.203 52.381 0.00 0.00 0.00 5.69
3173 3232 2.222027 GTGGGATGCTACAATAGTGCC 58.778 52.381 0.00 0.00 0.00 5.01
3174 3233 2.614057 GTGTGGGATGCTACAATAGTGC 59.386 50.000 4.67 0.00 0.00 4.40
3175 3234 3.873361 CAGTGTGGGATGCTACAATAGTG 59.127 47.826 4.67 0.00 0.00 2.74
3176 3235 3.519510 ACAGTGTGGGATGCTACAATAGT 59.480 43.478 4.67 3.03 0.00 2.12
3177 3236 4.142609 ACAGTGTGGGATGCTACAATAG 57.857 45.455 4.67 2.42 0.00 1.73
3178 3237 4.568072 AACAGTGTGGGATGCTACAATA 57.432 40.909 4.67 0.00 0.00 1.90
3179 3238 3.439857 AACAGTGTGGGATGCTACAAT 57.560 42.857 4.67 0.42 0.00 2.71
3180 3239 2.949177 AACAGTGTGGGATGCTACAA 57.051 45.000 4.67 0.00 0.00 2.41
3181 3240 2.949177 AAACAGTGTGGGATGCTACA 57.051 45.000 0.00 0.00 0.00 2.74
3182 3241 3.058224 GTGAAAACAGTGTGGGATGCTAC 60.058 47.826 0.00 0.00 0.00 3.58
3183 3242 3.146066 GTGAAAACAGTGTGGGATGCTA 58.854 45.455 0.00 0.00 0.00 3.49
3184 3243 1.956477 GTGAAAACAGTGTGGGATGCT 59.044 47.619 0.00 0.00 0.00 3.79
3185 3244 1.334960 CGTGAAAACAGTGTGGGATGC 60.335 52.381 0.00 0.00 0.00 3.91
3186 3245 1.334960 GCGTGAAAACAGTGTGGGATG 60.335 52.381 0.00 0.00 0.00 3.51
3187 3246 0.951558 GCGTGAAAACAGTGTGGGAT 59.048 50.000 0.00 0.00 0.00 3.85
3188 3247 1.098712 GGCGTGAAAACAGTGTGGGA 61.099 55.000 0.00 0.00 0.00 4.37
3189 3248 1.358759 GGCGTGAAAACAGTGTGGG 59.641 57.895 0.00 0.00 0.00 4.61
3190 3249 0.453793 TTGGCGTGAAAACAGTGTGG 59.546 50.000 0.00 0.00 0.00 4.17
3191 3250 2.270275 TTTGGCGTGAAAACAGTGTG 57.730 45.000 0.00 0.00 0.00 3.82
3192 3251 3.443976 GATTTTGGCGTGAAAACAGTGT 58.556 40.909 0.00 0.00 0.00 3.55
3193 3252 2.794350 GGATTTTGGCGTGAAAACAGTG 59.206 45.455 0.00 0.00 0.00 3.66
3194 3253 2.693074 AGGATTTTGGCGTGAAAACAGT 59.307 40.909 0.00 0.00 0.00 3.55
3195 3254 3.308530 GAGGATTTTGGCGTGAAAACAG 58.691 45.455 0.00 0.00 0.00 3.16
3196 3255 2.035321 GGAGGATTTTGGCGTGAAAACA 59.965 45.455 0.00 0.00 0.00 2.83
3197 3256 2.035321 TGGAGGATTTTGGCGTGAAAAC 59.965 45.455 0.00 0.00 0.00 2.43
3198 3257 2.035321 GTGGAGGATTTTGGCGTGAAAA 59.965 45.455 0.00 0.00 0.00 2.29
3199 3258 1.611491 GTGGAGGATTTTGGCGTGAAA 59.389 47.619 0.00 0.00 0.00 2.69
3200 3259 1.202879 AGTGGAGGATTTTGGCGTGAA 60.203 47.619 0.00 0.00 0.00 3.18
3201 3260 0.400213 AGTGGAGGATTTTGGCGTGA 59.600 50.000 0.00 0.00 0.00 4.35
3202 3261 1.200020 GAAGTGGAGGATTTTGGCGTG 59.800 52.381 0.00 0.00 0.00 5.34
3203 3262 1.073923 AGAAGTGGAGGATTTTGGCGT 59.926 47.619 0.00 0.00 0.00 5.68
3204 3263 1.740025 GAGAAGTGGAGGATTTTGGCG 59.260 52.381 0.00 0.00 0.00 5.69
3205 3264 3.078891 AGAGAAGTGGAGGATTTTGGC 57.921 47.619 0.00 0.00 0.00 4.52
3206 3265 4.916183 AGAAGAGAAGTGGAGGATTTTGG 58.084 43.478 0.00 0.00 0.00 3.28
3207 3266 5.414144 GGAAGAAGAGAAGTGGAGGATTTTG 59.586 44.000 0.00 0.00 0.00 2.44
3208 3267 5.073691 TGGAAGAAGAGAAGTGGAGGATTTT 59.926 40.000 0.00 0.00 0.00 1.82
3209 3268 4.599241 TGGAAGAAGAGAAGTGGAGGATTT 59.401 41.667 0.00 0.00 0.00 2.17
3210 3269 4.171234 TGGAAGAAGAGAAGTGGAGGATT 58.829 43.478 0.00 0.00 0.00 3.01
3211 3270 3.796111 TGGAAGAAGAGAAGTGGAGGAT 58.204 45.455 0.00 0.00 0.00 3.24
3212 3271 3.260269 TGGAAGAAGAGAAGTGGAGGA 57.740 47.619 0.00 0.00 0.00 3.71
3213 3272 4.512484 GAATGGAAGAAGAGAAGTGGAGG 58.488 47.826 0.00 0.00 0.00 4.30
3214 3273 4.512484 GGAATGGAAGAAGAGAAGTGGAG 58.488 47.826 0.00 0.00 0.00 3.86
3215 3274 3.264450 GGGAATGGAAGAAGAGAAGTGGA 59.736 47.826 0.00 0.00 0.00 4.02
3216 3275 3.615155 GGGAATGGAAGAAGAGAAGTGG 58.385 50.000 0.00 0.00 0.00 4.00
3217 3276 3.615155 GGGGAATGGAAGAAGAGAAGTG 58.385 50.000 0.00 0.00 0.00 3.16
3218 3277 2.237392 CGGGGAATGGAAGAAGAGAAGT 59.763 50.000 0.00 0.00 0.00 3.01
3219 3278 2.911484 CGGGGAATGGAAGAAGAGAAG 58.089 52.381 0.00 0.00 0.00 2.85
3220 3279 1.065418 GCGGGGAATGGAAGAAGAGAA 60.065 52.381 0.00 0.00 0.00 2.87
3221 3280 0.541863 GCGGGGAATGGAAGAAGAGA 59.458 55.000 0.00 0.00 0.00 3.10
3222 3281 0.464554 GGCGGGGAATGGAAGAAGAG 60.465 60.000 0.00 0.00 0.00 2.85
3223 3282 1.607612 GGCGGGGAATGGAAGAAGA 59.392 57.895 0.00 0.00 0.00 2.87
3224 3283 1.819632 CGGCGGGGAATGGAAGAAG 60.820 63.158 0.00 0.00 0.00 2.85
3225 3284 2.270850 CGGCGGGGAATGGAAGAA 59.729 61.111 0.00 0.00 0.00 2.52
3226 3285 4.483243 GCGGCGGGGAATGGAAGA 62.483 66.667 9.78 0.00 0.00 2.87
3227 3286 4.489771 AGCGGCGGGGAATGGAAG 62.490 66.667 9.78 0.00 0.00 3.46
3228 3287 4.483243 GAGCGGCGGGGAATGGAA 62.483 66.667 9.78 0.00 0.00 3.53
3230 3289 4.918201 GAGAGCGGCGGGGAATGG 62.918 72.222 9.78 0.00 0.00 3.16
3231 3290 4.918201 GGAGAGCGGCGGGGAATG 62.918 72.222 9.78 0.00 0.00 2.67
3241 3300 1.709147 CAAGAATTGGGCGGAGAGCG 61.709 60.000 0.00 0.00 43.94 5.03
3242 3301 2.101700 CAAGAATTGGGCGGAGAGC 58.898 57.895 0.00 0.00 43.94 4.09
3253 3312 2.899900 GTGGGGGAAAAGAGCAAGAATT 59.100 45.455 0.00 0.00 0.00 2.17
3254 3313 2.529632 GTGGGGGAAAAGAGCAAGAAT 58.470 47.619 0.00 0.00 0.00 2.40
3255 3314 1.480498 GGTGGGGGAAAAGAGCAAGAA 60.480 52.381 0.00 0.00 0.00 2.52
3256 3315 0.112412 GGTGGGGGAAAAGAGCAAGA 59.888 55.000 0.00 0.00 0.00 3.02
3257 3316 0.900182 GGGTGGGGGAAAAGAGCAAG 60.900 60.000 0.00 0.00 0.00 4.01
3258 3317 1.155155 GGGTGGGGGAAAAGAGCAA 59.845 57.895 0.00 0.00 0.00 3.91
3259 3318 1.778383 AGGGTGGGGGAAAAGAGCA 60.778 57.895 0.00 0.00 0.00 4.26
3260 3319 1.000771 GAGGGTGGGGGAAAAGAGC 60.001 63.158 0.00 0.00 0.00 4.09
3261 3320 0.621082 GAGAGGGTGGGGGAAAAGAG 59.379 60.000 0.00 0.00 0.00 2.85
3262 3321 0.845102 GGAGAGGGTGGGGGAAAAGA 60.845 60.000 0.00 0.00 0.00 2.52
3263 3322 0.846870 AGGAGAGGGTGGGGGAAAAG 60.847 60.000 0.00 0.00 0.00 2.27
3264 3323 0.404346 AAGGAGAGGGTGGGGGAAAA 60.404 55.000 0.00 0.00 0.00 2.29
3265 3324 0.845102 GAAGGAGAGGGTGGGGGAAA 60.845 60.000 0.00 0.00 0.00 3.13
3266 3325 1.229853 GAAGGAGAGGGTGGGGGAA 60.230 63.158 0.00 0.00 0.00 3.97
3267 3326 2.454941 GAAGGAGAGGGTGGGGGA 59.545 66.667 0.00 0.00 0.00 4.81
3268 3327 2.692741 GGAAGGAGAGGGTGGGGG 60.693 72.222 0.00 0.00 0.00 5.40
3269 3328 1.229984 AAGGAAGGAGAGGGTGGGG 60.230 63.158 0.00 0.00 0.00 4.96
3270 3329 0.252927 AGAAGGAAGGAGAGGGTGGG 60.253 60.000 0.00 0.00 0.00 4.61
3271 3330 0.908198 CAGAAGGAAGGAGAGGGTGG 59.092 60.000 0.00 0.00 0.00 4.61
3272 3331 0.251634 GCAGAAGGAAGGAGAGGGTG 59.748 60.000 0.00 0.00 0.00 4.61
3273