Multiple sequence alignment - TraesCS7B01G005900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)



BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7B01G005900 chr7B 100.000 7015 0 0 1 7015 3184838 3177824 0.000000e+00 12955
1 TraesCS7B01G005900 chr7B 78.764 518 86 13 5704 6211 3331713 3331210 6.790000e-85 326
2 TraesCS7B01G005900 chr7B 91.781 219 17 1 1 218 665147868 665148086 3.180000e-78 303
3 TraesCS7B01G005900 chr7B 88.532 218 23 2 1 217 62817708 62817924 5.400000e-66 263
4 TraesCS7B01G005900 chr7B 88.532 218 24 1 1 218 748027671 748027455 5.400000e-66 263
5 TraesCS7B01G005900 chr7B 91.089 101 7 2 6867 6967 533775230 533775328 1.230000e-27 135
6 TraesCS7B01G005900 chr7D 79.127 527 92 14 5704 6218 60695184 60694664 1.450000e-91 348
7 TraesCS7B01G005900 chr7D 91.667 216 14 2 1 216 5793843 5794054 5.320000e-76 296
8 TraesCS7B01G005900 chr7D 91.919 99 6 2 6867 6965 506006952 506007048 3.410000e-28 137
9 TraesCS7B01G005900 chr4B 98.851 174 2 0 870 1043 78609319 78609146 1.900000e-80 311
10 TraesCS7B01G005900 chr4B 98.295 176 3 0 871 1046 106047808 106047633 6.830000e-80 309
11 TraesCS7B01G005900 chr4B 96.277 188 4 3 858 1042 413121384 413121197 8.840000e-79 305
12 TraesCS7B01G005900 chr4B 96.703 182 4 2 861 1041 171146574 171146754 1.140000e-77 302
13 TraesCS7B01G005900 chr7A 92.166 217 17 0 1 217 47395693 47395909 2.460000e-79 307
14 TraesCS7B01G005900 chr7A 96.739 184 3 3 859 1040 426576408 426576590 3.180000e-78 303
15 TraesCS7B01G005900 chr7A 81.124 249 42 4 5704 5948 64932168 64931921 2.000000e-45 195
16 TraesCS7B01G005900 chr7A 83.575 207 33 1 6012 6218 64931901 64931696 7.180000e-45 193
17 TraesCS7B01G005900 chr7A 92.079 101 6 2 6867 6967 573432705 573432803 2.640000e-29 141
18 TraesCS7B01G005900 chr4A 98.286 175 3 0 873 1047 231287821 231287647 2.460000e-79 307
19 TraesCS7B01G005900 chr3B 91.855 221 17 1 1 221 755659070 755659289 2.460000e-79 307
20 TraesCS7B01G005900 chr3A 98.837 172 2 0 872 1043 565776547 565776376 2.460000e-79 307
21 TraesCS7B01G005900 chr5D 96.216 185 5 2 862 1044 319691599 319691415 1.140000e-77 302
22 TraesCS7B01G005900 chr1A 96.216 185 5 2 857 1041 58842248 58842066 1.140000e-77 302
23 TraesCS7B01G005900 chr1A 90.196 102 9 1 6860 6961 221699860 221699760 1.590000e-26 132
24 TraesCS7B01G005900 chr5A 90.323 217 19 2 1 216 316129480 316129695 4.140000e-72 283
25 TraesCS7B01G005900 chr5B 86.818 220 26 3 1 218 537903625 537903843 7.030000e-60 243
26 TraesCS7B01G005900 chr1D 86.636 217 27 2 1 216 481957796 481958011 9.090000e-59 239
27 TraesCS7B01G005900 chr2A 89.720 107 8 3 6857 6962 364478303 364478407 4.410000e-27 134
28 TraesCS7B01G005900 chr6D 92.473 93 6 1 6870 6962 7414609 7414518 1.590000e-26 132
29 TraesCS7B01G005900 chr1B 90.196 102 9 1 6860 6961 263552423 263552323 1.590000e-26 132
30 TraesCS7B01G005900 chr2D 90.816 98 8 1 6865 6962 164389688 164389784 5.710000e-26 130
31 TraesCS7B01G005900 chr2B 90.816 98 6 3 6870 6966 717368617 717368522 2.050000e-25 128


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7B01G005900 chr7B 3177824 3184838 7014 True 12955 12955 100.000 1 7015 1 chr7B.!!$R1 7014
1 TraesCS7B01G005900 chr7B 3331210 3331713 503 True 326 326 78.764 5704 6211 1 chr7B.!!$R2 507
2 TraesCS7B01G005900 chr7D 60694664 60695184 520 True 348 348 79.127 5704 6218 1 chr7D.!!$R1 514


AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
791 792 0.030603 AGGGATCCTCCTCCTTCACC 60.031 60.0 12.58 0.00 36.57 4.02 F
1341 1342 0.033228 CCTGCTCTATCGCCTGGAAG 59.967 60.0 0.00 0.00 0.00 3.46 F
2242 2243 0.035739 GCAGGTAACCTTCACGGGAA 59.964 55.0 0.00 0.00 36.97 3.97 F
2479 2480 0.033504 ACGAATGCAGGTCGACAACT 59.966 50.0 24.59 2.85 41.02 3.16 F
2485 2486 0.033504 GCAGGTCGACAACTGGAAGA 59.966 55.0 18.91 0.00 37.43 2.87 F
3788 3789 0.034186 TTGAGCCGCCATCTGGAATT 60.034 50.0 0.00 0.00 37.39 2.17 F
4349 4350 0.035056 ATGGGGTCTCCTTTTGCTCG 60.035 55.0 0.00 0.00 36.20 5.03 F
4800 4801 0.032017 GAGCCTTACCTCCCTCCAGA 60.032 60.0 0.00 0.00 0.00 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2460 2461 0.033504 AGTTGTCGACCTGCATTCGT 59.966 50.0 14.12 0.00 37.73 3.85 R
2466 2467 0.033504 TCTTCCAGTTGTCGACCTGC 59.966 55.0 14.12 2.98 0.00 4.85 R
3769 3770 0.034186 AATTCCAGATGGCGGCTCAA 60.034 50.0 11.43 0.00 34.44 3.02 R
4330 4331 0.035056 CGAGCAAAAGGAGACCCCAT 60.035 55.0 0.00 0.00 37.41 4.00 R
4427 4428 0.108186 CTAGTGATTGGAGTGCGCCA 60.108 55.0 4.18 0.00 35.78 5.69 R
4776 4777 0.031010 AGGGAGGTAAGGCTCCGAAT 60.031 55.0 0.00 0.00 40.51 3.34 R
5381 5382 0.039256 GCGCAACACAACCACATCAT 60.039 50.0 0.30 0.00 0.00 2.45 R
6463 6470 0.034574 TTGTGTGGTCAGTTGCCAGT 60.035 50.0 0.00 0.00 36.57 4.00 R


All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
20 21 3.255969 TCCCACAATAAGCTAACGGTC 57.744 47.619 0.00 0.00 0.00 4.79
21 22 2.568062 TCCCACAATAAGCTAACGGTCA 59.432 45.455 0.00 0.00 0.00 4.02
22 23 3.008157 TCCCACAATAAGCTAACGGTCAA 59.992 43.478 0.00 0.00 0.00 3.18
23 24 3.754323 CCCACAATAAGCTAACGGTCAAA 59.246 43.478 0.00 0.00 0.00 2.69
24 25 4.379082 CCCACAATAAGCTAACGGTCAAAC 60.379 45.833 0.00 0.00 0.00 2.93
25 26 4.214545 CCACAATAAGCTAACGGTCAAACA 59.785 41.667 0.00 0.00 0.00 2.83
26 27 5.278071 CCACAATAAGCTAACGGTCAAACAA 60.278 40.000 0.00 0.00 0.00 2.83
27 28 6.202937 CACAATAAGCTAACGGTCAAACAAA 58.797 36.000 0.00 0.00 0.00 2.83
28 29 6.693545 CACAATAAGCTAACGGTCAAACAAAA 59.306 34.615 0.00 0.00 0.00 2.44
29 30 7.221067 CACAATAAGCTAACGGTCAAACAAAAA 59.779 33.333 0.00 0.00 0.00 1.94
30 31 7.434013 ACAATAAGCTAACGGTCAAACAAAAAG 59.566 33.333 0.00 0.00 0.00 2.27
31 32 5.570234 AAGCTAACGGTCAAACAAAAAGA 57.430 34.783 0.00 0.00 0.00 2.52
32 33 5.767816 AGCTAACGGTCAAACAAAAAGAT 57.232 34.783 0.00 0.00 0.00 2.40
33 34 5.758924 AGCTAACGGTCAAACAAAAAGATC 58.241 37.500 0.00 0.00 0.00 2.75
34 35 5.298276 AGCTAACGGTCAAACAAAAAGATCA 59.702 36.000 0.00 0.00 0.00 2.92
35 36 5.974751 GCTAACGGTCAAACAAAAAGATCAA 59.025 36.000 0.00 0.00 0.00 2.57
36 37 6.075046 GCTAACGGTCAAACAAAAAGATCAAC 60.075 38.462 0.00 0.00 0.00 3.18
37 38 5.317733 ACGGTCAAACAAAAAGATCAACA 57.682 34.783 0.00 0.00 0.00 3.33
38 39 5.715070 ACGGTCAAACAAAAAGATCAACAA 58.285 33.333 0.00 0.00 0.00 2.83
39 40 6.159988 ACGGTCAAACAAAAAGATCAACAAA 58.840 32.000 0.00 0.00 0.00 2.83
40 41 6.090223 ACGGTCAAACAAAAAGATCAACAAAC 59.910 34.615 0.00 0.00 0.00 2.93
41 42 6.465978 GGTCAAACAAAAAGATCAACAAACG 58.534 36.000 0.00 0.00 0.00 3.60
42 43 6.454981 GGTCAAACAAAAAGATCAACAAACGG 60.455 38.462 0.00 0.00 0.00 4.44
43 44 6.309251 GTCAAACAAAAAGATCAACAAACGGA 59.691 34.615 0.00 0.00 0.00 4.69
44 45 7.010091 GTCAAACAAAAAGATCAACAAACGGAT 59.990 33.333 0.00 0.00 0.00 4.18
45 46 7.547370 TCAAACAAAAAGATCAACAAACGGATT 59.453 29.630 0.00 0.00 0.00 3.01
46 47 6.826893 ACAAAAAGATCAACAAACGGATTG 57.173 33.333 0.00 0.00 44.95 2.67
58 59 2.403252 ACGGATTGTTTAGGAGCAGG 57.597 50.000 0.00 0.00 0.00 4.85
59 60 1.017387 CGGATTGTTTAGGAGCAGGC 58.983 55.000 0.00 0.00 0.00 4.85
60 61 1.393603 GGATTGTTTAGGAGCAGGCC 58.606 55.000 0.00 0.00 0.00 5.19
61 62 1.393603 GATTGTTTAGGAGCAGGCCC 58.606 55.000 0.00 0.00 0.00 5.80
62 63 0.394352 ATTGTTTAGGAGCAGGCCCG 60.394 55.000 0.00 0.00 0.00 6.13
63 64 1.485294 TTGTTTAGGAGCAGGCCCGA 61.485 55.000 0.00 0.00 0.00 5.14
64 65 1.449778 GTTTAGGAGCAGGCCCGAC 60.450 63.158 0.00 0.00 0.00 4.79
65 66 2.666098 TTTAGGAGCAGGCCCGACC 61.666 63.158 0.00 0.00 39.61 4.79
76 77 2.180432 GGCCCGACCTATCATAAACC 57.820 55.000 0.00 0.00 34.51 3.27
77 78 1.271217 GGCCCGACCTATCATAAACCC 60.271 57.143 0.00 0.00 34.51 4.11
78 79 1.418637 GCCCGACCTATCATAAACCCA 59.581 52.381 0.00 0.00 0.00 4.51
79 80 2.039879 GCCCGACCTATCATAAACCCAT 59.960 50.000 0.00 0.00 0.00 4.00
80 81 3.497942 GCCCGACCTATCATAAACCCATT 60.498 47.826 0.00 0.00 0.00 3.16
81 82 4.725490 CCCGACCTATCATAAACCCATTT 58.275 43.478 0.00 0.00 0.00 2.32
82 83 5.746656 GCCCGACCTATCATAAACCCATTTA 60.747 44.000 0.00 0.00 34.78 1.40
83 84 6.300703 CCCGACCTATCATAAACCCATTTAA 58.699 40.000 0.00 0.00 33.98 1.52
84 85 6.773685 CCCGACCTATCATAAACCCATTTAAA 59.226 38.462 0.00 0.00 33.98 1.52
85 86 7.285858 CCCGACCTATCATAAACCCATTTAAAA 59.714 37.037 0.00 0.00 33.98 1.52
86 87 8.856103 CCGACCTATCATAAACCCATTTAAAAT 58.144 33.333 0.00 0.00 33.98 1.82
87 88 9.677567 CGACCTATCATAAACCCATTTAAAATG 57.322 33.333 0.00 0.00 33.98 2.32
96 97 7.414814 AAACCCATTTAAAATGTTAGCAACG 57.585 32.000 0.00 0.00 0.00 4.10
97 98 6.334102 ACCCATTTAAAATGTTAGCAACGA 57.666 33.333 0.00 0.00 0.00 3.85
98 99 6.386654 ACCCATTTAAAATGTTAGCAACGAG 58.613 36.000 0.00 0.00 0.00 4.18
99 100 5.804979 CCCATTTAAAATGTTAGCAACGAGG 59.195 40.000 0.00 0.00 0.00 4.63
100 101 6.349777 CCCATTTAAAATGTTAGCAACGAGGA 60.350 38.462 0.00 0.00 0.00 3.71
101 102 7.087639 CCATTTAAAATGTTAGCAACGAGGAA 58.912 34.615 0.00 0.00 0.00 3.36
102 103 7.759433 CCATTTAAAATGTTAGCAACGAGGAAT 59.241 33.333 0.00 0.00 0.00 3.01
103 104 9.139174 CATTTAAAATGTTAGCAACGAGGAATT 57.861 29.630 0.00 0.00 0.00 2.17
104 105 9.705290 ATTTAAAATGTTAGCAACGAGGAATTT 57.295 25.926 0.00 0.00 0.00 1.82
105 106 8.514136 TTAAAATGTTAGCAACGAGGAATTTG 57.486 30.769 0.00 0.00 0.00 2.32
106 107 4.701956 ATGTTAGCAACGAGGAATTTGG 57.298 40.909 0.00 0.00 0.00 3.28
107 108 2.817258 TGTTAGCAACGAGGAATTTGGG 59.183 45.455 0.00 0.00 0.00 4.12
108 109 2.817844 GTTAGCAACGAGGAATTTGGGT 59.182 45.455 0.00 0.00 0.00 4.51
109 110 1.995376 AGCAACGAGGAATTTGGGTT 58.005 45.000 0.00 0.00 0.00 4.11
110 111 2.316108 AGCAACGAGGAATTTGGGTTT 58.684 42.857 0.00 0.00 0.00 3.27
111 112 2.698274 AGCAACGAGGAATTTGGGTTTT 59.302 40.909 0.00 0.00 0.00 2.43
112 113 3.133901 AGCAACGAGGAATTTGGGTTTTT 59.866 39.130 0.00 0.00 0.00 1.94
129 130 1.314730 TTTTGAAACAGCCGACTCCC 58.685 50.000 0.00 0.00 0.00 4.30
130 131 0.882927 TTTGAAACAGCCGACTCCCG 60.883 55.000 0.00 0.00 38.18 5.14
131 132 1.750341 TTGAAACAGCCGACTCCCGA 61.750 55.000 0.00 0.00 41.76 5.14
132 133 1.005394 GAAACAGCCGACTCCCGAA 60.005 57.895 0.00 0.00 41.76 4.30
133 134 0.391263 GAAACAGCCGACTCCCGAAT 60.391 55.000 0.00 0.00 41.76 3.34
134 135 0.036306 AAACAGCCGACTCCCGAATT 59.964 50.000 0.00 0.00 41.76 2.17
135 136 0.673644 AACAGCCGACTCCCGAATTG 60.674 55.000 0.00 0.00 41.76 2.32
136 137 1.815421 CAGCCGACTCCCGAATTGG 60.815 63.158 0.00 0.00 41.76 3.16
137 138 2.267961 GCCGACTCCCGAATTGGT 59.732 61.111 0.00 0.00 41.76 3.67
138 139 0.974010 AGCCGACTCCCGAATTGGTA 60.974 55.000 0.00 0.00 41.76 3.25
139 140 0.529992 GCCGACTCCCGAATTGGTAG 60.530 60.000 0.00 0.00 41.76 3.18
140 141 0.822164 CCGACTCCCGAATTGGTAGT 59.178 55.000 0.00 0.00 41.76 2.73
141 142 1.206371 CCGACTCCCGAATTGGTAGTT 59.794 52.381 0.00 0.00 41.76 2.24
142 143 2.428171 CCGACTCCCGAATTGGTAGTTA 59.572 50.000 0.00 0.00 41.76 2.24
143 144 3.069158 CCGACTCCCGAATTGGTAGTTAT 59.931 47.826 0.00 0.00 41.76 1.89
144 145 4.296690 CGACTCCCGAATTGGTAGTTATC 58.703 47.826 0.00 0.00 41.76 1.75
145 146 4.202080 CGACTCCCGAATTGGTAGTTATCA 60.202 45.833 0.00 0.00 41.76 2.15
146 147 5.277857 ACTCCCGAATTGGTAGTTATCAG 57.722 43.478 0.00 0.00 35.15 2.90
147 148 4.058817 CTCCCGAATTGGTAGTTATCAGC 58.941 47.826 0.00 0.00 35.15 4.26
148 149 2.800544 CCCGAATTGGTAGTTATCAGCG 59.199 50.000 0.00 0.00 35.15 5.18
149 150 3.491964 CCCGAATTGGTAGTTATCAGCGA 60.492 47.826 0.00 0.00 35.15 4.93
150 151 4.116961 CCGAATTGGTAGTTATCAGCGAA 58.883 43.478 0.00 0.00 0.00 4.70
151 152 4.569162 CCGAATTGGTAGTTATCAGCGAAA 59.431 41.667 0.00 0.00 0.00 3.46
152 153 5.064198 CCGAATTGGTAGTTATCAGCGAAAA 59.936 40.000 0.00 0.00 0.00 2.29
153 154 6.402766 CCGAATTGGTAGTTATCAGCGAAAAA 60.403 38.462 0.00 0.00 0.00 1.94
192 193 5.975693 TTTTGGAACCATAGCCTGTAAAG 57.024 39.130 0.00 0.00 0.00 1.85
193 194 4.650972 TTGGAACCATAGCCTGTAAAGT 57.349 40.909 0.00 0.00 0.00 2.66
194 195 5.765576 TTGGAACCATAGCCTGTAAAGTA 57.234 39.130 0.00 0.00 0.00 2.24
195 196 5.353394 TGGAACCATAGCCTGTAAAGTAG 57.647 43.478 0.00 0.00 0.00 2.57
196 197 4.127907 GGAACCATAGCCTGTAAAGTAGC 58.872 47.826 0.00 0.00 0.00 3.58
197 198 4.383770 GGAACCATAGCCTGTAAAGTAGCA 60.384 45.833 0.00 0.00 0.00 3.49
198 199 4.408182 ACCATAGCCTGTAAAGTAGCAG 57.592 45.455 0.00 0.00 0.00 4.24
199 200 3.775316 ACCATAGCCTGTAAAGTAGCAGT 59.225 43.478 0.00 0.00 0.00 4.40
200 201 4.225267 ACCATAGCCTGTAAAGTAGCAGTT 59.775 41.667 0.00 0.00 0.00 3.16
201 202 5.186198 CCATAGCCTGTAAAGTAGCAGTTT 58.814 41.667 0.00 0.00 0.00 2.66
202 203 5.648092 CCATAGCCTGTAAAGTAGCAGTTTT 59.352 40.000 0.00 0.00 0.00 2.43
203 204 6.821665 CCATAGCCTGTAAAGTAGCAGTTTTA 59.178 38.462 0.00 0.00 0.00 1.52
204 205 7.499232 CCATAGCCTGTAAAGTAGCAGTTTTAT 59.501 37.037 0.00 0.00 0.00 1.40
205 206 6.743575 AGCCTGTAAAGTAGCAGTTTTATG 57.256 37.500 0.00 0.00 0.00 1.90
206 207 5.123979 AGCCTGTAAAGTAGCAGTTTTATGC 59.876 40.000 0.00 0.00 46.88 3.14
218 219 5.748592 GCAGTTTTATGCTATTTACTCGGG 58.251 41.667 0.00 0.00 43.07 5.14
219 220 5.526111 GCAGTTTTATGCTATTTACTCGGGA 59.474 40.000 0.00 0.00 43.07 5.14
220 221 6.292919 GCAGTTTTATGCTATTTACTCGGGAG 60.293 42.308 0.00 0.00 43.07 4.30
221 222 6.984474 CAGTTTTATGCTATTTACTCGGGAGA 59.016 38.462 2.08 0.00 37.31 3.71
222 223 7.494625 CAGTTTTATGCTATTTACTCGGGAGAA 59.505 37.037 2.08 0.00 39.18 2.87
223 224 7.494952 AGTTTTATGCTATTTACTCGGGAGAAC 59.505 37.037 2.08 0.00 39.18 3.01
224 225 3.431922 TGCTATTTACTCGGGAGAACG 57.568 47.619 2.08 0.00 39.18 3.95
225 226 2.100252 TGCTATTTACTCGGGAGAACGG 59.900 50.000 2.08 0.00 39.18 4.44
226 227 2.100418 GCTATTTACTCGGGAGAACGGT 59.900 50.000 2.08 0.00 39.18 4.83
227 228 3.316308 GCTATTTACTCGGGAGAACGGTA 59.684 47.826 2.08 0.00 39.18 4.02
228 229 3.790152 ATTTACTCGGGAGAACGGTAC 57.210 47.619 2.08 0.00 39.18 3.34
229 230 2.198827 TTACTCGGGAGAACGGTACA 57.801 50.000 2.08 0.00 39.18 2.90
230 231 2.198827 TACTCGGGAGAACGGTACAA 57.801 50.000 2.08 0.00 39.18 2.41
231 232 0.886563 ACTCGGGAGAACGGTACAAG 59.113 55.000 2.08 0.00 39.18 3.16
232 233 1.171308 CTCGGGAGAACGGTACAAGA 58.829 55.000 0.00 0.00 39.18 3.02
233 234 1.132643 CTCGGGAGAACGGTACAAGAG 59.867 57.143 0.00 0.00 39.18 2.85
234 235 0.886563 CGGGAGAACGGTACAAGAGT 59.113 55.000 0.00 0.00 0.00 3.24
235 236 1.402456 CGGGAGAACGGTACAAGAGTG 60.402 57.143 0.00 0.00 0.00 3.51
236 237 1.067071 GGGAGAACGGTACAAGAGTGG 60.067 57.143 0.00 0.00 0.00 4.00
237 238 1.617357 GGAGAACGGTACAAGAGTGGT 59.383 52.381 0.00 0.00 0.00 4.16
238 239 2.821969 GGAGAACGGTACAAGAGTGGTA 59.178 50.000 0.00 0.00 0.00 3.25
239 240 3.119566 GGAGAACGGTACAAGAGTGGTAG 60.120 52.174 0.00 0.00 0.00 3.18
240 241 2.230750 AGAACGGTACAAGAGTGGTAGC 59.769 50.000 0.00 0.00 36.23 3.58
241 242 1.624336 ACGGTACAAGAGTGGTAGCA 58.376 50.000 0.00 0.00 38.73 3.49
242 243 1.965643 ACGGTACAAGAGTGGTAGCAA 59.034 47.619 0.00 0.00 38.73 3.91
243 244 2.288640 ACGGTACAAGAGTGGTAGCAAC 60.289 50.000 0.00 0.00 38.73 4.17
244 245 2.029290 CGGTACAAGAGTGGTAGCAACT 60.029 50.000 0.00 0.00 38.73 3.16
245 246 3.554337 CGGTACAAGAGTGGTAGCAACTT 60.554 47.826 0.00 3.00 38.73 2.66
246 247 3.995048 GGTACAAGAGTGGTAGCAACTTC 59.005 47.826 11.09 4.12 38.68 3.01
247 248 2.755650 ACAAGAGTGGTAGCAACTTCG 58.244 47.619 11.09 9.88 0.00 3.79
248 249 1.461127 CAAGAGTGGTAGCAACTTCGC 59.539 52.381 11.09 0.00 0.00 4.70
249 250 0.679505 AGAGTGGTAGCAACTTCGCA 59.320 50.000 0.00 0.00 0.00 5.10
250 251 1.071605 GAGTGGTAGCAACTTCGCAG 58.928 55.000 0.00 0.00 0.00 5.18
251 252 0.951040 AGTGGTAGCAACTTCGCAGC 60.951 55.000 0.00 0.00 0.00 5.25
252 253 0.951040 GTGGTAGCAACTTCGCAGCT 60.951 55.000 0.00 0.00 42.14 4.24
253 254 0.250295 TGGTAGCAACTTCGCAGCTT 60.250 50.000 0.00 0.00 39.68 3.74
254 255 0.166814 GGTAGCAACTTCGCAGCTTG 59.833 55.000 0.00 0.00 39.68 4.01
255 256 1.148310 GTAGCAACTTCGCAGCTTGA 58.852 50.000 0.00 0.00 39.68 3.02
256 257 1.734465 GTAGCAACTTCGCAGCTTGAT 59.266 47.619 0.00 0.00 39.68 2.57
257 258 2.099141 AGCAACTTCGCAGCTTGATA 57.901 45.000 0.00 0.00 34.37 2.15
258 259 2.636830 AGCAACTTCGCAGCTTGATAT 58.363 42.857 0.00 0.00 34.37 1.63
259 260 3.012518 AGCAACTTCGCAGCTTGATATT 58.987 40.909 0.00 0.00 34.37 1.28
260 261 3.441572 AGCAACTTCGCAGCTTGATATTT 59.558 39.130 0.00 0.00 34.37 1.40
261 262 4.635765 AGCAACTTCGCAGCTTGATATTTA 59.364 37.500 0.00 0.00 34.37 1.40
262 263 5.297776 AGCAACTTCGCAGCTTGATATTTAT 59.702 36.000 0.00 0.00 34.37 1.40
263 264 5.622856 GCAACTTCGCAGCTTGATATTTATC 59.377 40.000 0.00 0.00 0.00 1.75
264 265 6.718388 CAACTTCGCAGCTTGATATTTATCA 58.282 36.000 0.00 0.00 40.69 2.15
265 266 6.536731 ACTTCGCAGCTTGATATTTATCAG 57.463 37.500 0.93 0.00 42.99 2.90
266 267 6.283694 ACTTCGCAGCTTGATATTTATCAGA 58.716 36.000 0.93 0.00 42.99 3.27
267 268 6.933521 ACTTCGCAGCTTGATATTTATCAGAT 59.066 34.615 0.93 0.00 42.99 2.90
268 269 6.957984 TCGCAGCTTGATATTTATCAGATC 57.042 37.500 0.93 0.00 42.99 2.75
269 270 6.695429 TCGCAGCTTGATATTTATCAGATCT 58.305 36.000 0.00 0.00 42.99 2.75
270 271 7.157347 TCGCAGCTTGATATTTATCAGATCTT 58.843 34.615 0.00 0.00 42.99 2.40
271 272 8.306761 TCGCAGCTTGATATTTATCAGATCTTA 58.693 33.333 0.00 0.00 42.99 2.10
272 273 8.929746 CGCAGCTTGATATTTATCAGATCTTAA 58.070 33.333 0.00 0.00 42.99 1.85
285 286 6.452494 TCAGATCTTAAGACGTCCTTTAGG 57.548 41.667 13.01 6.16 36.34 2.69
286 287 5.950549 TCAGATCTTAAGACGTCCTTTAGGT 59.049 40.000 13.01 5.66 36.34 3.08
287 288 6.037098 CAGATCTTAAGACGTCCTTTAGGTG 58.963 44.000 13.01 0.00 36.34 4.00
288 289 5.715753 AGATCTTAAGACGTCCTTTAGGTGT 59.284 40.000 13.01 1.88 36.34 4.16
289 290 5.382618 TCTTAAGACGTCCTTTAGGTGTC 57.617 43.478 13.01 12.78 39.88 3.67
290 291 5.075493 TCTTAAGACGTCCTTTAGGTGTCT 58.925 41.667 13.01 15.74 46.16 3.41
293 294 4.684484 AGACGTCCTTTAGGTGTCTTTT 57.316 40.909 13.01 1.72 43.83 2.27
294 295 5.032327 AGACGTCCTTTAGGTGTCTTTTT 57.968 39.130 13.01 1.47 43.83 1.94
314 315 4.364415 TTTTCCAAGAACAACCACTTCG 57.636 40.909 0.00 0.00 0.00 3.79
315 316 1.305201 TCCAAGAACAACCACTTCGC 58.695 50.000 0.00 0.00 0.00 4.70
316 317 1.021202 CCAAGAACAACCACTTCGCA 58.979 50.000 0.00 0.00 0.00 5.10
317 318 1.002468 CCAAGAACAACCACTTCGCAG 60.002 52.381 0.00 0.00 0.00 5.18
318 319 0.663153 AAGAACAACCACTTCGCAGC 59.337 50.000 0.00 0.00 0.00 5.25
319 320 0.179045 AGAACAACCACTTCGCAGCT 60.179 50.000 0.00 0.00 0.00 4.24
320 321 0.663153 GAACAACCACTTCGCAGCTT 59.337 50.000 0.00 0.00 0.00 3.74
321 322 0.381801 AACAACCACTTCGCAGCTTG 59.618 50.000 0.00 0.00 0.00 4.01
322 323 1.370900 CAACCACTTCGCAGCTTGC 60.371 57.895 0.00 0.00 40.69 4.01
323 324 1.823470 AACCACTTCGCAGCTTGCA 60.823 52.632 8.52 0.00 45.36 4.08
324 325 1.174712 AACCACTTCGCAGCTTGCAT 61.175 50.000 8.52 0.00 45.36 3.96
325 326 1.136147 CCACTTCGCAGCTTGCATC 59.864 57.895 8.52 0.00 45.36 3.91
326 327 1.303799 CCACTTCGCAGCTTGCATCT 61.304 55.000 8.52 0.00 45.36 2.90
327 328 0.179197 CACTTCGCAGCTTGCATCTG 60.179 55.000 11.01 11.01 45.36 2.90
328 329 0.321034 ACTTCGCAGCTTGCATCTGA 60.321 50.000 17.55 0.00 45.36 3.27
329 330 0.096628 CTTCGCAGCTTGCATCTGAC 59.903 55.000 17.55 9.53 45.36 3.51
330 331 1.629345 TTCGCAGCTTGCATCTGACG 61.629 55.000 17.55 17.83 45.36 4.35
331 332 2.099831 GCAGCTTGCATCTGACGC 59.900 61.111 17.55 0.00 44.26 5.19
332 333 2.396955 GCAGCTTGCATCTGACGCT 61.397 57.895 17.55 3.62 44.26 5.07
333 334 1.919956 GCAGCTTGCATCTGACGCTT 61.920 55.000 17.55 0.00 44.26 4.68
334 335 0.096628 CAGCTTGCATCTGACGCTTC 59.903 55.000 10.07 0.00 33.54 3.86
335 336 0.036577 AGCTTGCATCTGACGCTTCT 60.037 50.000 0.00 0.00 0.00 2.85
336 337 0.096628 GCTTGCATCTGACGCTTCTG 59.903 55.000 0.00 0.00 0.00 3.02
337 338 0.096628 CTTGCATCTGACGCTTCTGC 59.903 55.000 0.00 0.00 0.00 4.26
338 339 0.603439 TTGCATCTGACGCTTCTGCA 60.603 50.000 2.04 2.04 40.79 4.41
339 340 0.392060 TGCATCTGACGCTTCTGCAT 60.392 50.000 2.04 0.00 37.88 3.96
340 341 1.134729 TGCATCTGACGCTTCTGCATA 60.135 47.619 2.04 0.00 37.88 3.14
341 342 2.141517 GCATCTGACGCTTCTGCATAT 58.858 47.619 0.00 0.00 39.64 1.78
342 343 2.547211 GCATCTGACGCTTCTGCATATT 59.453 45.455 0.00 0.00 39.64 1.28
343 344 3.003068 GCATCTGACGCTTCTGCATATTT 59.997 43.478 0.00 0.00 39.64 1.40
344 345 4.497006 GCATCTGACGCTTCTGCATATTTT 60.497 41.667 0.00 0.00 39.64 1.82
345 346 4.864916 TCTGACGCTTCTGCATATTTTC 57.135 40.909 0.00 0.00 39.64 2.29
346 347 4.507710 TCTGACGCTTCTGCATATTTTCT 58.492 39.130 0.00 0.00 39.64 2.52
347 348 4.937620 TCTGACGCTTCTGCATATTTTCTT 59.062 37.500 0.00 0.00 39.64 2.52
348 349 5.412594 TCTGACGCTTCTGCATATTTTCTTT 59.587 36.000 0.00 0.00 39.64 2.52
349 350 5.631026 TGACGCTTCTGCATATTTTCTTTC 58.369 37.500 0.00 0.00 39.64 2.62
350 351 4.986622 ACGCTTCTGCATATTTTCTTTCC 58.013 39.130 0.00 0.00 39.64 3.13
351 352 4.702131 ACGCTTCTGCATATTTTCTTTCCT 59.298 37.500 0.00 0.00 39.64 3.36
352 353 5.183904 ACGCTTCTGCATATTTTCTTTCCTT 59.816 36.000 0.00 0.00 39.64 3.36
353 354 5.741040 CGCTTCTGCATATTTTCTTTCCTTC 59.259 40.000 0.00 0.00 39.64 3.46
354 355 5.741040 GCTTCTGCATATTTTCTTTCCTTCG 59.259 40.000 0.00 0.00 39.41 3.79
355 356 5.818136 TCTGCATATTTTCTTTCCTTCGG 57.182 39.130 0.00 0.00 0.00 4.30
356 357 5.253330 TCTGCATATTTTCTTTCCTTCGGT 58.747 37.500 0.00 0.00 0.00 4.69
357 358 5.123820 TCTGCATATTTTCTTTCCTTCGGTG 59.876 40.000 0.00 0.00 0.00 4.94
358 359 4.105486 GCATATTTTCTTTCCTTCGGTGC 58.895 43.478 0.00 0.00 0.00 5.01
359 360 4.672409 CATATTTTCTTTCCTTCGGTGCC 58.328 43.478 0.00 0.00 0.00 5.01
360 361 0.948678 TTTTCTTTCCTTCGGTGCCG 59.051 50.000 3.94 3.94 41.35 5.69
378 379 1.809684 CGAAAGGAGGAACTTGGACC 58.190 55.000 0.00 0.00 41.55 4.46
379 380 1.071699 CGAAAGGAGGAACTTGGACCA 59.928 52.381 0.00 0.00 41.55 4.02
380 381 2.784347 GAAAGGAGGAACTTGGACCAG 58.216 52.381 0.00 0.00 41.55 4.00
381 382 1.068121 AAGGAGGAACTTGGACCAGG 58.932 55.000 1.23 1.23 41.55 4.45
382 383 0.193574 AGGAGGAACTTGGACCAGGA 59.806 55.000 11.16 0.00 41.55 3.86
383 384 0.325272 GGAGGAACTTGGACCAGGAC 59.675 60.000 11.16 4.01 41.55 3.85
384 385 0.037232 GAGGAACTTGGACCAGGACG 60.037 60.000 11.16 0.00 41.55 4.79
385 386 1.003718 GGAACTTGGACCAGGACGG 60.004 63.158 11.16 0.00 42.50 4.79
386 387 1.477685 GGAACTTGGACCAGGACGGA 61.478 60.000 11.16 0.00 38.63 4.69
387 388 0.320508 GAACTTGGACCAGGACGGAC 60.321 60.000 11.16 0.00 38.63 4.79
391 392 2.926242 GGACCAGGACGGACCCAA 60.926 66.667 0.00 0.00 43.24 4.12
392 393 2.663196 GACCAGGACGGACCCAAG 59.337 66.667 0.00 0.00 40.05 3.61
393 394 1.911766 GACCAGGACGGACCCAAGA 60.912 63.158 0.00 0.00 40.05 3.02
394 395 1.460689 ACCAGGACGGACCCAAGAA 60.461 57.895 0.00 0.00 40.05 2.52
395 396 0.840722 ACCAGGACGGACCCAAGAAT 60.841 55.000 0.00 0.00 40.05 2.40
396 397 0.107654 CCAGGACGGACCCAAGAATC 60.108 60.000 0.00 0.00 40.05 2.52
397 398 0.107654 CAGGACGGACCCAAGAATCC 60.108 60.000 0.00 0.00 40.05 3.01
398 399 0.252742 AGGACGGACCCAAGAATCCT 60.253 55.000 0.00 0.00 40.05 3.24
399 400 0.107654 GGACGGACCCAAGAATCCTG 60.108 60.000 0.00 0.00 32.33 3.86
400 401 0.107654 GACGGACCCAAGAATCCTGG 60.108 60.000 0.00 0.00 32.33 4.45
401 402 1.452108 CGGACCCAAGAATCCTGGC 60.452 63.158 0.00 0.00 32.33 4.85
402 403 1.076705 GGACCCAAGAATCCTGGCC 60.077 63.158 0.00 0.00 31.75 5.36
403 404 1.575447 GGACCCAAGAATCCTGGCCT 61.575 60.000 3.32 0.00 31.75 5.19
404 405 0.394899 GACCCAAGAATCCTGGCCTG 60.395 60.000 3.32 2.54 0.00 4.85
405 406 1.076485 CCCAAGAATCCTGGCCTGG 60.076 63.158 22.36 22.36 0.00 4.45
406 407 1.755783 CCAAGAATCCTGGCCTGGC 60.756 63.158 23.46 11.05 0.00 4.85
407 408 1.000521 CAAGAATCCTGGCCTGGCA 60.001 57.895 23.46 12.81 0.00 4.92
408 409 0.612732 CAAGAATCCTGGCCTGGCAA 60.613 55.000 23.46 8.66 0.00 4.52
409 410 0.337428 AAGAATCCTGGCCTGGCAAT 59.663 50.000 23.46 10.28 0.00 3.56
410 411 0.396695 AGAATCCTGGCCTGGCAATG 60.397 55.000 23.46 6.50 0.00 2.82
411 412 1.382146 AATCCTGGCCTGGCAATGG 60.382 57.895 23.46 17.86 0.00 3.16
432 433 2.592194 CATGCATGCAAGTCAGTCAAC 58.408 47.619 26.68 0.00 0.00 3.18
433 434 1.971481 TGCATGCAAGTCAGTCAACT 58.029 45.000 20.30 0.00 0.00 3.16
434 435 3.124578 TGCATGCAAGTCAGTCAACTA 57.875 42.857 20.30 0.00 0.00 2.24
435 436 2.807967 TGCATGCAAGTCAGTCAACTAC 59.192 45.455 20.30 0.00 0.00 2.73
436 437 3.070018 GCATGCAAGTCAGTCAACTACT 58.930 45.455 14.21 0.00 39.81 2.57
437 438 4.245660 GCATGCAAGTCAGTCAACTACTA 58.754 43.478 14.21 0.00 35.76 1.82
438 439 4.328440 GCATGCAAGTCAGTCAACTACTAG 59.672 45.833 14.21 0.00 35.76 2.57
439 440 5.473931 CATGCAAGTCAGTCAACTACTAGT 58.526 41.667 0.00 0.00 35.76 2.57
440 441 4.871513 TGCAAGTCAGTCAACTACTAGTG 58.128 43.478 5.39 0.00 35.76 2.74
441 442 3.675698 GCAAGTCAGTCAACTACTAGTGC 59.324 47.826 5.39 0.00 35.76 4.40
442 443 4.796290 GCAAGTCAGTCAACTACTAGTGCA 60.796 45.833 5.39 0.00 35.76 4.57
443 444 4.775058 AGTCAGTCAACTACTAGTGCAG 57.225 45.455 5.39 0.00 35.76 4.41
444 445 4.145807 AGTCAGTCAACTACTAGTGCAGT 58.854 43.478 5.39 0.00 41.62 4.40
445 446 4.585162 AGTCAGTCAACTACTAGTGCAGTT 59.415 41.667 5.39 5.38 38.80 3.16
446 447 5.069251 AGTCAGTCAACTACTAGTGCAGTTT 59.931 40.000 5.39 0.00 38.80 2.66
447 448 5.753921 GTCAGTCAACTACTAGTGCAGTTTT 59.246 40.000 5.39 0.00 38.80 2.43
448 449 5.983720 TCAGTCAACTACTAGTGCAGTTTTC 59.016 40.000 5.39 4.08 38.80 2.29
449 450 5.177696 CAGTCAACTACTAGTGCAGTTTTCC 59.822 44.000 5.39 0.00 38.80 3.13
450 451 5.070580 AGTCAACTACTAGTGCAGTTTTCCT 59.929 40.000 5.39 1.39 38.80 3.36
451 452 5.405873 GTCAACTACTAGTGCAGTTTTCCTC 59.594 44.000 5.39 0.00 38.80 3.71
452 453 4.538746 ACTACTAGTGCAGTTTTCCTCC 57.461 45.455 5.39 0.00 38.80 4.30
453 454 3.901844 ACTACTAGTGCAGTTTTCCTCCA 59.098 43.478 5.39 0.00 38.80 3.86
454 455 3.857157 ACTAGTGCAGTTTTCCTCCAA 57.143 42.857 0.00 0.00 31.59 3.53
455 456 4.164843 ACTAGTGCAGTTTTCCTCCAAA 57.835 40.909 0.00 0.00 31.59 3.28
456 457 3.883489 ACTAGTGCAGTTTTCCTCCAAAC 59.117 43.478 0.00 0.00 36.97 2.93
457 458 1.676006 AGTGCAGTTTTCCTCCAAACG 59.324 47.619 0.00 0.00 40.92 3.60
458 459 1.673920 GTGCAGTTTTCCTCCAAACGA 59.326 47.619 0.00 0.00 40.92 3.85
459 460 1.673920 TGCAGTTTTCCTCCAAACGAC 59.326 47.619 0.00 0.00 40.92 4.34
460 461 1.947456 GCAGTTTTCCTCCAAACGACT 59.053 47.619 0.00 0.00 40.92 4.18
461 462 3.135994 GCAGTTTTCCTCCAAACGACTA 58.864 45.455 0.00 0.00 40.92 2.59
462 463 3.059120 GCAGTTTTCCTCCAAACGACTAC 60.059 47.826 0.00 0.00 40.92 2.73
463 464 4.124238 CAGTTTTCCTCCAAACGACTACA 58.876 43.478 0.00 0.00 40.92 2.74
464 465 4.211374 CAGTTTTCCTCCAAACGACTACAG 59.789 45.833 0.00 0.00 40.92 2.74
465 466 4.100498 AGTTTTCCTCCAAACGACTACAGA 59.900 41.667 0.00 0.00 40.92 3.41
466 467 4.675976 TTTCCTCCAAACGACTACAGAA 57.324 40.909 0.00 0.00 0.00 3.02
467 468 4.884668 TTCCTCCAAACGACTACAGAAT 57.115 40.909 0.00 0.00 0.00 2.40
468 469 4.884668 TCCTCCAAACGACTACAGAATT 57.115 40.909 0.00 0.00 0.00 2.17
469 470 5.988310 TCCTCCAAACGACTACAGAATTA 57.012 39.130 0.00 0.00 0.00 1.40
470 471 6.349243 TCCTCCAAACGACTACAGAATTAA 57.651 37.500 0.00 0.00 0.00 1.40
471 472 6.761312 TCCTCCAAACGACTACAGAATTAAA 58.239 36.000 0.00 0.00 0.00 1.52
472 473 6.872020 TCCTCCAAACGACTACAGAATTAAAG 59.128 38.462 0.00 0.00 0.00 1.85
473 474 6.649557 CCTCCAAACGACTACAGAATTAAAGT 59.350 38.462 0.00 0.00 0.00 2.66
474 475 7.816031 CCTCCAAACGACTACAGAATTAAAGTA 59.184 37.037 0.00 0.00 0.00 2.24
475 476 9.199982 CTCCAAACGACTACAGAATTAAAGTAA 57.800 33.333 0.00 0.00 0.00 2.24
476 477 9.199982 TCCAAACGACTACAGAATTAAAGTAAG 57.800 33.333 0.00 0.00 0.00 2.34
477 478 8.985805 CCAAACGACTACAGAATTAAAGTAAGT 58.014 33.333 0.00 0.00 0.00 2.24
487 488 9.379791 ACAGAATTAAAGTAAGTAATAAGCGCT 57.620 29.630 2.64 2.64 0.00 5.92
495 496 9.908152 AAAGTAAGTAATAAGCGCTTCAAAATT 57.092 25.926 28.82 21.88 0.00 1.82
496 497 9.908152 AAGTAAGTAATAAGCGCTTCAAAATTT 57.092 25.926 28.82 16.73 0.00 1.82
501 502 9.983804 AGTAATAAGCGCTTCAAAATTTACTAC 57.016 29.630 28.82 14.49 0.00 2.73
502 503 9.983804 GTAATAAGCGCTTCAAAATTTACTACT 57.016 29.630 28.82 0.00 0.00 2.57
504 505 9.983804 AATAAGCGCTTCAAAATTTACTACTAC 57.016 29.630 28.82 0.00 0.00 2.73
505 506 6.418585 AGCGCTTCAAAATTTACTACTACC 57.581 37.500 2.64 0.00 0.00 3.18
506 507 5.935789 AGCGCTTCAAAATTTACTACTACCA 59.064 36.000 2.64 0.00 0.00 3.25
507 508 6.092259 AGCGCTTCAAAATTTACTACTACCAG 59.908 38.462 2.64 0.00 0.00 4.00
508 509 6.091713 GCGCTTCAAAATTTACTACTACCAGA 59.908 38.462 0.00 0.00 0.00 3.86
509 510 7.674240 GCGCTTCAAAATTTACTACTACCAGAG 60.674 40.741 0.00 0.00 0.00 3.35
510 511 7.544566 CGCTTCAAAATTTACTACTACCAGAGA 59.455 37.037 0.00 0.00 0.00 3.10
511 512 9.216117 GCTTCAAAATTTACTACTACCAGAGAA 57.784 33.333 0.00 0.00 0.00 2.87
519 520 9.945904 ATTTACTACTACCAGAGAAAAGAAAGG 57.054 33.333 0.00 0.00 0.00 3.11
520 521 8.716674 TTACTACTACCAGAGAAAAGAAAGGA 57.283 34.615 0.00 0.00 0.00 3.36
521 522 7.234661 ACTACTACCAGAGAAAAGAAAGGAG 57.765 40.000 0.00 0.00 0.00 3.69
522 523 7.011382 ACTACTACCAGAGAAAAGAAAGGAGA 58.989 38.462 0.00 0.00 0.00 3.71
523 524 6.749036 ACTACCAGAGAAAAGAAAGGAGAA 57.251 37.500 0.00 0.00 0.00 2.87
524 525 7.138054 ACTACCAGAGAAAAGAAAGGAGAAA 57.862 36.000 0.00 0.00 0.00 2.52
525 526 7.574607 ACTACCAGAGAAAAGAAAGGAGAAAA 58.425 34.615 0.00 0.00 0.00 2.29
526 527 8.053355 ACTACCAGAGAAAAGAAAGGAGAAAAA 58.947 33.333 0.00 0.00 0.00 1.94
527 528 7.101652 ACCAGAGAAAAGAAAGGAGAAAAAC 57.898 36.000 0.00 0.00 0.00 2.43
528 529 6.663523 ACCAGAGAAAAGAAAGGAGAAAAACA 59.336 34.615 0.00 0.00 0.00 2.83
529 530 7.178451 ACCAGAGAAAAGAAAGGAGAAAAACAA 59.822 33.333 0.00 0.00 0.00 2.83
530 531 7.704047 CCAGAGAAAAGAAAGGAGAAAAACAAG 59.296 37.037 0.00 0.00 0.00 3.16
531 532 7.221645 CAGAGAAAAGAAAGGAGAAAAACAAGC 59.778 37.037 0.00 0.00 0.00 4.01
532 533 6.341316 AGAAAAGAAAGGAGAAAAACAAGCC 58.659 36.000 0.00 0.00 0.00 4.35
533 534 4.672587 AAGAAAGGAGAAAAACAAGCCC 57.327 40.909 0.00 0.00 0.00 5.19
534 535 2.623416 AGAAAGGAGAAAAACAAGCCCG 59.377 45.455 0.00 0.00 0.00 6.13
535 536 1.328279 AAGGAGAAAAACAAGCCCGG 58.672 50.000 0.00 0.00 0.00 5.73
536 537 0.539669 AGGAGAAAAACAAGCCCGGG 60.540 55.000 19.09 19.09 0.00 5.73
537 538 1.289066 GAGAAAAACAAGCCCGGGC 59.711 57.895 39.29 39.29 42.33 6.13
551 552 3.890674 GGGCTCTACCGTGCAAAG 58.109 61.111 0.00 0.00 40.62 2.77
552 553 2.399356 GGGCTCTACCGTGCAAAGC 61.399 63.158 0.00 0.00 40.62 3.51
553 554 1.376037 GGCTCTACCGTGCAAAGCT 60.376 57.895 0.00 0.00 33.50 3.74
554 555 0.955919 GGCTCTACCGTGCAAAGCTT 60.956 55.000 0.00 0.00 33.50 3.74
555 556 0.875059 GCTCTACCGTGCAAAGCTTT 59.125 50.000 5.69 5.69 0.00 3.51
556 557 1.400242 GCTCTACCGTGCAAAGCTTTG 60.400 52.381 30.70 30.70 41.03 2.77
569 570 2.498644 AGCTTTGCTTCCTTCCTACC 57.501 50.000 0.00 0.00 33.89 3.18
570 571 1.004862 AGCTTTGCTTCCTTCCTACCC 59.995 52.381 0.00 0.00 33.89 3.69
571 572 1.004862 GCTTTGCTTCCTTCCTACCCT 59.995 52.381 0.00 0.00 0.00 4.34
572 573 2.555448 GCTTTGCTTCCTTCCTACCCTT 60.555 50.000 0.00 0.00 0.00 3.95
573 574 2.879103 TTGCTTCCTTCCTACCCTTG 57.121 50.000 0.00 0.00 0.00 3.61
574 575 2.038863 TGCTTCCTTCCTACCCTTGA 57.961 50.000 0.00 0.00 0.00 3.02
575 576 2.344592 TGCTTCCTTCCTACCCTTGAA 58.655 47.619 0.00 0.00 0.00 2.69
576 577 2.305927 TGCTTCCTTCCTACCCTTGAAG 59.694 50.000 0.00 0.00 38.14 3.02
577 578 2.572104 GCTTCCTTCCTACCCTTGAAGA 59.428 50.000 0.00 0.00 40.30 2.87
578 579 3.009143 GCTTCCTTCCTACCCTTGAAGAA 59.991 47.826 0.00 0.00 40.30 2.52
579 580 4.580868 CTTCCTTCCTACCCTTGAAGAAC 58.419 47.826 0.00 0.00 40.30 3.01
580 581 2.910977 TCCTTCCTACCCTTGAAGAACC 59.089 50.000 0.00 0.00 40.30 3.62
581 582 2.642807 CCTTCCTACCCTTGAAGAACCA 59.357 50.000 0.00 0.00 40.30 3.67
582 583 3.073946 CCTTCCTACCCTTGAAGAACCAA 59.926 47.826 0.00 0.00 40.30 3.67
583 584 3.782656 TCCTACCCTTGAAGAACCAAC 57.217 47.619 0.00 0.00 0.00 3.77
584 585 2.374170 TCCTACCCTTGAAGAACCAACC 59.626 50.000 0.00 0.00 0.00 3.77
585 586 2.375509 CCTACCCTTGAAGAACCAACCT 59.624 50.000 0.00 0.00 0.00 3.50
586 587 2.658807 ACCCTTGAAGAACCAACCTC 57.341 50.000 0.00 0.00 0.00 3.85
587 588 1.202770 ACCCTTGAAGAACCAACCTCG 60.203 52.381 0.00 0.00 0.00 4.63
588 589 0.875059 CCTTGAAGAACCAACCTCGC 59.125 55.000 0.00 0.00 0.00 5.03
589 590 0.875059 CTTGAAGAACCAACCTCGCC 59.125 55.000 0.00 0.00 0.00 5.54
590 591 0.181587 TTGAAGAACCAACCTCGCCA 59.818 50.000 0.00 0.00 0.00 5.69
591 592 0.250295 TGAAGAACCAACCTCGCCAG 60.250 55.000 0.00 0.00 0.00 4.85
592 593 0.250338 GAAGAACCAACCTCGCCAGT 60.250 55.000 0.00 0.00 0.00 4.00
593 594 0.182775 AAGAACCAACCTCGCCAGTT 59.817 50.000 0.00 0.00 0.00 3.16
594 595 0.250338 AGAACCAACCTCGCCAGTTC 60.250 55.000 0.00 0.00 37.65 3.01
595 596 0.534203 GAACCAACCTCGCCAGTTCA 60.534 55.000 0.00 0.00 37.39 3.18
596 597 0.818040 AACCAACCTCGCCAGTTCAC 60.818 55.000 0.00 0.00 0.00 3.18
597 598 1.966451 CCAACCTCGCCAGTTCACC 60.966 63.158 0.00 0.00 0.00 4.02
598 599 1.227823 CAACCTCGCCAGTTCACCA 60.228 57.895 0.00 0.00 0.00 4.17
599 600 1.071471 AACCTCGCCAGTTCACCAG 59.929 57.895 0.00 0.00 0.00 4.00
600 601 1.407656 AACCTCGCCAGTTCACCAGA 61.408 55.000 0.00 0.00 0.00 3.86
601 602 1.371183 CCTCGCCAGTTCACCAGAA 59.629 57.895 0.00 0.00 0.00 3.02
602 603 0.250295 CCTCGCCAGTTCACCAGAAA 60.250 55.000 0.00 0.00 35.08 2.52
603 604 1.593196 CTCGCCAGTTCACCAGAAAA 58.407 50.000 0.00 0.00 35.08 2.29
604 605 1.946768 CTCGCCAGTTCACCAGAAAAA 59.053 47.619 0.00 0.00 35.08 1.94
605 606 1.673920 TCGCCAGTTCACCAGAAAAAC 59.326 47.619 0.00 0.00 35.08 2.43
606 607 1.676006 CGCCAGTTCACCAGAAAAACT 59.324 47.619 0.00 0.00 35.08 2.66
607 608 2.541588 CGCCAGTTCACCAGAAAAACTG 60.542 50.000 7.35 7.35 45.99 3.16
608 609 2.799562 GCCAGTTCACCAGAAAAACTGC 60.800 50.000 8.57 2.35 45.39 4.40
609 610 2.426738 CCAGTTCACCAGAAAAACTGCA 59.573 45.455 8.57 0.00 45.39 4.41
610 611 3.119173 CCAGTTCACCAGAAAAACTGCAA 60.119 43.478 8.57 0.00 45.39 4.08
611 612 3.859386 CAGTTCACCAGAAAAACTGCAAC 59.141 43.478 1.96 0.00 42.23 4.17
612 613 2.842208 TCACCAGAAAAACTGCAACG 57.158 45.000 0.00 0.00 44.52 4.10
613 614 1.403679 TCACCAGAAAAACTGCAACGG 59.596 47.619 0.00 0.00 44.52 4.44
614 615 1.403679 CACCAGAAAAACTGCAACGGA 59.596 47.619 0.00 0.00 44.52 4.69
615 616 1.676006 ACCAGAAAAACTGCAACGGAG 59.324 47.619 0.00 0.00 44.52 4.63
616 617 1.001378 CCAGAAAAACTGCAACGGAGG 60.001 52.381 0.00 0.00 44.52 4.30
617 618 1.676006 CAGAAAAACTGCAACGGAGGT 59.324 47.619 0.00 0.00 39.86 3.85
618 619 2.099098 CAGAAAAACTGCAACGGAGGTT 59.901 45.455 0.00 0.00 39.86 3.50
619 620 2.357952 AGAAAAACTGCAACGGAGGTTC 59.642 45.455 0.00 0.00 32.98 3.62
620 621 2.052782 AAAACTGCAACGGAGGTTCT 57.947 45.000 0.00 0.00 32.98 3.01
621 622 2.052782 AAACTGCAACGGAGGTTCTT 57.947 45.000 0.00 0.00 32.98 2.52
622 623 2.052782 AACTGCAACGGAGGTTCTTT 57.947 45.000 0.00 0.00 32.98 2.52
623 624 2.052782 ACTGCAACGGAGGTTCTTTT 57.947 45.000 0.00 0.00 32.98 2.27
624 625 1.676006 ACTGCAACGGAGGTTCTTTTG 59.324 47.619 0.00 0.00 32.98 2.44
625 626 0.383949 TGCAACGGAGGTTCTTTTGC 59.616 50.000 0.00 0.00 42.37 3.68
626 627 0.383949 GCAACGGAGGTTCTTTTGCA 59.616 50.000 0.00 0.00 41.77 4.08
627 628 1.600413 GCAACGGAGGTTCTTTTGCAG 60.600 52.381 0.00 0.00 41.77 4.41
628 629 1.676006 CAACGGAGGTTCTTTTGCAGT 59.324 47.619 0.00 0.00 32.98 4.40
629 630 2.052782 ACGGAGGTTCTTTTGCAGTT 57.947 45.000 0.00 0.00 0.00 3.16
630 631 2.375146 ACGGAGGTTCTTTTGCAGTTT 58.625 42.857 0.00 0.00 0.00 2.66
631 632 2.357952 ACGGAGGTTCTTTTGCAGTTTC 59.642 45.455 0.00 0.00 0.00 2.78
632 633 2.602217 CGGAGGTTCTTTTGCAGTTTCG 60.602 50.000 0.00 0.00 0.00 3.46
633 634 2.385315 GAGGTTCTTTTGCAGTTTCGC 58.615 47.619 0.00 0.00 0.00 4.70
634 635 2.024414 AGGTTCTTTTGCAGTTTCGCT 58.976 42.857 0.00 0.00 0.00 4.93
635 636 2.427095 AGGTTCTTTTGCAGTTTCGCTT 59.573 40.909 0.00 0.00 0.00 4.68
636 637 2.789339 GGTTCTTTTGCAGTTTCGCTTC 59.211 45.455 0.00 0.00 0.00 3.86
637 638 3.489229 GGTTCTTTTGCAGTTTCGCTTCT 60.489 43.478 0.00 0.00 0.00 2.85
638 639 4.105486 GTTCTTTTGCAGTTTCGCTTCTT 58.895 39.130 0.00 0.00 0.00 2.52
639 640 4.370364 TCTTTTGCAGTTTCGCTTCTTT 57.630 36.364 0.00 0.00 0.00 2.52
640 641 4.351192 TCTTTTGCAGTTTCGCTTCTTTC 58.649 39.130 0.00 0.00 0.00 2.62
641 642 3.773860 TTTGCAGTTTCGCTTCTTTCA 57.226 38.095 0.00 0.00 0.00 2.69
642 643 3.988379 TTGCAGTTTCGCTTCTTTCAT 57.012 38.095 0.00 0.00 0.00 2.57
643 644 3.542712 TGCAGTTTCGCTTCTTTCATC 57.457 42.857 0.00 0.00 0.00 2.92
644 645 3.141398 TGCAGTTTCGCTTCTTTCATCT 58.859 40.909 0.00 0.00 0.00 2.90
645 646 3.058708 TGCAGTTTCGCTTCTTTCATCTG 60.059 43.478 0.00 0.00 0.00 2.90
646 647 3.187227 GCAGTTTCGCTTCTTTCATCTGA 59.813 43.478 0.00 0.00 0.00 3.27
647 648 4.319766 GCAGTTTCGCTTCTTTCATCTGAA 60.320 41.667 0.00 0.00 0.00 3.02
648 649 5.618640 GCAGTTTCGCTTCTTTCATCTGAAT 60.619 40.000 0.00 0.00 33.54 2.57
649 650 6.020372 CAGTTTCGCTTCTTTCATCTGAATC 58.980 40.000 0.00 0.00 33.54 2.52
650 651 5.936956 AGTTTCGCTTCTTTCATCTGAATCT 59.063 36.000 0.00 0.00 33.54 2.40
651 652 6.429385 AGTTTCGCTTCTTTCATCTGAATCTT 59.571 34.615 0.00 0.00 33.54 2.40
652 653 6.414408 TTCGCTTCTTTCATCTGAATCTTC 57.586 37.500 0.00 0.00 33.54 2.87
653 654 5.482006 TCGCTTCTTTCATCTGAATCTTCA 58.518 37.500 0.00 0.00 33.54 3.02
654 655 6.111382 TCGCTTCTTTCATCTGAATCTTCAT 58.889 36.000 0.00 0.00 36.46 2.57
655 656 6.036844 TCGCTTCTTTCATCTGAATCTTCATG 59.963 38.462 0.00 0.00 36.46 3.07
656 657 5.972382 GCTTCTTTCATCTGAATCTTCATGC 59.028 40.000 0.00 0.00 36.46 4.06
657 658 6.446781 TTCTTTCATCTGAATCTTCATGCC 57.553 37.500 0.00 0.00 36.46 4.40
658 659 5.503002 TCTTTCATCTGAATCTTCATGCCA 58.497 37.500 0.00 0.00 36.46 4.92
659 660 6.127101 TCTTTCATCTGAATCTTCATGCCAT 58.873 36.000 0.00 0.00 36.46 4.40
660 661 6.262496 TCTTTCATCTGAATCTTCATGCCATC 59.738 38.462 0.00 0.00 36.46 3.51
661 662 5.306114 TCATCTGAATCTTCATGCCATCT 57.694 39.130 0.00 0.00 36.46 2.90
662 663 5.306394 TCATCTGAATCTTCATGCCATCTC 58.694 41.667 0.00 0.00 36.46 2.75
663 664 4.765813 TCTGAATCTTCATGCCATCTCA 57.234 40.909 0.00 0.00 36.46 3.27
664 665 4.704965 TCTGAATCTTCATGCCATCTCAG 58.295 43.478 7.31 7.31 36.46 3.35
665 666 4.407945 TCTGAATCTTCATGCCATCTCAGA 59.592 41.667 10.66 10.66 36.59 3.27
666 667 4.704965 TGAATCTTCATGCCATCTCAGAG 58.295 43.478 0.00 0.00 31.01 3.35
667 668 4.163649 TGAATCTTCATGCCATCTCAGAGT 59.836 41.667 0.00 0.00 31.01 3.24
668 669 4.774660 ATCTTCATGCCATCTCAGAGTT 57.225 40.909 0.00 0.00 0.00 3.01
669 670 5.883685 ATCTTCATGCCATCTCAGAGTTA 57.116 39.130 0.00 0.00 0.00 2.24
670 671 5.016051 TCTTCATGCCATCTCAGAGTTAC 57.984 43.478 0.00 0.00 0.00 2.50
671 672 3.443099 TCATGCCATCTCAGAGTTACG 57.557 47.619 0.00 0.00 0.00 3.18
672 673 1.863454 CATGCCATCTCAGAGTTACGC 59.137 52.381 0.00 0.00 0.00 4.42
673 674 0.179137 TGCCATCTCAGAGTTACGCG 60.179 55.000 3.53 3.53 0.00 6.01
674 675 0.872021 GCCATCTCAGAGTTACGCGG 60.872 60.000 12.47 0.00 0.00 6.46
675 676 0.456221 CCATCTCAGAGTTACGCGGT 59.544 55.000 12.47 0.00 0.00 5.68
676 677 1.135083 CCATCTCAGAGTTACGCGGTT 60.135 52.381 12.47 0.00 0.00 4.44
677 678 2.607187 CATCTCAGAGTTACGCGGTTT 58.393 47.619 12.47 0.00 0.00 3.27
678 679 2.060326 TCTCAGAGTTACGCGGTTTG 57.940 50.000 12.47 0.00 0.00 2.93
679 680 1.610038 TCTCAGAGTTACGCGGTTTGA 59.390 47.619 12.47 4.50 0.00 2.69
680 681 1.986378 CTCAGAGTTACGCGGTTTGAG 59.014 52.381 12.47 10.61 0.00 3.02
681 682 0.438830 CAGAGTTACGCGGTTTGAGC 59.561 55.000 12.47 0.00 0.00 4.26
682 683 0.032952 AGAGTTACGCGGTTTGAGCA 59.967 50.000 12.47 0.00 34.19 4.26
683 684 0.863144 GAGTTACGCGGTTTGAGCAA 59.137 50.000 12.47 0.00 34.19 3.91
684 685 1.463444 GAGTTACGCGGTTTGAGCAAT 59.537 47.619 12.47 0.00 34.19 3.56
685 686 1.463444 AGTTACGCGGTTTGAGCAATC 59.537 47.619 12.47 0.00 34.19 2.67
686 687 1.463444 GTTACGCGGTTTGAGCAATCT 59.537 47.619 12.47 0.00 34.19 2.40
687 688 1.075542 TACGCGGTTTGAGCAATCTG 58.924 50.000 12.47 0.00 34.19 2.90
688 689 1.512734 CGCGGTTTGAGCAATCTGC 60.513 57.895 12.75 12.75 45.46 4.26
732 733 9.492973 TTTATTATAAAGTACAACGGATAGGGC 57.507 33.333 0.00 0.00 0.00 5.19
733 734 6.482898 TTATAAAGTACAACGGATAGGGCA 57.517 37.500 0.00 0.00 0.00 5.36
734 735 3.926058 AAAGTACAACGGATAGGGCAT 57.074 42.857 0.00 0.00 0.00 4.40
735 736 6.675413 ATAAAGTACAACGGATAGGGCATA 57.325 37.500 0.00 0.00 0.00 3.14
736 737 5.562298 AAAGTACAACGGATAGGGCATAT 57.438 39.130 0.00 0.00 0.00 1.78
737 738 5.562298 AAGTACAACGGATAGGGCATATT 57.438 39.130 0.00 0.00 0.00 1.28
738 739 5.562298 AGTACAACGGATAGGGCATATTT 57.438 39.130 0.00 0.00 0.00 1.40
739 740 5.305585 AGTACAACGGATAGGGCATATTTG 58.694 41.667 0.00 0.00 0.00 2.32
740 741 4.431416 ACAACGGATAGGGCATATTTGA 57.569 40.909 8.55 0.00 0.00 2.69
741 742 4.134563 ACAACGGATAGGGCATATTTGAC 58.865 43.478 8.55 0.00 0.00 3.18
742 743 4.141482 ACAACGGATAGGGCATATTTGACT 60.141 41.667 8.55 0.00 0.00 3.41
743 744 5.071250 ACAACGGATAGGGCATATTTGACTA 59.929 40.000 8.55 0.00 0.00 2.59
744 745 5.407407 ACGGATAGGGCATATTTGACTAG 57.593 43.478 0.00 0.00 0.00 2.57
745 746 4.223032 ACGGATAGGGCATATTTGACTAGG 59.777 45.833 0.00 0.00 0.00 3.02
746 747 4.466370 CGGATAGGGCATATTTGACTAGGA 59.534 45.833 0.00 0.00 0.00 2.94
747 748 5.046591 CGGATAGGGCATATTTGACTAGGAA 60.047 44.000 0.00 0.00 0.00 3.36
748 749 6.352222 CGGATAGGGCATATTTGACTAGGAAT 60.352 42.308 0.00 0.00 0.00 3.01
749 750 7.147724 CGGATAGGGCATATTTGACTAGGAATA 60.148 40.741 0.00 0.00 0.00 1.75
750 751 8.548877 GGATAGGGCATATTTGACTAGGAATAA 58.451 37.037 0.00 0.00 0.00 1.40
751 752 9.606631 GATAGGGCATATTTGACTAGGAATAAG 57.393 37.037 0.00 0.00 0.00 1.73
752 753 6.241645 AGGGCATATTTGACTAGGAATAAGC 58.758 40.000 11.37 11.37 33.83 3.09
753 754 6.003950 GGGCATATTTGACTAGGAATAAGCA 58.996 40.000 17.10 0.00 35.36 3.91
754 755 6.490040 GGGCATATTTGACTAGGAATAAGCAA 59.510 38.462 17.10 0.00 35.36 3.91
755 756 7.308830 GGGCATATTTGACTAGGAATAAGCAAG 60.309 40.741 17.10 0.00 35.36 4.01
756 757 7.080724 GCATATTTGACTAGGAATAAGCAAGC 58.919 38.462 13.41 0.00 34.40 4.01
757 758 7.255242 GCATATTTGACTAGGAATAAGCAAGCA 60.255 37.037 13.41 0.00 34.40 3.91
758 759 8.623903 CATATTTGACTAGGAATAAGCAAGCAA 58.376 33.333 0.00 0.00 0.00 3.91
759 760 6.892658 TTTGACTAGGAATAAGCAAGCAAA 57.107 33.333 0.00 0.00 0.00 3.68
760 761 6.500684 TTGACTAGGAATAAGCAAGCAAAG 57.499 37.500 0.00 0.00 0.00 2.77
761 762 4.396166 TGACTAGGAATAAGCAAGCAAAGC 59.604 41.667 0.00 0.00 0.00 3.51
762 763 4.335416 ACTAGGAATAAGCAAGCAAAGCA 58.665 39.130 0.00 0.00 0.00 3.91
763 764 4.766891 ACTAGGAATAAGCAAGCAAAGCAA 59.233 37.500 0.00 0.00 0.00 3.91
764 765 4.184079 AGGAATAAGCAAGCAAAGCAAG 57.816 40.909 0.00 0.00 0.00 4.01
765 766 3.575687 AGGAATAAGCAAGCAAAGCAAGT 59.424 39.130 0.00 0.00 0.00 3.16
766 767 3.922850 GGAATAAGCAAGCAAAGCAAGTC 59.077 43.478 0.00 0.00 0.00 3.01
767 768 3.582714 ATAAGCAAGCAAAGCAAGTCC 57.417 42.857 0.00 0.00 0.00 3.85
768 769 0.390492 AAGCAAGCAAAGCAAGTCCC 59.610 50.000 0.00 0.00 0.00 4.46
769 770 0.468771 AGCAAGCAAAGCAAGTCCCT 60.469 50.000 0.00 0.00 0.00 4.20
770 771 1.202927 AGCAAGCAAAGCAAGTCCCTA 60.203 47.619 0.00 0.00 0.00 3.53
771 772 1.821136 GCAAGCAAAGCAAGTCCCTAT 59.179 47.619 0.00 0.00 0.00 2.57
772 773 3.016736 GCAAGCAAAGCAAGTCCCTATA 58.983 45.455 0.00 0.00 0.00 1.31
773 774 3.065925 GCAAGCAAAGCAAGTCCCTATAG 59.934 47.826 0.00 0.00 0.00 1.31
774 775 3.567478 AGCAAAGCAAGTCCCTATAGG 57.433 47.619 12.27 12.27 0.00 2.57
788 789 3.989056 CCTATAGGGATCCTCCTCCTTC 58.011 54.545 12.58 0.00 38.30 3.46
789 790 3.338214 CCTATAGGGATCCTCCTCCTTCA 59.662 52.174 12.58 0.00 38.30 3.02
790 791 2.777459 TAGGGATCCTCCTCCTTCAC 57.223 55.000 12.58 0.00 38.30 3.18
791 792 0.030603 AGGGATCCTCCTCCTTCACC 60.031 60.000 12.58 0.00 36.57 4.02
792 793 0.326618 GGGATCCTCCTCCTTCACCA 60.327 60.000 12.58 0.00 36.57 4.17
793 794 1.697291 GGGATCCTCCTCCTTCACCAT 60.697 57.143 12.58 0.00 36.57 3.55
794 795 2.131023 GGATCCTCCTCCTTCACCATT 58.869 52.381 3.84 0.00 32.53 3.16
795 796 2.511637 GGATCCTCCTCCTTCACCATTT 59.488 50.000 3.84 0.00 32.53 2.32
796 797 3.549794 GATCCTCCTCCTTCACCATTTG 58.450 50.000 0.00 0.00 0.00 2.32
797 798 1.635487 TCCTCCTCCTTCACCATTTGG 59.365 52.381 0.00 0.00 42.17 3.28
811 812 4.510038 CCATTTGGTATGCTTATGCTCC 57.490 45.455 1.96 3.30 40.48 4.70
812 813 3.256631 CCATTTGGTATGCTTATGCTCCC 59.743 47.826 1.96 0.40 40.48 4.30
813 814 2.656947 TTGGTATGCTTATGCTCCCC 57.343 50.000 1.96 0.08 40.48 4.81
814 815 1.819753 TGGTATGCTTATGCTCCCCT 58.180 50.000 1.96 0.00 40.48 4.79
815 816 1.421268 TGGTATGCTTATGCTCCCCTG 59.579 52.381 1.96 0.00 40.48 4.45
816 817 1.528129 GTATGCTTATGCTCCCCTGC 58.472 55.000 1.96 0.00 40.48 4.85
817 818 0.401738 TATGCTTATGCTCCCCTGCC 59.598 55.000 1.96 0.00 40.48 4.85
818 819 1.648302 ATGCTTATGCTCCCCTGCCA 61.648 55.000 1.96 0.00 40.48 4.92
819 820 1.152368 GCTTATGCTCCCCTGCCAT 59.848 57.895 0.00 0.00 36.03 4.40
820 821 1.177256 GCTTATGCTCCCCTGCCATG 61.177 60.000 0.00 0.00 36.03 3.66
821 822 0.475475 CTTATGCTCCCCTGCCATGA 59.525 55.000 0.00 0.00 0.00 3.07
822 823 0.925558 TTATGCTCCCCTGCCATGAA 59.074 50.000 0.00 0.00 0.00 2.57
823 824 0.475475 TATGCTCCCCTGCCATGAAG 59.525 55.000 0.00 0.00 0.00 3.02
824 825 1.578215 ATGCTCCCCTGCCATGAAGT 61.578 55.000 0.00 0.00 0.00 3.01
825 826 0.913934 TGCTCCCCTGCCATGAAGTA 60.914 55.000 0.00 0.00 0.00 2.24
826 827 0.475906 GCTCCCCTGCCATGAAGTAT 59.524 55.000 0.00 0.00 0.00 2.12
827 828 1.544314 GCTCCCCTGCCATGAAGTATC 60.544 57.143 0.00 0.00 0.00 2.24
828 829 1.770658 CTCCCCTGCCATGAAGTATCA 59.229 52.381 0.00 0.00 40.57 2.15
829 830 2.173356 CTCCCCTGCCATGAAGTATCAA 59.827 50.000 0.00 0.00 39.49 2.57
830 831 2.580322 TCCCCTGCCATGAAGTATCAAA 59.420 45.455 0.00 0.00 39.49 2.69
831 832 3.205056 TCCCCTGCCATGAAGTATCAAAT 59.795 43.478 0.00 0.00 39.49 2.32
832 833 3.571401 CCCCTGCCATGAAGTATCAAATC 59.429 47.826 0.00 0.00 39.49 2.17
833 834 3.571401 CCCTGCCATGAAGTATCAAATCC 59.429 47.826 0.00 0.00 39.49 3.01
834 835 4.209538 CCTGCCATGAAGTATCAAATCCA 58.790 43.478 0.00 0.00 39.49 3.41
835 836 4.037208 CCTGCCATGAAGTATCAAATCCAC 59.963 45.833 0.00 0.00 39.49 4.02
836 837 4.598022 TGCCATGAAGTATCAAATCCACA 58.402 39.130 0.00 0.00 39.49 4.17
837 838 4.398988 TGCCATGAAGTATCAAATCCACAC 59.601 41.667 0.00 0.00 39.49 3.82
838 839 4.398988 GCCATGAAGTATCAAATCCACACA 59.601 41.667 0.00 0.00 39.49 3.72
839 840 5.105797 GCCATGAAGTATCAAATCCACACAA 60.106 40.000 0.00 0.00 39.49 3.33
840 841 6.324819 CCATGAAGTATCAAATCCACACAAC 58.675 40.000 0.00 0.00 39.49 3.32
841 842 5.957842 TGAAGTATCAAATCCACACAACC 57.042 39.130 0.00 0.00 30.99 3.77
842 843 4.764823 TGAAGTATCAAATCCACACAACCC 59.235 41.667 0.00 0.00 30.99 4.11
843 844 4.380843 AGTATCAAATCCACACAACCCA 57.619 40.909 0.00 0.00 0.00 4.51
844 845 4.335416 AGTATCAAATCCACACAACCCAG 58.665 43.478 0.00 0.00 0.00 4.45
845 846 2.746279 TCAAATCCACACAACCCAGT 57.254 45.000 0.00 0.00 0.00 4.00
846 847 2.582052 TCAAATCCACACAACCCAGTC 58.418 47.619 0.00 0.00 0.00 3.51
847 848 2.092158 TCAAATCCACACAACCCAGTCA 60.092 45.455 0.00 0.00 0.00 3.41
848 849 2.692557 CAAATCCACACAACCCAGTCAA 59.307 45.455 0.00 0.00 0.00 3.18
849 850 2.746279 ATCCACACAACCCAGTCAAA 57.254 45.000 0.00 0.00 0.00 2.69
850 851 2.746279 TCCACACAACCCAGTCAAAT 57.254 45.000 0.00 0.00 0.00 2.32
851 852 3.866703 TCCACACAACCCAGTCAAATA 57.133 42.857 0.00 0.00 0.00 1.40
852 853 4.171878 TCCACACAACCCAGTCAAATAA 57.828 40.909 0.00 0.00 0.00 1.40
853 854 4.537751 TCCACACAACCCAGTCAAATAAA 58.462 39.130 0.00 0.00 0.00 1.40
854 855 5.144100 TCCACACAACCCAGTCAAATAAAT 58.856 37.500 0.00 0.00 0.00 1.40
855 856 5.010516 TCCACACAACCCAGTCAAATAAATG 59.989 40.000 0.00 0.00 0.00 2.32
856 857 4.685628 CACACAACCCAGTCAAATAAATGC 59.314 41.667 0.00 0.00 0.00 3.56
857 858 4.343526 ACACAACCCAGTCAAATAAATGCA 59.656 37.500 0.00 0.00 0.00 3.96
858 859 5.163364 ACACAACCCAGTCAAATAAATGCAA 60.163 36.000 0.00 0.00 0.00 4.08
859 860 5.177327 CACAACCCAGTCAAATAAATGCAAC 59.823 40.000 0.00 0.00 0.00 4.17
860 861 5.070313 ACAACCCAGTCAAATAAATGCAACT 59.930 36.000 0.00 0.00 0.00 3.16
861 862 5.806654 ACCCAGTCAAATAAATGCAACTT 57.193 34.783 0.00 0.00 0.00 2.66
862 863 6.173427 ACCCAGTCAAATAAATGCAACTTT 57.827 33.333 0.00 0.00 0.00 2.66
863 864 6.591001 ACCCAGTCAAATAAATGCAACTTTT 58.409 32.000 0.00 0.00 0.00 2.27
864 865 7.053498 ACCCAGTCAAATAAATGCAACTTTTT 58.947 30.769 0.00 0.00 0.00 1.94
883 884 2.143876 TTTTTATCTGAGGGCAGGCC 57.856 50.000 4.33 4.33 42.53 5.19
884 885 1.298953 TTTTATCTGAGGGCAGGCCT 58.701 50.000 17.36 17.36 42.53 5.19
885 886 0.548031 TTTATCTGAGGGCAGGCCTG 59.452 55.000 29.34 29.34 42.53 4.85
886 887 1.348008 TTATCTGAGGGCAGGCCTGG 61.348 60.000 33.46 16.08 42.53 4.45
899 900 3.052082 CCTGGCGCAGTGGTGAAG 61.052 66.667 10.83 0.00 0.00 3.02
900 901 2.281070 CTGGCGCAGTGGTGAAGT 60.281 61.111 10.83 0.00 0.00 3.01
901 902 2.280797 TGGCGCAGTGGTGAAGTC 60.281 61.111 10.83 0.00 0.00 3.01
902 903 3.050275 GGCGCAGTGGTGAAGTCC 61.050 66.667 10.83 0.00 0.00 3.85
903 904 2.031163 GCGCAGTGGTGAAGTCCT 59.969 61.111 0.30 0.00 0.00 3.85
904 905 2.029844 GCGCAGTGGTGAAGTCCTC 61.030 63.158 0.30 0.00 0.00 3.71
905 906 1.374758 CGCAGTGGTGAAGTCCTCC 60.375 63.158 0.00 0.00 0.00 4.30
906 907 1.003233 GCAGTGGTGAAGTCCTCCC 60.003 63.158 0.00 0.00 0.00 4.30
907 908 1.679898 CAGTGGTGAAGTCCTCCCC 59.320 63.158 0.00 0.00 0.00 4.81
908 909 1.127567 CAGTGGTGAAGTCCTCCCCA 61.128 60.000 0.00 0.00 0.00 4.96
909 910 1.128188 AGTGGTGAAGTCCTCCCCAC 61.128 60.000 0.00 0.00 44.69 4.61
910 911 1.128188 GTGGTGAAGTCCTCCCCACT 61.128 60.000 0.00 0.00 41.83 4.00
911 912 0.401395 TGGTGAAGTCCTCCCCACTT 60.401 55.000 0.00 0.00 36.77 3.16
912 913 0.036875 GGTGAAGTCCTCCCCACTTG 59.963 60.000 0.00 0.00 34.10 3.16
913 914 0.765510 GTGAAGTCCTCCCCACTTGT 59.234 55.000 0.00 0.00 34.10 3.16
914 915 0.764890 TGAAGTCCTCCCCACTTGTG 59.235 55.000 0.00 0.00 34.10 3.33
915 916 0.606673 GAAGTCCTCCCCACTTGTGC 60.607 60.000 0.00 0.00 34.10 4.57
916 917 2.034221 GTCCTCCCCACTTGTGCC 59.966 66.667 0.00 0.00 0.00 5.01
917 918 2.449518 TCCTCCCCACTTGTGCCA 60.450 61.111 0.00 0.00 0.00 4.92
918 919 2.081787 TCCTCCCCACTTGTGCCAA 61.082 57.895 0.00 0.00 0.00 4.52
919 920 1.604593 CCTCCCCACTTGTGCCAAG 60.605 63.158 11.87 11.87 0.00 3.61
920 921 1.455849 CTCCCCACTTGTGCCAAGA 59.544 57.895 18.22 0.00 0.00 3.02
921 922 0.607489 CTCCCCACTTGTGCCAAGAG 60.607 60.000 18.22 11.85 0.00 2.85
922 923 1.604593 CCCCACTTGTGCCAAGAGG 60.605 63.158 18.22 18.17 38.23 3.69
923 924 1.151450 CCCACTTGTGCCAAGAGGT 59.849 57.895 21.11 2.99 37.19 3.85
924 925 0.890996 CCCACTTGTGCCAAGAGGTC 60.891 60.000 21.11 0.00 37.19 3.85
925 926 0.890996 CCACTTGTGCCAAGAGGTCC 60.891 60.000 18.22 0.00 37.19 4.46
926 927 0.109342 CACTTGTGCCAAGAGGTCCT 59.891 55.000 18.22 0.00 37.19 3.85
927 928 0.109342 ACTTGTGCCAAGAGGTCCTG 59.891 55.000 18.22 0.00 37.19 3.86
928 929 0.607489 CTTGTGCCAAGAGGTCCTGG 60.607 60.000 0.00 0.00 37.19 4.45
929 930 2.067932 TTGTGCCAAGAGGTCCTGGG 62.068 60.000 0.00 0.00 39.14 4.45
930 931 2.121963 TGCCAAGAGGTCCTGGGT 60.122 61.111 0.00 0.00 38.32 4.51
931 932 1.774217 TGCCAAGAGGTCCTGGGTT 60.774 57.895 0.00 0.00 38.32 4.11
932 933 1.002011 GCCAAGAGGTCCTGGGTTC 60.002 63.158 0.00 0.00 38.32 3.62
933 934 1.296715 CCAAGAGGTCCTGGGTTCG 59.703 63.158 0.00 0.00 30.82 3.95
934 935 1.192146 CCAAGAGGTCCTGGGTTCGA 61.192 60.000 0.00 0.00 30.82 3.71
935 936 0.685097 CAAGAGGTCCTGGGTTCGAA 59.315 55.000 0.00 0.00 0.00 3.71
936 937 0.685660 AAGAGGTCCTGGGTTCGAAC 59.314 55.000 20.14 20.14 0.00 3.95
947 948 3.129792 GTTCGAACCAGCCTCTCTG 57.870 57.895 17.68 0.00 42.49 3.35
948 949 1.016653 GTTCGAACCAGCCTCTCTGC 61.017 60.000 17.68 0.00 41.50 4.26
949 950 1.471829 TTCGAACCAGCCTCTCTGCA 61.472 55.000 0.00 0.00 41.50 4.41
950 951 1.220206 CGAACCAGCCTCTCTGCAT 59.780 57.895 0.00 0.00 41.50 3.96
951 952 0.392193 CGAACCAGCCTCTCTGCATT 60.392 55.000 0.00 0.00 41.50 3.56
952 953 1.093159 GAACCAGCCTCTCTGCATTG 58.907 55.000 0.00 0.00 41.50 2.82
953 954 0.964358 AACCAGCCTCTCTGCATTGC 60.964 55.000 0.46 0.46 41.50 3.56
954 955 1.378119 CCAGCCTCTCTGCATTGCA 60.378 57.895 11.50 11.50 41.50 4.08
955 956 1.654954 CCAGCCTCTCTGCATTGCAC 61.655 60.000 7.38 0.00 41.50 4.57
956 957 0.677098 CAGCCTCTCTGCATTGCACT 60.677 55.000 7.38 0.00 35.78 4.40
957 958 0.037877 AGCCTCTCTGCATTGCACTT 59.962 50.000 7.38 0.00 33.79 3.16
958 959 0.886563 GCCTCTCTGCATTGCACTTT 59.113 50.000 7.38 0.00 33.79 2.66
959 960 1.402456 GCCTCTCTGCATTGCACTTTG 60.402 52.381 7.38 0.00 33.79 2.77
960 961 1.402456 CCTCTCTGCATTGCACTTTGC 60.402 52.381 7.38 8.20 45.29 3.68
970 971 3.339547 GCACTTTGCAGGGGTAAGA 57.660 52.632 2.16 0.00 44.26 2.10
971 972 0.881796 GCACTTTGCAGGGGTAAGAC 59.118 55.000 2.16 0.00 44.26 3.01
972 973 1.545651 GCACTTTGCAGGGGTAAGACT 60.546 52.381 2.16 0.00 44.26 3.24
973 974 2.290071 GCACTTTGCAGGGGTAAGACTA 60.290 50.000 2.16 0.00 44.26 2.59
974 975 3.600388 CACTTTGCAGGGGTAAGACTAG 58.400 50.000 2.16 0.00 0.00 2.57
975 976 2.027100 ACTTTGCAGGGGTAAGACTAGC 60.027 50.000 2.16 0.00 0.00 3.42
976 977 1.952621 TTGCAGGGGTAAGACTAGCT 58.047 50.000 0.00 0.00 0.00 3.32
977 978 1.952621 TGCAGGGGTAAGACTAGCTT 58.047 50.000 0.00 5.06 40.68 3.74
978 979 1.831736 TGCAGGGGTAAGACTAGCTTC 59.168 52.381 0.00 0.00 38.05 3.86
979 980 1.139256 GCAGGGGTAAGACTAGCTTCC 59.861 57.143 0.00 5.32 38.05 3.46
980 981 2.753247 CAGGGGTAAGACTAGCTTCCT 58.247 52.381 0.00 2.53 38.05 3.36
981 982 3.912248 CAGGGGTAAGACTAGCTTCCTA 58.088 50.000 0.00 0.00 38.05 2.94
982 983 4.484912 CAGGGGTAAGACTAGCTTCCTAT 58.515 47.826 0.00 0.00 38.05 2.57
983 984 5.642165 CAGGGGTAAGACTAGCTTCCTATA 58.358 45.833 0.00 0.00 38.05 1.31
984 985 6.075984 CAGGGGTAAGACTAGCTTCCTATAA 58.924 44.000 0.00 0.00 38.05 0.98
985 986 6.726764 CAGGGGTAAGACTAGCTTCCTATAAT 59.273 42.308 0.00 0.00 38.05 1.28
986 987 6.955267 AGGGGTAAGACTAGCTTCCTATAATC 59.045 42.308 0.00 0.00 38.05 1.75
987 988 6.154877 GGGGTAAGACTAGCTTCCTATAATCC 59.845 46.154 0.00 0.00 38.05 3.01
988 989 6.154877 GGGTAAGACTAGCTTCCTATAATCCC 59.845 46.154 0.00 0.00 38.05 3.85
989 990 6.955267 GGTAAGACTAGCTTCCTATAATCCCT 59.045 42.308 0.00 0.00 38.05 4.20
990 991 7.123098 GGTAAGACTAGCTTCCTATAATCCCTC 59.877 44.444 0.00 0.00 38.05 4.30
991 992 5.585894 AGACTAGCTTCCTATAATCCCTCC 58.414 45.833 0.00 0.00 0.00 4.30
992 993 4.690149 ACTAGCTTCCTATAATCCCTCCC 58.310 47.826 0.00 0.00 0.00 4.30
993 994 2.922564 AGCTTCCTATAATCCCTCCCC 58.077 52.381 0.00 0.00 0.00 4.81
994 995 2.184565 AGCTTCCTATAATCCCTCCCCA 59.815 50.000 0.00 0.00 0.00 4.96
995 996 2.573915 GCTTCCTATAATCCCTCCCCAG 59.426 54.545 0.00 0.00 0.00 4.45
996 997 3.762128 GCTTCCTATAATCCCTCCCCAGA 60.762 52.174 0.00 0.00 0.00 3.86
997 998 3.562108 TCCTATAATCCCTCCCCAGAC 57.438 52.381 0.00 0.00 0.00 3.51
998 999 2.113777 TCCTATAATCCCTCCCCAGACC 59.886 54.545 0.00 0.00 0.00 3.85
999 1000 2.552367 CTATAATCCCTCCCCAGACCC 58.448 57.143 0.00 0.00 0.00 4.46
1000 1001 0.103876 ATAATCCCTCCCCAGACCCC 60.104 60.000 0.00 0.00 0.00 4.95
1001 1002 1.542093 TAATCCCTCCCCAGACCCCA 61.542 60.000 0.00 0.00 0.00 4.96
1002 1003 3.660092 ATCCCTCCCCAGACCCCAC 62.660 68.421 0.00 0.00 0.00 4.61
1004 1005 4.354943 CCTCCCCAGACCCCACCT 62.355 72.222 0.00 0.00 0.00 4.00
1005 1006 2.204151 CTCCCCAGACCCCACCTT 60.204 66.667 0.00 0.00 0.00 3.50
1006 1007 2.531685 TCCCCAGACCCCACCTTG 60.532 66.667 0.00 0.00 0.00 3.61
1007 1008 2.858974 CCCCAGACCCCACCTTGT 60.859 66.667 0.00 0.00 0.00 3.16
1008 1009 2.436109 CCCAGACCCCACCTTGTG 59.564 66.667 0.00 0.00 0.00 3.33
1009 1010 2.460853 CCCAGACCCCACCTTGTGT 61.461 63.158 0.00 0.00 0.00 3.72
1010 1011 1.228245 CCAGACCCCACCTTGTGTG 60.228 63.158 0.00 0.00 45.01 3.82
1019 1020 2.348411 CACCTTGTGTGGGAGTTTCT 57.652 50.000 0.00 0.00 41.52 2.52
1020 1021 3.485463 CACCTTGTGTGGGAGTTTCTA 57.515 47.619 0.00 0.00 41.52 2.10
1021 1022 4.021102 CACCTTGTGTGGGAGTTTCTAT 57.979 45.455 0.00 0.00 41.52 1.98
1022 1023 3.753272 CACCTTGTGTGGGAGTTTCTATG 59.247 47.826 0.00 0.00 41.52 2.23
1023 1024 2.749621 CCTTGTGTGGGAGTTTCTATGC 59.250 50.000 0.00 0.00 0.00 3.14
1024 1025 3.411446 CTTGTGTGGGAGTTTCTATGCA 58.589 45.455 0.00 0.00 0.00 3.96
1025 1026 2.778299 TGTGTGGGAGTTTCTATGCAC 58.222 47.619 0.00 0.00 0.00 4.57
1026 1027 2.371841 TGTGTGGGAGTTTCTATGCACT 59.628 45.455 0.00 0.00 0.00 4.40
1027 1028 2.744202 GTGTGGGAGTTTCTATGCACTG 59.256 50.000 0.00 0.00 0.00 3.66
1028 1029 2.290260 TGTGGGAGTTTCTATGCACTGG 60.290 50.000 0.00 0.00 0.00 4.00
1029 1030 1.281867 TGGGAGTTTCTATGCACTGGG 59.718 52.381 0.00 0.00 0.00 4.45
1030 1031 1.282157 GGGAGTTTCTATGCACTGGGT 59.718 52.381 0.00 0.00 0.00 4.51
1031 1032 2.633488 GGAGTTTCTATGCACTGGGTC 58.367 52.381 0.00 0.00 0.00 4.46
1032 1033 2.237392 GGAGTTTCTATGCACTGGGTCT 59.763 50.000 0.00 0.00 0.00 3.85
1033 1034 3.265791 GAGTTTCTATGCACTGGGTCTG 58.734 50.000 0.00 0.00 0.00 3.51
1034 1035 2.639839 AGTTTCTATGCACTGGGTCTGT 59.360 45.455 0.00 0.00 0.00 3.41
1035 1036 3.003480 GTTTCTATGCACTGGGTCTGTC 58.997 50.000 0.00 0.00 0.00 3.51
1036 1037 1.195115 TCTATGCACTGGGTCTGTCC 58.805 55.000 0.00 0.00 0.00 4.02
1037 1038 1.198713 CTATGCACTGGGTCTGTCCT 58.801 55.000 0.00 0.00 36.25 3.85
1038 1039 1.556911 CTATGCACTGGGTCTGTCCTT 59.443 52.381 0.00 0.00 36.25 3.36
1039 1040 0.773644 ATGCACTGGGTCTGTCCTTT 59.226 50.000 0.00 0.00 36.25 3.11
1040 1041 0.550914 TGCACTGGGTCTGTCCTTTT 59.449 50.000 0.00 0.00 36.25 2.27
1041 1042 1.064017 TGCACTGGGTCTGTCCTTTTT 60.064 47.619 0.00 0.00 36.25 1.94
1059 1060 4.679373 TTTTTGCAGGCAGTTATTGGAA 57.321 36.364 0.00 0.00 0.00 3.53
1060 1061 3.658757 TTTGCAGGCAGTTATTGGAAC 57.341 42.857 0.00 0.00 0.00 3.62
1061 1062 2.284754 TGCAGGCAGTTATTGGAACA 57.715 45.000 0.00 0.00 0.00 3.18
1062 1063 2.806434 TGCAGGCAGTTATTGGAACAT 58.194 42.857 0.00 0.00 39.30 2.71
1063 1064 3.961849 TGCAGGCAGTTATTGGAACATA 58.038 40.909 0.00 0.00 39.30 2.29
1064 1065 4.339748 TGCAGGCAGTTATTGGAACATAA 58.660 39.130 0.00 0.00 39.30 1.90
1065 1066 4.398988 TGCAGGCAGTTATTGGAACATAAG 59.601 41.667 0.00 0.00 39.30 1.73
1066 1067 4.640201 GCAGGCAGTTATTGGAACATAAGA 59.360 41.667 0.00 0.00 39.30 2.10
1067 1068 5.125417 GCAGGCAGTTATTGGAACATAAGAA 59.875 40.000 0.00 0.00 39.30 2.52
1068 1069 6.678900 GCAGGCAGTTATTGGAACATAAGAAG 60.679 42.308 0.00 0.00 39.30 2.85
1069 1070 5.888161 AGGCAGTTATTGGAACATAAGAAGG 59.112 40.000 0.00 0.00 39.30 3.46
1070 1071 5.885912 GGCAGTTATTGGAACATAAGAAGGA 59.114 40.000 0.00 0.00 39.30 3.36
1071 1072 6.547510 GGCAGTTATTGGAACATAAGAAGGAT 59.452 38.462 0.00 0.00 39.30 3.24
1072 1073 7.255277 GGCAGTTATTGGAACATAAGAAGGATC 60.255 40.741 0.00 0.00 39.30 3.36
1073 1074 7.500559 GCAGTTATTGGAACATAAGAAGGATCT 59.499 37.037 0.00 0.00 39.30 2.75
1076 1077 9.274206 GTTATTGGAACATAAGAAGGATCTACC 57.726 37.037 0.00 0.00 39.30 3.18
1077 1078 5.888982 TGGAACATAAGAAGGATCTACCC 57.111 43.478 0.00 0.00 40.05 3.69
1078 1079 5.538877 TGGAACATAAGAAGGATCTACCCT 58.461 41.667 0.00 0.00 40.05 4.34
1079 1080 5.366768 TGGAACATAAGAAGGATCTACCCTG 59.633 44.000 0.00 0.00 40.05 4.45
1080 1081 5.221742 GGAACATAAGAAGGATCTACCCTGG 60.222 48.000 0.00 0.00 40.05 4.45
1081 1082 4.897051 ACATAAGAAGGATCTACCCTGGT 58.103 43.478 0.00 0.00 40.05 4.00
1082 1083 4.656112 ACATAAGAAGGATCTACCCTGGTG 59.344 45.833 0.00 0.00 40.05 4.17
1083 1084 2.182516 AGAAGGATCTACCCTGGTGG 57.817 55.000 0.00 0.00 40.05 4.61
1084 1085 0.470341 GAAGGATCTACCCTGGTGGC 59.530 60.000 0.00 0.00 40.05 5.01
1085 1086 0.988678 AAGGATCTACCCTGGTGGCC 60.989 60.000 0.00 0.00 40.05 5.36
1086 1087 2.808206 GGATCTACCCTGGTGGCCG 61.808 68.421 0.00 0.00 37.83 6.13
1087 1088 3.462199 GATCTACCCTGGTGGCCGC 62.462 68.421 8.12 8.12 37.83 6.53
1089 1090 4.028490 CTACCCTGGTGGCCGCAA 62.028 66.667 19.98 5.74 37.83 4.85
1090 1091 3.334891 TACCCTGGTGGCCGCAAT 61.335 61.111 19.98 0.00 37.83 3.56
1091 1092 3.636929 TACCCTGGTGGCCGCAATG 62.637 63.158 19.98 3.37 37.83 2.82
1093 1094 4.738998 CCTGGTGGCCGCAATGGA 62.739 66.667 19.98 0.00 42.00 3.41
1094 1095 3.136123 CTGGTGGCCGCAATGGAG 61.136 66.667 19.98 1.41 42.00 3.86
1095 1096 4.738998 TGGTGGCCGCAATGGAGG 62.739 66.667 19.98 0.00 42.00 4.30
1101 1102 2.753043 CCGCAATGGAGGCTGCTT 60.753 61.111 7.74 0.00 42.00 3.91
1102 1103 2.345760 CCGCAATGGAGGCTGCTTT 61.346 57.895 7.74 4.24 42.00 3.51
1103 1104 1.138247 CGCAATGGAGGCTGCTTTC 59.862 57.895 7.74 0.00 36.38 2.62
1104 1105 1.514553 GCAATGGAGGCTGCTTTCC 59.485 57.895 7.74 14.18 35.62 3.13
1105 1106 0.969409 GCAATGGAGGCTGCTTTCCT 60.969 55.000 19.30 1.19 35.62 3.36
1106 1107 0.815734 CAATGGAGGCTGCTTTCCTG 59.184 55.000 19.30 10.26 33.24 3.86
1107 1108 0.407139 AATGGAGGCTGCTTTCCTGT 59.593 50.000 19.30 9.46 33.24 4.00
1108 1109 0.034670 ATGGAGGCTGCTTTCCTGTC 60.035 55.000 19.30 0.00 33.24 3.51
1109 1110 1.743252 GGAGGCTGCTTTCCTGTCG 60.743 63.158 13.90 0.00 33.24 4.35
1110 1111 1.743252 GAGGCTGCTTTCCTGTCGG 60.743 63.158 0.00 0.00 33.24 4.79
1111 1112 3.435186 GGCTGCTTTCCTGTCGGC 61.435 66.667 0.00 0.00 0.00 5.54
1112 1113 3.793144 GCTGCTTTCCTGTCGGCG 61.793 66.667 0.00 0.00 0.00 6.46
1113 1114 3.121030 CTGCTTTCCTGTCGGCGG 61.121 66.667 7.21 0.00 0.00 6.13
1114 1115 3.883744 CTGCTTTCCTGTCGGCGGT 62.884 63.158 7.21 0.00 0.00 5.68
1115 1116 3.423154 GCTTTCCTGTCGGCGGTG 61.423 66.667 7.21 0.00 0.00 4.94
1116 1117 2.030562 CTTTCCTGTCGGCGGTGT 59.969 61.111 7.21 0.00 0.00 4.16
1117 1118 1.597027 CTTTCCTGTCGGCGGTGTT 60.597 57.895 7.21 0.00 0.00 3.32
1118 1119 1.841663 CTTTCCTGTCGGCGGTGTTG 61.842 60.000 7.21 0.00 0.00 3.33
1119 1120 2.313051 TTTCCTGTCGGCGGTGTTGA 62.313 55.000 7.21 0.00 0.00 3.18
1120 1121 2.280524 CCTGTCGGCGGTGTTGAA 60.281 61.111 7.21 0.00 0.00 2.69
1121 1122 2.317609 CCTGTCGGCGGTGTTGAAG 61.318 63.158 7.21 0.00 0.00 3.02
1122 1123 1.594293 CTGTCGGCGGTGTTGAAGT 60.594 57.895 7.21 0.00 0.00 3.01
1123 1124 1.557443 CTGTCGGCGGTGTTGAAGTC 61.557 60.000 7.21 0.00 0.00 3.01
1124 1125 1.300697 GTCGGCGGTGTTGAAGTCT 60.301 57.895 7.21 0.00 0.00 3.24
1125 1126 1.300620 TCGGCGGTGTTGAAGTCTG 60.301 57.895 7.21 0.00 0.00 3.51
1126 1127 2.946762 GGCGGTGTTGAAGTCTGC 59.053 61.111 0.00 0.00 0.00 4.26
1127 1128 1.891919 GGCGGTGTTGAAGTCTGCA 60.892 57.895 0.00 0.00 35.45 4.41
1128 1129 1.571460 GCGGTGTTGAAGTCTGCAG 59.429 57.895 7.63 7.63 34.13 4.41
1129 1130 1.160329 GCGGTGTTGAAGTCTGCAGT 61.160 55.000 14.67 0.00 34.13 4.40
1130 1131 0.861837 CGGTGTTGAAGTCTGCAGTC 59.138 55.000 14.67 8.44 0.00 3.51
1131 1132 1.806247 CGGTGTTGAAGTCTGCAGTCA 60.806 52.381 14.67 7.56 0.00 3.41
1132 1133 2.288666 GGTGTTGAAGTCTGCAGTCAA 58.711 47.619 14.67 13.56 0.00 3.18
1136 1137 3.945179 GTTGAAGTCTGCAGTCAACAAG 58.055 45.455 29.60 1.97 46.69 3.16
1137 1138 1.942657 TGAAGTCTGCAGTCAACAAGC 59.057 47.619 14.67 0.00 0.00 4.01
1138 1139 2.216898 GAAGTCTGCAGTCAACAAGCT 58.783 47.619 14.67 0.00 0.00 3.74
1139 1140 3.181466 TGAAGTCTGCAGTCAACAAGCTA 60.181 43.478 14.67 0.00 0.00 3.32
1140 1141 3.037431 AGTCTGCAGTCAACAAGCTAG 57.963 47.619 14.67 0.00 0.00 3.42
1141 1142 2.366916 AGTCTGCAGTCAACAAGCTAGT 59.633 45.455 14.67 0.00 0.00 2.57
1142 1143 3.134458 GTCTGCAGTCAACAAGCTAGTT 58.866 45.455 14.67 0.00 0.00 2.24
1143 1144 3.185391 GTCTGCAGTCAACAAGCTAGTTC 59.815 47.826 14.67 0.00 0.00 3.01
1144 1145 2.135139 TGCAGTCAACAAGCTAGTTCG 58.865 47.619 0.00 0.00 0.00 3.95
1145 1146 1.461127 GCAGTCAACAAGCTAGTTCGG 59.539 52.381 0.00 0.00 0.00 4.30
1146 1147 1.461127 CAGTCAACAAGCTAGTTCGGC 59.539 52.381 0.00 0.00 0.00 5.54
1147 1148 1.344763 AGTCAACAAGCTAGTTCGGCT 59.655 47.619 0.00 0.00 42.31 5.52
1148 1149 1.461127 GTCAACAAGCTAGTTCGGCTG 59.539 52.381 0.00 0.00 40.19 4.85
1149 1150 1.343142 TCAACAAGCTAGTTCGGCTGA 59.657 47.619 0.00 0.00 40.19 4.26
1150 1151 2.028112 TCAACAAGCTAGTTCGGCTGAT 60.028 45.455 0.00 0.00 40.19 2.90
1151 1152 3.194755 TCAACAAGCTAGTTCGGCTGATA 59.805 43.478 0.00 0.00 40.19 2.15
1152 1153 3.887621 ACAAGCTAGTTCGGCTGATAA 57.112 42.857 0.00 0.00 40.19 1.75
1153 1154 3.522553 ACAAGCTAGTTCGGCTGATAAC 58.477 45.455 0.00 0.00 40.19 1.89
1154 1155 2.866762 CAAGCTAGTTCGGCTGATAACC 59.133 50.000 0.00 0.00 40.19 2.85
1155 1156 2.108168 AGCTAGTTCGGCTGATAACCA 58.892 47.619 0.00 0.00 38.73 3.67
1156 1157 2.101582 AGCTAGTTCGGCTGATAACCAG 59.898 50.000 0.00 0.00 45.67 4.00
1176 1177 1.409412 CGAGTTCGCCTCCATAATCG 58.591 55.000 0.00 0.00 36.82 3.34
1177 1178 1.784525 GAGTTCGCCTCCATAATCGG 58.215 55.000 0.00 0.00 33.79 4.18
1178 1179 1.068741 GAGTTCGCCTCCATAATCGGT 59.931 52.381 0.00 0.00 33.79 4.69
1179 1180 1.202533 AGTTCGCCTCCATAATCGGTG 60.203 52.381 0.00 0.00 0.00 4.94
1180 1181 0.828022 TTCGCCTCCATAATCGGTGT 59.172 50.000 0.00 0.00 0.00 4.16
1181 1182 0.828022 TCGCCTCCATAATCGGTGTT 59.172 50.000 0.00 0.00 0.00 3.32
1182 1183 2.033372 TCGCCTCCATAATCGGTGTTA 58.967 47.619 0.00 0.00 0.00 2.41
1183 1184 2.132762 CGCCTCCATAATCGGTGTTAC 58.867 52.381 0.00 0.00 0.00 2.50
1184 1185 2.490991 GCCTCCATAATCGGTGTTACC 58.509 52.381 0.00 0.00 34.05 2.85
1185 1186 2.158871 GCCTCCATAATCGGTGTTACCA 60.159 50.000 0.00 0.00 38.47 3.25
1186 1187 3.683281 GCCTCCATAATCGGTGTTACCAA 60.683 47.826 0.00 0.00 38.47 3.67
1187 1188 4.519213 CCTCCATAATCGGTGTTACCAAA 58.481 43.478 0.00 0.00 38.47 3.28
1188 1189 4.334481 CCTCCATAATCGGTGTTACCAAAC 59.666 45.833 0.00 0.00 38.47 2.93
1189 1190 4.907809 TCCATAATCGGTGTTACCAAACA 58.092 39.130 0.00 0.00 43.32 2.83
1190 1191 5.502079 TCCATAATCGGTGTTACCAAACAT 58.498 37.500 0.00 0.00 46.84 2.71
1191 1192 5.587043 TCCATAATCGGTGTTACCAAACATC 59.413 40.000 0.00 0.00 46.84 3.06
1192 1193 5.588648 CCATAATCGGTGTTACCAAACATCT 59.411 40.000 0.00 0.00 46.84 2.90
1193 1194 6.238374 CCATAATCGGTGTTACCAAACATCTC 60.238 42.308 0.00 0.00 46.84 2.75
1194 1195 4.553330 ATCGGTGTTACCAAACATCTCT 57.447 40.909 0.00 0.00 46.84 3.10
1195 1196 3.921677 TCGGTGTTACCAAACATCTCTC 58.078 45.455 0.00 0.00 46.84 3.20
1196 1197 3.000727 CGGTGTTACCAAACATCTCTCC 58.999 50.000 0.00 0.00 46.84 3.71
1197 1198 3.000727 GGTGTTACCAAACATCTCTCCG 58.999 50.000 0.00 0.00 46.84 4.63
1198 1199 3.306502 GGTGTTACCAAACATCTCTCCGA 60.307 47.826 0.00 0.00 46.84 4.55
1199 1200 3.927142 GTGTTACCAAACATCTCTCCGAG 59.073 47.826 0.00 0.00 46.84 4.63
1200 1201 2.930682 GTTACCAAACATCTCTCCGAGC 59.069 50.000 0.00 0.00 35.56 5.03
1201 1202 1.270907 ACCAAACATCTCTCCGAGCT 58.729 50.000 0.00 0.00 0.00 4.09
1202 1203 1.205893 ACCAAACATCTCTCCGAGCTC 59.794 52.381 2.73 2.73 0.00 4.09
1203 1204 1.472376 CCAAACATCTCTCCGAGCTCC 60.472 57.143 8.47 0.00 0.00 4.70
1204 1205 1.205655 CAAACATCTCTCCGAGCTCCA 59.794 52.381 8.47 0.00 0.00 3.86
1205 1206 1.110442 AACATCTCTCCGAGCTCCAG 58.890 55.000 8.47 4.48 0.00 3.86
1206 1207 0.754957 ACATCTCTCCGAGCTCCAGG 60.755 60.000 8.47 4.56 0.00 4.45
1207 1208 1.152567 ATCTCTCCGAGCTCCAGGG 60.153 63.158 8.47 4.40 0.00 4.45
1208 1209 1.943730 ATCTCTCCGAGCTCCAGGGT 61.944 60.000 8.47 0.00 0.00 4.34
1209 1210 1.684049 CTCTCCGAGCTCCAGGGTT 60.684 63.158 8.47 0.00 0.00 4.11
1210 1211 1.229209 TCTCCGAGCTCCAGGGTTT 60.229 57.895 8.47 0.00 0.00 3.27
1211 1212 0.040646 TCTCCGAGCTCCAGGGTTTA 59.959 55.000 8.47 0.00 0.00 2.01
1212 1213 1.123928 CTCCGAGCTCCAGGGTTTAT 58.876 55.000 8.47 0.00 0.00 1.40
1213 1214 1.486726 CTCCGAGCTCCAGGGTTTATT 59.513 52.381 8.47 0.00 0.00 1.40
1214 1215 1.913419 TCCGAGCTCCAGGGTTTATTT 59.087 47.619 8.47 0.00 0.00 1.40
1215 1216 2.017049 CCGAGCTCCAGGGTTTATTTG 58.983 52.381 8.47 0.00 0.00 2.32
1216 1217 2.017049 CGAGCTCCAGGGTTTATTTGG 58.983 52.381 8.47 0.00 0.00 3.28
1217 1218 2.355716 CGAGCTCCAGGGTTTATTTGGA 60.356 50.000 8.47 0.00 38.62 3.53
1224 1225 6.840090 TCCAGGGTTTATTTGGAGATATCA 57.160 37.500 5.32 0.00 36.13 2.15
1225 1226 6.601332 TCCAGGGTTTATTTGGAGATATCAC 58.399 40.000 5.32 0.00 36.13 3.06
1226 1227 6.389869 TCCAGGGTTTATTTGGAGATATCACT 59.610 38.462 5.32 0.00 36.13 3.41
1227 1228 7.570982 TCCAGGGTTTATTTGGAGATATCACTA 59.429 37.037 5.32 0.00 36.13 2.74
1228 1229 7.880195 CCAGGGTTTATTTGGAGATATCACTAG 59.120 40.741 5.32 0.00 33.76 2.57
1229 1230 8.432805 CAGGGTTTATTTGGAGATATCACTAGT 58.567 37.037 5.32 0.00 0.00 2.57
1230 1231 9.004231 AGGGTTTATTTGGAGATATCACTAGTT 57.996 33.333 5.32 0.00 0.00 2.24
1231 1232 9.057089 GGGTTTATTTGGAGATATCACTAGTTG 57.943 37.037 5.32 0.00 0.00 3.16
1232 1233 9.057089 GGTTTATTTGGAGATATCACTAGTTGG 57.943 37.037 5.32 0.00 0.00 3.77
1233 1234 8.560374 GTTTATTTGGAGATATCACTAGTTGGC 58.440 37.037 5.32 0.00 0.00 4.52
1234 1235 5.957771 TTTGGAGATATCACTAGTTGGCT 57.042 39.130 5.32 0.00 0.00 4.75
1235 1236 4.944619 TGGAGATATCACTAGTTGGCTG 57.055 45.455 5.32 0.00 0.00 4.85
1236 1237 4.290093 TGGAGATATCACTAGTTGGCTGT 58.710 43.478 5.32 0.00 0.00 4.40
1237 1238 4.342378 TGGAGATATCACTAGTTGGCTGTC 59.658 45.833 5.32 0.00 0.00 3.51
1238 1239 4.342378 GGAGATATCACTAGTTGGCTGTCA 59.658 45.833 5.32 0.00 0.00 3.58
1239 1240 5.508825 GGAGATATCACTAGTTGGCTGTCAG 60.509 48.000 5.32 0.00 0.00 3.51
1240 1241 2.393271 ATCACTAGTTGGCTGTCAGC 57.607 50.000 16.93 16.93 41.46 4.26
1241 1242 1.342074 TCACTAGTTGGCTGTCAGCT 58.658 50.000 23.68 3.65 41.99 4.24
1242 1243 1.001293 TCACTAGTTGGCTGTCAGCTG 59.999 52.381 23.68 7.63 41.99 4.24
1243 1244 1.051812 ACTAGTTGGCTGTCAGCTGT 58.948 50.000 23.68 10.53 41.99 4.40
1244 1245 1.270518 ACTAGTTGGCTGTCAGCTGTG 60.271 52.381 23.68 10.90 41.99 3.66
1245 1246 0.035317 TAGTTGGCTGTCAGCTGTGG 59.965 55.000 23.68 6.31 41.99 4.17
1246 1247 2.113774 TTGGCTGTCAGCTGTGGG 59.886 61.111 23.68 5.94 41.99 4.61
1247 1248 3.496309 TTGGCTGTCAGCTGTGGGG 62.496 63.158 23.68 4.15 41.99 4.96
1248 1249 4.729918 GGCTGTCAGCTGTGGGGG 62.730 72.222 23.68 2.39 41.99 5.40
1249 1250 3.958860 GCTGTCAGCTGTGGGGGT 61.959 66.667 17.89 0.00 38.45 4.95
1250 1251 2.348998 CTGTCAGCTGTGGGGGTC 59.651 66.667 14.67 0.00 0.00 4.46
1251 1252 2.447572 TGTCAGCTGTGGGGGTCA 60.448 61.111 14.67 0.73 0.00 4.02
1252 1253 2.348998 GTCAGCTGTGGGGGTCAG 59.651 66.667 14.67 0.00 36.18 3.51
1253 1254 2.930019 TCAGCTGTGGGGGTCAGG 60.930 66.667 14.67 0.00 33.98 3.86
1254 1255 4.039092 CAGCTGTGGGGGTCAGGG 62.039 72.222 5.25 0.00 33.98 4.45
1257 1258 3.579302 CTGTGGGGGTCAGGGCAA 61.579 66.667 0.00 0.00 0.00 4.52
1258 1259 3.868200 CTGTGGGGGTCAGGGCAAC 62.868 68.421 0.00 0.00 0.00 4.17
1259 1260 3.897122 GTGGGGGTCAGGGCAACA 61.897 66.667 0.00 0.00 39.74 3.33
1260 1261 3.579302 TGGGGGTCAGGGCAACAG 61.579 66.667 0.00 0.00 39.74 3.16
1262 1263 4.284550 GGGGTCAGGGCAACAGCA 62.285 66.667 0.00 0.00 39.74 4.41
1263 1264 2.203480 GGGTCAGGGCAACAGCAA 60.203 61.111 0.00 0.00 39.74 3.91
1264 1265 2.270986 GGGTCAGGGCAACAGCAAG 61.271 63.158 0.00 0.00 39.74 4.01
1265 1266 1.529244 GGTCAGGGCAACAGCAAGT 60.529 57.895 0.00 0.00 39.74 3.16
1266 1267 1.656441 GTCAGGGCAACAGCAAGTG 59.344 57.895 0.00 0.00 39.74 3.16
1267 1268 1.529010 TCAGGGCAACAGCAAGTGG 60.529 57.895 0.00 0.00 39.74 4.00
1268 1269 1.829533 CAGGGCAACAGCAAGTGGT 60.830 57.895 0.00 0.00 39.74 4.16
1269 1270 1.076044 AGGGCAACAGCAAGTGGTT 60.076 52.632 0.00 0.00 39.74 3.67
1270 1271 1.109323 AGGGCAACAGCAAGTGGTTC 61.109 55.000 0.00 0.00 39.74 3.62
1271 1272 1.391157 GGGCAACAGCAAGTGGTTCA 61.391 55.000 0.00 0.00 39.74 3.18
1272 1273 0.675633 GGCAACAGCAAGTGGTTCAT 59.324 50.000 0.00 0.00 0.00 2.57
1273 1274 1.336240 GGCAACAGCAAGTGGTTCATC 60.336 52.381 0.00 0.00 0.00 2.92
1274 1275 1.337703 GCAACAGCAAGTGGTTCATCA 59.662 47.619 0.00 0.00 0.00 3.07
1275 1276 2.859806 GCAACAGCAAGTGGTTCATCAC 60.860 50.000 0.00 0.00 37.89 3.06
1286 1287 3.971032 GGTTCATCACCGAATTGGATC 57.029 47.619 0.00 0.00 42.00 3.36
1287 1288 3.278574 GGTTCATCACCGAATTGGATCA 58.721 45.455 0.00 0.00 42.00 2.92
1288 1289 3.694072 GGTTCATCACCGAATTGGATCAA 59.306 43.478 0.00 0.00 42.00 2.57
1289 1290 4.157656 GGTTCATCACCGAATTGGATCAAA 59.842 41.667 0.00 0.00 42.00 2.69
1290 1291 5.335127 GTTCATCACCGAATTGGATCAAAG 58.665 41.667 0.00 0.00 42.00 2.77
1291 1292 4.842574 TCATCACCGAATTGGATCAAAGA 58.157 39.130 0.00 0.00 42.00 2.52
1292 1293 4.877823 TCATCACCGAATTGGATCAAAGAG 59.122 41.667 0.00 0.00 42.00 2.85
1293 1294 4.286297 TCACCGAATTGGATCAAAGAGT 57.714 40.909 0.00 0.00 42.00 3.24
1294 1295 4.651778 TCACCGAATTGGATCAAAGAGTT 58.348 39.130 0.00 0.00 42.00 3.01
1295 1296 4.455533 TCACCGAATTGGATCAAAGAGTTG 59.544 41.667 0.00 0.00 42.00 3.16
1296 1297 4.455533 CACCGAATTGGATCAAAGAGTTGA 59.544 41.667 0.00 0.00 44.12 3.18
1297 1298 5.048782 CACCGAATTGGATCAAAGAGTTGAA 60.049 40.000 0.00 0.00 43.60 2.69
1298 1299 5.534654 ACCGAATTGGATCAAAGAGTTGAAA 59.465 36.000 0.00 0.00 43.60 2.69
1299 1300 6.088824 CCGAATTGGATCAAAGAGTTGAAAG 58.911 40.000 0.00 0.00 46.66 2.62
1300 1301 5.570589 CGAATTGGATCAAAGAGTTGAAAGC 59.429 40.000 0.00 0.00 46.66 3.51
1301 1302 6.409524 AATTGGATCAAAGAGTTGAAAGCA 57.590 33.333 0.00 0.00 46.66 3.91
1302 1303 5.443185 TTGGATCAAAGAGTTGAAAGCAG 57.557 39.130 0.00 0.00 46.66 4.24
1303 1304 4.464008 TGGATCAAAGAGTTGAAAGCAGT 58.536 39.130 0.00 0.00 46.66 4.40
1304 1305 4.889409 TGGATCAAAGAGTTGAAAGCAGTT 59.111 37.500 0.00 0.00 46.66 3.16
1305 1306 5.218139 GGATCAAAGAGTTGAAAGCAGTTG 58.782 41.667 0.00 0.00 46.66 3.16
1306 1307 5.221126 GGATCAAAGAGTTGAAAGCAGTTGT 60.221 40.000 0.00 0.00 46.66 3.32
1307 1308 5.235305 TCAAAGAGTTGAAAGCAGTTGTC 57.765 39.130 0.00 0.00 40.87 3.18
1308 1309 4.699735 TCAAAGAGTTGAAAGCAGTTGTCA 59.300 37.500 0.00 0.00 40.87 3.58
1309 1310 5.182950 TCAAAGAGTTGAAAGCAGTTGTCAA 59.817 36.000 0.00 0.00 40.87 3.18
1310 1311 5.841957 AAGAGTTGAAAGCAGTTGTCAAT 57.158 34.783 0.00 0.00 34.04 2.57
1311 1312 5.179045 AGAGTTGAAAGCAGTTGTCAATG 57.821 39.130 0.00 0.00 34.04 2.82
1312 1313 4.883585 AGAGTTGAAAGCAGTTGTCAATGA 59.116 37.500 0.00 0.00 34.04 2.57
1313 1314 5.533903 AGAGTTGAAAGCAGTTGTCAATGAT 59.466 36.000 0.00 0.00 34.04 2.45
1314 1315 6.040166 AGAGTTGAAAGCAGTTGTCAATGATT 59.960 34.615 0.00 0.00 34.04 2.57
1315 1316 6.576185 AGTTGAAAGCAGTTGTCAATGATTT 58.424 32.000 9.49 9.49 37.71 2.17
1316 1317 7.043565 AGTTGAAAGCAGTTGTCAATGATTTT 58.956 30.769 10.47 2.14 35.34 1.82
1317 1318 6.831727 TGAAAGCAGTTGTCAATGATTTTG 57.168 33.333 10.47 0.00 35.34 2.44
1318 1319 6.571605 TGAAAGCAGTTGTCAATGATTTTGA 58.428 32.000 10.47 0.00 35.34 2.69
1319 1320 7.211573 TGAAAGCAGTTGTCAATGATTTTGAT 58.788 30.769 10.47 0.00 35.34 2.57
1320 1321 7.170151 TGAAAGCAGTTGTCAATGATTTTGATG 59.830 33.333 10.47 0.00 35.34 3.07
1321 1322 6.335471 AGCAGTTGTCAATGATTTTGATGA 57.665 33.333 0.00 0.00 0.00 2.92
1322 1323 6.154445 AGCAGTTGTCAATGATTTTGATGAC 58.846 36.000 0.00 0.00 41.90 3.06
1323 1324 5.346822 GCAGTTGTCAATGATTTTGATGACC 59.653 40.000 0.00 0.00 41.08 4.02
1324 1325 6.684686 CAGTTGTCAATGATTTTGATGACCT 58.315 36.000 0.00 0.00 41.08 3.85
1325 1326 6.584942 CAGTTGTCAATGATTTTGATGACCTG 59.415 38.462 0.00 0.00 41.08 4.00
1326 1327 5.063180 TGTCAATGATTTTGATGACCTGC 57.937 39.130 0.00 0.00 41.08 4.85
1327 1328 4.768448 TGTCAATGATTTTGATGACCTGCT 59.232 37.500 0.00 0.00 41.08 4.24
1328 1329 5.106038 TGTCAATGATTTTGATGACCTGCTC 60.106 40.000 0.00 0.00 41.08 4.26
1329 1330 5.125097 GTCAATGATTTTGATGACCTGCTCT 59.875 40.000 0.00 0.00 36.94 4.09
1330 1331 6.317140 GTCAATGATTTTGATGACCTGCTCTA 59.683 38.462 0.00 0.00 36.94 2.43
1331 1332 7.013083 GTCAATGATTTTGATGACCTGCTCTAT 59.987 37.037 0.00 0.00 36.94 1.98
1332 1333 7.228108 TCAATGATTTTGATGACCTGCTCTATC 59.772 37.037 0.00 0.00 0.00 2.08
1333 1334 5.052481 TGATTTTGATGACCTGCTCTATCG 58.948 41.667 0.00 0.00 0.00 2.92
1334 1335 2.515926 TTGATGACCTGCTCTATCGC 57.484 50.000 0.00 0.00 0.00 4.58
1335 1336 0.676184 TGATGACCTGCTCTATCGCC 59.324 55.000 0.00 0.00 0.00 5.54
1336 1337 0.965439 GATGACCTGCTCTATCGCCT 59.035 55.000 0.00 0.00 0.00 5.52
1337 1338 0.678395 ATGACCTGCTCTATCGCCTG 59.322 55.000 0.00 0.00 0.00 4.85
1338 1339 1.365633 GACCTGCTCTATCGCCTGG 59.634 63.158 0.00 0.00 0.00 4.45
1339 1340 1.075970 ACCTGCTCTATCGCCTGGA 60.076 57.895 0.00 0.00 0.00 3.86
1340 1341 0.687757 ACCTGCTCTATCGCCTGGAA 60.688 55.000 0.00 0.00 0.00 3.53
1341 1342 0.033228 CCTGCTCTATCGCCTGGAAG 59.967 60.000 0.00 0.00 0.00 3.46
1342 1343 0.599728 CTGCTCTATCGCCTGGAAGC 60.600 60.000 0.00 0.00 0.00 3.86
1343 1344 1.301322 GCTCTATCGCCTGGAAGCC 60.301 63.158 0.00 0.00 0.00 4.35
1344 1345 1.006805 CTCTATCGCCTGGAAGCCG 60.007 63.158 0.00 0.00 0.00 5.52
1345 1346 1.455032 TCTATCGCCTGGAAGCCGA 60.455 57.895 0.00 0.00 35.29 5.54
1346 1347 1.006805 CTATCGCCTGGAAGCCGAG 60.007 63.158 0.00 0.00 34.21 4.63
1347 1348 1.455032 TATCGCCTGGAAGCCGAGA 60.455 57.895 0.00 0.00 34.21 4.04
1348 1349 1.040893 TATCGCCTGGAAGCCGAGAA 61.041 55.000 0.00 0.00 34.21 2.87
1349 1350 2.303549 ATCGCCTGGAAGCCGAGAAG 62.304 60.000 0.00 0.00 34.21 2.85
1350 1351 2.821810 GCCTGGAAGCCGAGAAGC 60.822 66.667 0.00 0.00 0.00 3.86
1351 1352 2.665000 CCTGGAAGCCGAGAAGCA 59.335 61.111 0.00 0.00 34.23 3.91
1352 1353 1.743252 CCTGGAAGCCGAGAAGCAC 60.743 63.158 0.00 0.00 34.23 4.40
1353 1354 1.004560 CTGGAAGCCGAGAAGCACA 60.005 57.895 0.00 0.00 34.23 4.57
1354 1355 0.603707 CTGGAAGCCGAGAAGCACAA 60.604 55.000 0.00 0.00 34.23 3.33
1355 1356 0.603707 TGGAAGCCGAGAAGCACAAG 60.604 55.000 0.00 0.00 34.23 3.16
1356 1357 1.301677 GGAAGCCGAGAAGCACAAGG 61.302 60.000 0.00 0.00 34.23 3.61
1366 1367 2.126346 GCACAAGGCGGACATTGC 60.126 61.111 0.00 0.00 0.00 3.56
1367 1368 2.629656 GCACAAGGCGGACATTGCT 61.630 57.895 0.00 0.00 0.00 3.91
1368 1369 1.305219 GCACAAGGCGGACATTGCTA 61.305 55.000 0.00 0.00 0.00 3.49
1369 1370 0.729116 CACAAGGCGGACATTGCTAG 59.271 55.000 0.00 0.00 0.00 3.42
1370 1371 0.324943 ACAAGGCGGACATTGCTAGT 59.675 50.000 0.00 0.00 0.00 2.57
1371 1372 0.729116 CAAGGCGGACATTGCTAGTG 59.271 55.000 0.00 0.00 0.00 2.74
1372 1373 0.613260 AAGGCGGACATTGCTAGTGA 59.387 50.000 0.00 0.00 0.00 3.41
1373 1374 0.613260 AGGCGGACATTGCTAGTGAA 59.387 50.000 0.00 0.00 0.00 3.18
1374 1375 1.003118 AGGCGGACATTGCTAGTGAAA 59.997 47.619 0.00 0.00 0.00 2.69
1375 1376 1.810151 GGCGGACATTGCTAGTGAAAA 59.190 47.619 0.00 0.00 0.00 2.29
1376 1377 2.423538 GGCGGACATTGCTAGTGAAAAT 59.576 45.455 0.00 0.00 0.00 1.82
1377 1378 3.487544 GGCGGACATTGCTAGTGAAAATC 60.488 47.826 0.00 0.00 0.00 2.17
1378 1379 3.126858 GCGGACATTGCTAGTGAAAATCA 59.873 43.478 0.00 0.00 0.00 2.57
1379 1380 4.201950 GCGGACATTGCTAGTGAAAATCAT 60.202 41.667 0.00 0.00 0.00 2.45
1380 1381 5.268544 CGGACATTGCTAGTGAAAATCATG 58.731 41.667 0.00 0.00 0.00 3.07
1381 1382 5.039333 GGACATTGCTAGTGAAAATCATGC 58.961 41.667 0.00 0.00 0.00 4.06
1382 1383 5.163581 GGACATTGCTAGTGAAAATCATGCT 60.164 40.000 0.00 0.00 0.00 3.79
1383 1384 6.038603 GGACATTGCTAGTGAAAATCATGCTA 59.961 38.462 0.00 0.00 0.00 3.49
1384 1385 7.255381 GGACATTGCTAGTGAAAATCATGCTAT 60.255 37.037 0.00 0.00 0.00 2.97
1385 1386 7.423199 ACATTGCTAGTGAAAATCATGCTATG 58.577 34.615 16.59 16.59 38.12 2.23
1386 1387 6.381481 TTGCTAGTGAAAATCATGCTATGG 57.619 37.500 0.00 0.00 0.00 2.74
1387 1388 4.276678 TGCTAGTGAAAATCATGCTATGGC 59.723 41.667 0.00 0.00 39.26 4.40
1388 1389 4.518211 GCTAGTGAAAATCATGCTATGGCT 59.482 41.667 1.68 0.00 39.59 4.75
1389 1390 5.702670 GCTAGTGAAAATCATGCTATGGCTA 59.297 40.000 1.68 0.00 39.59 3.93
1390 1391 6.205464 GCTAGTGAAAATCATGCTATGGCTAA 59.795 38.462 1.68 0.00 39.59 3.09
1391 1392 7.094463 GCTAGTGAAAATCATGCTATGGCTAAT 60.094 37.037 1.68 0.00 39.59 1.73
1392 1393 7.592885 AGTGAAAATCATGCTATGGCTAATT 57.407 32.000 1.68 0.00 39.59 1.40
1393 1394 7.431249 AGTGAAAATCATGCTATGGCTAATTG 58.569 34.615 1.68 0.00 39.59 2.32
1394 1395 6.643770 GTGAAAATCATGCTATGGCTAATTGG 59.356 38.462 1.68 0.00 39.59 3.16
1395 1396 6.324512 TGAAAATCATGCTATGGCTAATTGGT 59.675 34.615 1.68 0.00 39.59 3.67
1396 1397 6.736110 AAATCATGCTATGGCTAATTGGTT 57.264 33.333 1.68 0.00 39.59 3.67
1397 1398 5.972107 ATCATGCTATGGCTAATTGGTTC 57.028 39.130 1.68 0.00 39.59 3.62
1398 1399 5.052693 TCATGCTATGGCTAATTGGTTCT 57.947 39.130 1.68 0.00 39.59 3.01
1399 1400 6.186420 TCATGCTATGGCTAATTGGTTCTA 57.814 37.500 1.68 0.00 39.59 2.10
1400 1401 6.782986 TCATGCTATGGCTAATTGGTTCTAT 58.217 36.000 1.68 0.00 39.59 1.98
1401 1402 7.917003 TCATGCTATGGCTAATTGGTTCTATA 58.083 34.615 1.68 0.00 39.59 1.31
1402 1403 7.824289 TCATGCTATGGCTAATTGGTTCTATAC 59.176 37.037 1.68 0.00 39.59 1.47
1403 1404 7.073457 TGCTATGGCTAATTGGTTCTATACA 57.927 36.000 1.68 0.00 39.59 2.29
1404 1405 7.513856 TGCTATGGCTAATTGGTTCTATACAA 58.486 34.615 1.68 0.00 39.59 2.41
1405 1406 7.996066 TGCTATGGCTAATTGGTTCTATACAAA 59.004 33.333 1.68 0.00 39.59 2.83
1406 1407 8.846211 GCTATGGCTAATTGGTTCTATACAAAA 58.154 33.333 0.00 0.00 35.22 2.44
1408 1409 7.399245 TGGCTAATTGGTTCTATACAAAACC 57.601 36.000 0.00 0.00 44.29 3.27
1409 1410 6.094325 TGGCTAATTGGTTCTATACAAAACCG 59.906 38.462 0.00 0.00 46.49 4.44
1410 1411 6.316890 GGCTAATTGGTTCTATACAAAACCGA 59.683 38.462 0.00 0.00 46.49 4.69
1411 1412 7.148205 GGCTAATTGGTTCTATACAAAACCGAA 60.148 37.037 0.00 0.00 46.49 4.30
1412 1413 8.238631 GCTAATTGGTTCTATACAAAACCGAAA 58.761 33.333 0.00 0.00 46.49 3.46
1415 1416 6.746745 TGGTTCTATACAAAACCGAAATCC 57.253 37.500 0.00 0.00 46.49 3.01
1416 1417 5.352016 TGGTTCTATACAAAACCGAAATCCG 59.648 40.000 0.00 0.00 46.49 4.18
1417 1418 5.352293 GGTTCTATACAAAACCGAAATCCGT 59.648 40.000 0.00 0.00 35.93 4.69
1418 1419 6.128200 GGTTCTATACAAAACCGAAATCCGTT 60.128 38.462 0.00 0.00 35.93 4.44
1419 1420 6.651755 TCTATACAAAACCGAAATCCGTTC 57.348 37.500 0.00 0.00 36.31 3.95
1420 1421 6.400568 TCTATACAAAACCGAAATCCGTTCT 58.599 36.000 0.00 0.00 36.31 3.01
1421 1422 3.619233 ACAAAACCGAAATCCGTTCTG 57.381 42.857 0.00 0.00 36.31 3.02
1422 1423 2.946990 ACAAAACCGAAATCCGTTCTGT 59.053 40.909 0.00 0.00 35.40 3.41
1423 1424 3.379057 ACAAAACCGAAATCCGTTCTGTT 59.621 39.130 0.00 0.00 43.22 3.16
1424 1425 3.891056 AAACCGAAATCCGTTCTGTTC 57.109 42.857 0.00 0.00 41.28 3.18
1425 1426 1.804601 ACCGAAATCCGTTCTGTTCC 58.195 50.000 0.00 0.00 30.18 3.62
1426 1427 0.719465 CCGAAATCCGTTCTGTTCCG 59.281 55.000 0.00 0.00 36.31 4.30
1427 1428 1.670674 CCGAAATCCGTTCTGTTCCGA 60.671 52.381 0.00 0.00 36.31 4.55
1428 1429 2.063266 CGAAATCCGTTCTGTTCCGAA 58.937 47.619 0.00 0.00 33.70 4.30
1429 1430 2.159881 CGAAATCCGTTCTGTTCCGAAC 60.160 50.000 4.18 4.18 39.83 3.95
1430 1431 1.804601 AATCCGTTCTGTTCCGAACC 58.195 50.000 8.80 0.00 40.03 3.62
1431 1432 0.682852 ATCCGTTCTGTTCCGAACCA 59.317 50.000 8.80 0.00 40.03 3.67
1432 1433 0.464870 TCCGTTCTGTTCCGAACCAA 59.535 50.000 8.80 0.00 40.03 3.67
1433 1434 0.865769 CCGTTCTGTTCCGAACCAAG 59.134 55.000 8.80 0.91 40.03 3.61
1434 1435 1.539496 CCGTTCTGTTCCGAACCAAGA 60.539 52.381 8.80 3.30 40.03 3.02
1435 1436 2.413837 CGTTCTGTTCCGAACCAAGAT 58.586 47.619 8.80 0.00 40.03 2.40
1436 1437 3.581755 CGTTCTGTTCCGAACCAAGATA 58.418 45.455 8.80 0.00 40.03 1.98
1437 1438 3.612860 CGTTCTGTTCCGAACCAAGATAG 59.387 47.826 8.80 0.00 40.03 2.08
1438 1439 3.247006 TCTGTTCCGAACCAAGATAGC 57.753 47.619 8.80 0.00 0.00 2.97
1439 1440 2.093658 TCTGTTCCGAACCAAGATAGCC 60.094 50.000 8.80 0.00 0.00 3.93
1440 1441 1.065709 TGTTCCGAACCAAGATAGCCC 60.066 52.381 8.80 0.00 0.00 5.19
1441 1442 1.065709 GTTCCGAACCAAGATAGCCCA 60.066 52.381 0.00 0.00 0.00 5.36
1442 1443 0.830648 TCCGAACCAAGATAGCCCAG 59.169 55.000 0.00 0.00 0.00 4.45
1443 1444 0.179045 CCGAACCAAGATAGCCCAGG 60.179 60.000 0.00 0.00 0.00 4.45
1444 1445 0.830648 CGAACCAAGATAGCCCAGGA 59.169 55.000 0.00 0.00 0.00 3.86
1445 1446 1.202580 CGAACCAAGATAGCCCAGGAG 60.203 57.143 0.00 0.00 0.00 3.69
1446 1447 1.141858 GAACCAAGATAGCCCAGGAGG 59.858 57.143 0.00 0.00 39.47 4.30
1447 1448 0.044855 ACCAAGATAGCCCAGGAGGT 59.955 55.000 0.00 0.00 38.26 3.85
1448 1449 1.216990 CCAAGATAGCCCAGGAGGTT 58.783 55.000 0.00 0.00 38.26 3.50
1449 1450 2.293586 ACCAAGATAGCCCAGGAGGTTA 60.294 50.000 0.00 0.00 38.26 2.85
1450 1451 2.777692 CCAAGATAGCCCAGGAGGTTAA 59.222 50.000 0.00 0.00 34.60 2.01
1451 1452 3.181450 CCAAGATAGCCCAGGAGGTTAAG 60.181 52.174 0.00 0.00 34.60 1.85
1452 1453 2.695585 AGATAGCCCAGGAGGTTAAGG 58.304 52.381 0.00 0.00 34.60 2.69
1453 1454 2.250273 AGATAGCCCAGGAGGTTAAGGA 59.750 50.000 0.00 0.00 34.60 3.36
1454 1455 2.653543 TAGCCCAGGAGGTTAAGGAA 57.346 50.000 0.00 0.00 38.26 3.36
1455 1456 1.755200 AGCCCAGGAGGTTAAGGAAA 58.245 50.000 0.00 0.00 38.26 3.13
1456 1457 2.288525 AGCCCAGGAGGTTAAGGAAAT 58.711 47.619 0.00 0.00 38.26 2.17
1457 1458 2.242452 AGCCCAGGAGGTTAAGGAAATC 59.758 50.000 0.00 0.00 38.26 2.17
1458 1459 2.025321 GCCCAGGAGGTTAAGGAAATCA 60.025 50.000 0.00 0.00 38.26 2.57
1459 1460 3.563479 GCCCAGGAGGTTAAGGAAATCAA 60.563 47.826 0.00 0.00 38.26 2.57
1460 1461 4.273318 CCCAGGAGGTTAAGGAAATCAAG 58.727 47.826 0.00 0.00 0.00 3.02
1461 1462 4.018415 CCCAGGAGGTTAAGGAAATCAAGA 60.018 45.833 0.00 0.00 0.00 3.02
1462 1463 5.516591 CCCAGGAGGTTAAGGAAATCAAGAA 60.517 44.000 0.00 0.00 0.00 2.52
1463 1464 5.649831 CCAGGAGGTTAAGGAAATCAAGAAG 59.350 44.000 0.00 0.00 0.00 2.85
1464 1465 6.476378 CAGGAGGTTAAGGAAATCAAGAAGA 58.524 40.000 0.00 0.00 0.00 2.87
1465 1466 6.597280 CAGGAGGTTAAGGAAATCAAGAAGAG 59.403 42.308 0.00 0.00 0.00 2.85
1466 1467 6.502158 AGGAGGTTAAGGAAATCAAGAAGAGA 59.498 38.462 0.00 0.00 0.00 3.10
1467 1468 7.183657 AGGAGGTTAAGGAAATCAAGAAGAGAT 59.816 37.037 0.00 0.00 0.00 2.75
1468 1469 7.831690 GGAGGTTAAGGAAATCAAGAAGAGATT 59.168 37.037 0.00 0.00 37.30 2.40
1469 1470 8.800370 AGGTTAAGGAAATCAAGAAGAGATTC 57.200 34.615 0.00 0.00 34.78 2.52
1470 1471 7.550906 AGGTTAAGGAAATCAAGAAGAGATTCG 59.449 37.037 0.00 0.00 34.78 3.34
1471 1472 5.809719 AAGGAAATCAAGAAGAGATTCGC 57.190 39.130 0.00 0.00 34.78 4.70
1472 1473 3.868077 AGGAAATCAAGAAGAGATTCGCG 59.132 43.478 0.00 0.00 34.78 5.87
1473 1474 3.865745 GGAAATCAAGAAGAGATTCGCGA 59.134 43.478 3.71 3.71 34.78 5.87
1474 1475 4.330074 GGAAATCAAGAAGAGATTCGCGAA 59.670 41.667 25.66 25.66 34.78 4.70
1475 1476 5.163854 GGAAATCAAGAAGAGATTCGCGAAA 60.164 40.000 27.23 9.62 34.78 3.46
1476 1477 5.862924 AATCAAGAAGAGATTCGCGAAAA 57.137 34.783 27.23 3.73 30.16 2.29
1477 1478 6.428385 AATCAAGAAGAGATTCGCGAAAAT 57.572 33.333 27.23 17.23 30.16 1.82
1478 1479 5.862924 TCAAGAAGAGATTCGCGAAAATT 57.137 34.783 27.23 17.04 0.00 1.82
1479 1480 5.621422 TCAAGAAGAGATTCGCGAAAATTG 58.379 37.500 27.23 19.66 0.00 2.32
1480 1481 5.179368 TCAAGAAGAGATTCGCGAAAATTGT 59.821 36.000 27.23 8.89 0.00 2.71
1481 1482 4.962693 AGAAGAGATTCGCGAAAATTGTG 58.037 39.130 27.23 0.00 0.00 3.33
1482 1483 4.690748 AGAAGAGATTCGCGAAAATTGTGA 59.309 37.500 27.23 0.00 0.00 3.58
1483 1484 5.179368 AGAAGAGATTCGCGAAAATTGTGAA 59.821 36.000 27.23 0.00 39.85 3.18
1484 1485 4.962693 AGAGATTCGCGAAAATTGTGAAG 58.037 39.130 27.23 0.00 39.02 3.02
1485 1486 3.492313 AGATTCGCGAAAATTGTGAAGC 58.508 40.909 27.23 1.60 41.24 3.86
1486 1487 2.765108 TTCGCGAAAATTGTGAAGCA 57.235 40.000 21.14 0.00 32.49 3.91
1487 1488 2.314561 TCGCGAAAATTGTGAAGCAG 57.685 45.000 6.20 0.00 0.00 4.24
1488 1489 0.704551 CGCGAAAATTGTGAAGCAGC 59.295 50.000 0.00 0.00 0.00 5.25
1489 1490 0.704551 GCGAAAATTGTGAAGCAGCG 59.295 50.000 0.00 0.00 0.00 5.18
1490 1491 1.662876 GCGAAAATTGTGAAGCAGCGA 60.663 47.619 0.00 0.00 0.00 4.93
1491 1492 2.236690 CGAAAATTGTGAAGCAGCGAG 58.763 47.619 0.00 0.00 0.00 5.03
1492 1493 1.981533 GAAAATTGTGAAGCAGCGAGC 59.018 47.619 0.00 0.00 46.19 5.03
1501 1502 3.957260 GCAGCGAGCTGACTTCAA 58.043 55.556 27.09 0.00 46.30 2.69
1502 1503 2.464682 GCAGCGAGCTGACTTCAAT 58.535 52.632 27.09 0.00 46.30 2.57
1503 1504 0.096628 GCAGCGAGCTGACTTCAATG 59.903 55.000 27.09 0.22 46.30 2.82
1504 1505 0.096628 CAGCGAGCTGACTTCAATGC 59.903 55.000 19.40 0.00 46.30 3.56
1505 1506 0.321034 AGCGAGCTGACTTCAATGCA 60.321 50.000 0.00 0.00 0.00 3.96
1506 1507 0.518636 GCGAGCTGACTTCAATGCAA 59.481 50.000 0.00 0.00 0.00 4.08
1507 1508 1.131883 GCGAGCTGACTTCAATGCAAT 59.868 47.619 0.00 0.00 0.00 3.56
1508 1509 2.352651 GCGAGCTGACTTCAATGCAATA 59.647 45.455 0.00 0.00 0.00 1.90
1509 1510 3.545624 GCGAGCTGACTTCAATGCAATAG 60.546 47.826 0.00 0.00 0.00 1.73
1510 1511 3.620374 CGAGCTGACTTCAATGCAATAGT 59.380 43.478 0.00 0.00 0.00 2.12
1511 1512 4.805719 CGAGCTGACTTCAATGCAATAGTA 59.194 41.667 0.00 0.00 0.00 1.82
1512 1513 5.291858 CGAGCTGACTTCAATGCAATAGTAA 59.708 40.000 0.00 0.00 0.00 2.24
1513 1514 6.428385 AGCTGACTTCAATGCAATAGTAAC 57.572 37.500 0.00 0.00 0.00 2.50
1514 1515 6.176183 AGCTGACTTCAATGCAATAGTAACT 58.824 36.000 0.00 0.00 0.00 2.24
1515 1516 7.331026 AGCTGACTTCAATGCAATAGTAACTA 58.669 34.615 0.00 0.00 0.00 2.24
1516 1517 7.493971 AGCTGACTTCAATGCAATAGTAACTAG 59.506 37.037 0.00 0.00 0.00 2.57
1517 1518 7.278868 GCTGACTTCAATGCAATAGTAACTAGT 59.721 37.037 0.00 0.00 0.00 2.57
1518 1519 9.803315 CTGACTTCAATGCAATAGTAACTAGTA 57.197 33.333 0.00 0.00 0.00 1.82
1519 1520 9.803315 TGACTTCAATGCAATAGTAACTAGTAG 57.197 33.333 0.00 0.00 0.00 2.57
1520 1521 9.804758 GACTTCAATGCAATAGTAACTAGTAGT 57.195 33.333 0.00 0.00 0.00 2.73
1528 1529 9.896645 TGCAATAGTAACTAGTAGTAGTACACT 57.103 33.333 20.48 20.48 38.66 3.55
1539 1540 9.467258 CTAGTAGTAGTACACTAGTCACTCATC 57.533 40.741 20.51 3.94 41.60 2.92
1540 1541 7.849160 AGTAGTAGTACACTAGTCACTCATCA 58.151 38.462 10.33 0.00 38.80 3.07
1541 1542 8.487848 AGTAGTAGTACACTAGTCACTCATCAT 58.512 37.037 10.33 0.00 38.80 2.45
1542 1543 7.561021 AGTAGTACACTAGTCACTCATCATG 57.439 40.000 9.43 0.00 34.98 3.07
1543 1544 7.113437 AGTAGTACACTAGTCACTCATCATGT 58.887 38.462 9.43 0.00 34.98 3.21
1544 1545 6.842437 AGTACACTAGTCACTCATCATGTT 57.158 37.500 0.00 0.00 0.00 2.71
1545 1546 6.857956 AGTACACTAGTCACTCATCATGTTC 58.142 40.000 0.00 0.00 0.00 3.18
1546 1547 5.728637 ACACTAGTCACTCATCATGTTCA 57.271 39.130 0.00 0.00 0.00 3.18
1547 1548 6.291648 ACACTAGTCACTCATCATGTTCAT 57.708 37.500 0.00 0.00 0.00 2.57
1548 1549 6.336566 ACACTAGTCACTCATCATGTTCATC 58.663 40.000 0.00 0.00 0.00 2.92
1549 1550 5.752472 CACTAGTCACTCATCATGTTCATCC 59.248 44.000 0.00 0.00 0.00 3.51
1550 1551 5.660417 ACTAGTCACTCATCATGTTCATCCT 59.340 40.000 0.00 0.00 0.00 3.24
1551 1552 6.836007 ACTAGTCACTCATCATGTTCATCCTA 59.164 38.462 0.00 0.00 0.00 2.94
1552 1553 5.911752 AGTCACTCATCATGTTCATCCTAC 58.088 41.667 0.00 0.00 0.00 3.18
1553 1554 5.423290 AGTCACTCATCATGTTCATCCTACA 59.577 40.000 0.00 0.00 0.00 2.74
1554 1555 5.521735 GTCACTCATCATGTTCATCCTACAC 59.478 44.000 0.00 0.00 0.00 2.90
1555 1556 5.187576 TCACTCATCATGTTCATCCTACACA 59.812 40.000 0.00 0.00 0.00 3.72
1556 1557 5.292834 CACTCATCATGTTCATCCTACACAC 59.707 44.000 0.00 0.00 0.00 3.82
1557 1558 5.046376 ACTCATCATGTTCATCCTACACACA 60.046 40.000 0.00 0.00 0.00 3.72
1558 1559 5.803552 TCATCATGTTCATCCTACACACAA 58.196 37.500 0.00 0.00 0.00 3.33
1559 1560 5.876460 TCATCATGTTCATCCTACACACAAG 59.124 40.000 0.00 0.00 0.00 3.16
1560 1561 5.482163 TCATGTTCATCCTACACACAAGA 57.518 39.130 0.00 0.00 0.00 3.02
1561 1562 5.237815 TCATGTTCATCCTACACACAAGAC 58.762 41.667 0.00 0.00 0.00 3.01
1562 1563 4.681074 TGTTCATCCTACACACAAGACA 57.319 40.909 0.00 0.00 0.00 3.41
1563 1564 5.029807 TGTTCATCCTACACACAAGACAA 57.970 39.130 0.00 0.00 0.00 3.18
1564 1565 5.620206 TGTTCATCCTACACACAAGACAAT 58.380 37.500 0.00 0.00 0.00 2.71
1565 1566 6.764379 TGTTCATCCTACACACAAGACAATA 58.236 36.000 0.00 0.00 0.00 1.90
1566 1567 6.873605 TGTTCATCCTACACACAAGACAATAG 59.126 38.462 0.00 0.00 0.00 1.73
1567 1568 5.977635 TCATCCTACACACAAGACAATAGG 58.022 41.667 0.00 0.00 0.00 2.57
1568 1569 4.819105 TCCTACACACAAGACAATAGGG 57.181 45.455 0.00 0.00 31.80 3.53
1569 1570 3.517901 TCCTACACACAAGACAATAGGGG 59.482 47.826 0.00 0.00 31.80 4.79
1570 1571 3.517901 CCTACACACAAGACAATAGGGGA 59.482 47.826 0.00 0.00 0.00 4.81
1571 1572 3.703001 ACACACAAGACAATAGGGGAG 57.297 47.619 0.00 0.00 0.00 4.30
1572 1573 3.248024 ACACACAAGACAATAGGGGAGA 58.752 45.455 0.00 0.00 0.00 3.71
1573 1574 3.846588 ACACACAAGACAATAGGGGAGAT 59.153 43.478 0.00 0.00 0.00 2.75
1574 1575 4.194640 CACACAAGACAATAGGGGAGATG 58.805 47.826 0.00 0.00 0.00 2.90
1575 1576 3.846588 ACACAAGACAATAGGGGAGATGT 59.153 43.478 0.00 0.00 0.00 3.06
1576 1577 4.080863 ACACAAGACAATAGGGGAGATGTC 60.081 45.833 0.00 0.00 41.88 3.06
1577 1578 4.080919 CACAAGACAATAGGGGAGATGTCA 60.081 45.833 7.42 0.00 43.53 3.58
1578 1579 4.536090 ACAAGACAATAGGGGAGATGTCAA 59.464 41.667 7.42 0.00 43.53 3.18
1579 1580 5.192522 ACAAGACAATAGGGGAGATGTCAAT 59.807 40.000 7.42 0.00 43.53 2.57
1580 1581 6.386927 ACAAGACAATAGGGGAGATGTCAATA 59.613 38.462 7.42 0.00 43.53 1.90
1581 1582 7.072961 ACAAGACAATAGGGGAGATGTCAATAT 59.927 37.037 7.42 0.00 43.53 1.28
1582 1583 7.639062 AGACAATAGGGGAGATGTCAATATT 57.361 36.000 7.42 0.00 43.53 1.28
1583 1584 7.456725 AGACAATAGGGGAGATGTCAATATTG 58.543 38.462 9.29 9.29 43.53 1.90
1584 1585 6.546484 ACAATAGGGGAGATGTCAATATTGG 58.454 40.000 15.36 0.00 32.96 3.16
1585 1586 3.515602 AGGGGAGATGTCAATATTGGC 57.484 47.619 13.24 13.24 0.00 4.52
1587 1588 3.205056 AGGGGAGATGTCAATATTGGCAA 59.795 43.478 25.41 10.28 46.95 4.52
1588 1589 3.960102 GGGGAGATGTCAATATTGGCAAA 59.040 43.478 25.41 4.66 46.95 3.68
1589 1590 4.590222 GGGGAGATGTCAATATTGGCAAAT 59.410 41.667 25.41 16.86 46.95 2.32
1590 1591 5.774690 GGGGAGATGTCAATATTGGCAAATA 59.225 40.000 25.41 3.52 46.95 1.40
1591 1592 6.294731 GGGGAGATGTCAATATTGGCAAATAC 60.295 42.308 25.41 17.00 46.95 1.89
1592 1593 6.294731 GGGAGATGTCAATATTGGCAAATACC 60.295 42.308 25.41 21.38 46.95 2.73
1593 1594 6.265196 GGAGATGTCAATATTGGCAAATACCA 59.735 38.462 25.41 1.62 46.95 3.25
1594 1595 7.042797 AGATGTCAATATTGGCAAATACCAC 57.957 36.000 25.41 8.71 46.95 4.16
1595 1596 6.606796 AGATGTCAATATTGGCAAATACCACA 59.393 34.615 25.41 13.73 46.95 4.17
1596 1597 5.960113 TGTCAATATTGGCAAATACCACAC 58.040 37.500 20.12 4.64 40.28 3.82
1597 1598 5.478332 TGTCAATATTGGCAAATACCACACA 59.522 36.000 20.12 7.12 40.28 3.72
1598 1599 6.154192 TGTCAATATTGGCAAATACCACACAT 59.846 34.615 20.12 0.00 40.28 3.21
1599 1600 6.476380 GTCAATATTGGCAAATACCACACATG 59.524 38.462 15.16 0.00 40.19 3.21
1600 1601 6.154192 TCAATATTGGCAAATACCACACATGT 59.846 34.615 15.36 0.00 40.19 3.21
1601 1602 7.340487 TCAATATTGGCAAATACCACACATGTA 59.660 33.333 15.36 0.00 40.19 2.29
1602 1603 7.838079 ATATTGGCAAATACCACACATGTAT 57.162 32.000 3.01 0.00 40.19 2.29
1603 1604 5.991933 TTGGCAAATACCACACATGTATT 57.008 34.783 0.00 0.00 40.19 1.89
1604 1605 5.991933 TGGCAAATACCACACATGTATTT 57.008 34.783 0.00 0.00 45.21 1.40
1610 1611 6.773976 AATACCACACATGTATTTGGAAGG 57.226 37.500 21.46 9.80 35.85 3.46
1611 1612 3.430453 ACCACACATGTATTTGGAAGGG 58.570 45.455 21.46 0.78 33.02 3.95
1612 1613 3.075283 ACCACACATGTATTTGGAAGGGA 59.925 43.478 21.46 0.00 33.02 4.20
1613 1614 4.264352 ACCACACATGTATTTGGAAGGGAT 60.264 41.667 21.46 1.65 33.02 3.85
1614 1615 4.098349 CCACACATGTATTTGGAAGGGATG 59.902 45.833 12.90 0.00 0.00 3.51
1615 1616 4.949238 CACACATGTATTTGGAAGGGATGA 59.051 41.667 0.00 0.00 0.00 2.92
1616 1617 5.066893 CACACATGTATTTGGAAGGGATGAG 59.933 44.000 0.00 0.00 0.00 2.90
1617 1618 4.581824 CACATGTATTTGGAAGGGATGAGG 59.418 45.833 0.00 0.00 0.00 3.86
1618 1619 4.230502 ACATGTATTTGGAAGGGATGAGGT 59.769 41.667 0.00 0.00 0.00 3.85
1619 1620 4.503714 TGTATTTGGAAGGGATGAGGTC 57.496 45.455 0.00 0.00 0.00 3.85
1620 1621 3.849574 TGTATTTGGAAGGGATGAGGTCA 59.150 43.478 0.00 0.00 0.00 4.02
1621 1622 4.290985 TGTATTTGGAAGGGATGAGGTCAA 59.709 41.667 0.00 0.00 0.00 3.18
1622 1623 3.439857 TTTGGAAGGGATGAGGTCAAG 57.560 47.619 0.00 0.00 0.00 3.02
1623 1624 2.044793 TGGAAGGGATGAGGTCAAGT 57.955 50.000 0.00 0.00 0.00 3.16
1624 1625 3.199442 TGGAAGGGATGAGGTCAAGTA 57.801 47.619 0.00 0.00 0.00 2.24
1625 1626 3.736094 TGGAAGGGATGAGGTCAAGTAT 58.264 45.455 0.00 0.00 0.00 2.12
1626 1627 4.890988 TGGAAGGGATGAGGTCAAGTATA 58.109 43.478 0.00 0.00 0.00 1.47
1627 1628 4.901849 TGGAAGGGATGAGGTCAAGTATAG 59.098 45.833 0.00 0.00 0.00 1.31
1628 1629 4.262678 GGAAGGGATGAGGTCAAGTATAGC 60.263 50.000 0.00 0.00 0.00 2.97
1629 1630 3.928754 AGGGATGAGGTCAAGTATAGCA 58.071 45.455 0.00 0.00 0.00 3.49
1630 1631 4.497516 AGGGATGAGGTCAAGTATAGCAT 58.502 43.478 0.00 0.00 0.00 3.79
1631 1632 4.530161 AGGGATGAGGTCAAGTATAGCATC 59.470 45.833 0.00 0.00 0.00 3.91
1632 1633 4.489810 GGATGAGGTCAAGTATAGCATCG 58.510 47.826 0.00 0.00 33.37 3.84
1633 1634 4.021894 GGATGAGGTCAAGTATAGCATCGT 60.022 45.833 0.00 0.00 33.37 3.73
1634 1635 5.183331 GGATGAGGTCAAGTATAGCATCGTA 59.817 44.000 0.00 0.00 33.37 3.43
1635 1636 6.127591 GGATGAGGTCAAGTATAGCATCGTAT 60.128 42.308 0.00 0.00 33.37 3.06
1636 1637 6.255596 TGAGGTCAAGTATAGCATCGTATC 57.744 41.667 0.00 0.00 0.00 2.24
1637 1638 6.004574 TGAGGTCAAGTATAGCATCGTATCT 58.995 40.000 0.00 0.00 0.00 1.98
1638 1639 7.166167 TGAGGTCAAGTATAGCATCGTATCTA 58.834 38.462 0.00 0.00 0.00 1.98
1639 1640 7.664318 TGAGGTCAAGTATAGCATCGTATCTAA 59.336 37.037 0.00 0.00 0.00 2.10
1640 1641 8.046294 AGGTCAAGTATAGCATCGTATCTAAG 57.954 38.462 0.00 0.00 0.00 2.18
1641 1642 6.748198 GGTCAAGTATAGCATCGTATCTAAGC 59.252 42.308 0.00 0.00 0.00 3.09
1642 1643 7.362229 GGTCAAGTATAGCATCGTATCTAAGCT 60.362 40.741 0.00 0.00 39.22 3.74
1643 1644 8.666573 GTCAAGTATAGCATCGTATCTAAGCTA 58.333 37.037 0.00 0.00 41.46 3.32
1644 1645 8.884726 TCAAGTATAGCATCGTATCTAAGCTAG 58.115 37.037 0.00 0.00 40.66 3.42
1645 1646 8.670135 CAAGTATAGCATCGTATCTAAGCTAGT 58.330 37.037 0.00 0.00 40.66 2.57
1646 1647 9.887629 AAGTATAGCATCGTATCTAAGCTAGTA 57.112 33.333 0.00 0.00 40.66 1.82
1647 1648 9.537192 AGTATAGCATCGTATCTAAGCTAGTAG 57.463 37.037 0.00 0.00 40.66 2.57
1648 1649 9.531942 GTATAGCATCGTATCTAAGCTAGTAGA 57.468 37.037 0.00 0.00 40.66 2.59
1649 1650 6.978343 AGCATCGTATCTAAGCTAGTAGAG 57.022 41.667 0.00 0.00 33.66 2.43
1650 1651 5.878116 AGCATCGTATCTAAGCTAGTAGAGG 59.122 44.000 0.00 0.00 33.66 3.69
1651 1652 5.448089 GCATCGTATCTAAGCTAGTAGAGGC 60.448 48.000 0.00 0.00 33.66 4.70
1652 1653 5.486735 TCGTATCTAAGCTAGTAGAGGCT 57.513 43.478 0.00 0.00 40.85 4.58
1653 1654 5.239351 TCGTATCTAAGCTAGTAGAGGCTG 58.761 45.833 0.00 0.00 38.91 4.85
1654 1655 5.011840 TCGTATCTAAGCTAGTAGAGGCTGA 59.988 44.000 0.00 0.00 38.91 4.26
1655 1656 5.878116 CGTATCTAAGCTAGTAGAGGCTGAT 59.122 44.000 0.00 0.68 38.91 2.90
1656 1657 7.042950 CGTATCTAAGCTAGTAGAGGCTGATA 58.957 42.308 0.00 0.00 38.91 2.15
1657 1658 7.223971 CGTATCTAAGCTAGTAGAGGCTGATAG 59.776 44.444 0.00 0.00 38.91 2.08
1658 1659 6.442541 TCTAAGCTAGTAGAGGCTGATAGT 57.557 41.667 0.00 0.00 38.91 2.12
1659 1660 6.469410 TCTAAGCTAGTAGAGGCTGATAGTC 58.531 44.000 0.00 0.00 38.91 2.59
1660 1661 4.715534 AGCTAGTAGAGGCTGATAGTCA 57.284 45.455 0.00 0.00 37.41 3.41
1661 1662 5.255397 AGCTAGTAGAGGCTGATAGTCAT 57.745 43.478 0.00 0.00 37.41 3.06
1662 1663 6.381498 AGCTAGTAGAGGCTGATAGTCATA 57.619 41.667 0.00 0.00 37.41 2.15
1663 1664 6.414732 AGCTAGTAGAGGCTGATAGTCATAG 58.585 44.000 0.00 0.00 37.41 2.23
1664 1665 6.012858 AGCTAGTAGAGGCTGATAGTCATAGT 60.013 42.308 0.00 0.00 37.41 2.12
1665 1666 7.181305 AGCTAGTAGAGGCTGATAGTCATAGTA 59.819 40.741 0.00 0.00 37.41 1.82
1666 1667 7.279313 GCTAGTAGAGGCTGATAGTCATAGTAC 59.721 44.444 0.00 0.00 0.00 2.73
1667 1668 6.478129 AGTAGAGGCTGATAGTCATAGTACC 58.522 44.000 0.00 0.00 0.00 3.34
1668 1669 4.668636 AGAGGCTGATAGTCATAGTACCC 58.331 47.826 0.00 0.00 0.00 3.69
1669 1670 4.106502 AGAGGCTGATAGTCATAGTACCCA 59.893 45.833 0.00 0.00 0.00 4.51
1670 1671 4.816126 AGGCTGATAGTCATAGTACCCAA 58.184 43.478 0.00 0.00 0.00 4.12
1671 1672 4.835615 AGGCTGATAGTCATAGTACCCAAG 59.164 45.833 0.00 0.00 0.00 3.61
1672 1673 4.833380 GGCTGATAGTCATAGTACCCAAGA 59.167 45.833 0.00 0.00 0.00 3.02
1673 1674 5.279056 GGCTGATAGTCATAGTACCCAAGAC 60.279 48.000 0.00 0.00 0.00 3.01
1674 1675 5.302059 GCTGATAGTCATAGTACCCAAGACA 59.698 44.000 7.72 0.00 0.00 3.41
1675 1676 6.515862 GCTGATAGTCATAGTACCCAAGACAG 60.516 46.154 7.72 0.00 0.00 3.51
1676 1677 5.833667 TGATAGTCATAGTACCCAAGACAGG 59.166 44.000 7.72 0.00 0.00 4.00
1677 1678 4.332683 AGTCATAGTACCCAAGACAGGA 57.667 45.455 7.72 0.00 0.00 3.86
1678 1679 4.884961 AGTCATAGTACCCAAGACAGGAT 58.115 43.478 7.72 0.00 0.00 3.24
1679 1680 4.651503 AGTCATAGTACCCAAGACAGGATG 59.348 45.833 7.72 0.00 46.00 3.51
1680 1681 3.388024 TCATAGTACCCAAGACAGGATGC 59.612 47.826 0.00 0.00 42.53 3.91
1681 1682 0.912486 AGTACCCAAGACAGGATGCC 59.088 55.000 0.00 0.00 42.53 4.40
1682 1683 0.462047 GTACCCAAGACAGGATGCCG 60.462 60.000 0.00 0.00 42.53 5.69
1683 1684 0.616395 TACCCAAGACAGGATGCCGA 60.616 55.000 0.00 0.00 42.53 5.54
1684 1685 1.274703 ACCCAAGACAGGATGCCGAT 61.275 55.000 0.00 0.00 42.53 4.18
1685 1686 0.758734 CCCAAGACAGGATGCCGATA 59.241 55.000 0.00 0.00 42.53 2.92
1686 1687 1.270518 CCCAAGACAGGATGCCGATAG 60.271 57.143 0.00 0.00 42.53 2.08
1687 1688 1.414181 CCAAGACAGGATGCCGATAGT 59.586 52.381 0.00 0.00 42.53 2.12
1688 1689 2.158900 CCAAGACAGGATGCCGATAGTT 60.159 50.000 0.00 0.00 42.53 2.24
1689 1690 3.535561 CAAGACAGGATGCCGATAGTTT 58.464 45.455 0.00 0.00 42.53 2.66
1690 1691 3.460857 AGACAGGATGCCGATAGTTTC 57.539 47.619 0.00 0.00 42.53 2.78
1691 1692 3.034635 AGACAGGATGCCGATAGTTTCT 58.965 45.455 0.00 0.00 42.53 2.52
1692 1693 3.126831 GACAGGATGCCGATAGTTTCTG 58.873 50.000 0.00 0.00 42.53 3.02
1693 1694 2.501723 ACAGGATGCCGATAGTTTCTGT 59.498 45.455 0.00 0.00 42.53 3.41
1694 1695 3.055094 ACAGGATGCCGATAGTTTCTGTT 60.055 43.478 0.00 0.00 42.53 3.16
1695 1696 3.310774 CAGGATGCCGATAGTTTCTGTTG 59.689 47.826 0.00 0.00 0.00 3.33
1696 1697 3.055094 AGGATGCCGATAGTTTCTGTTGT 60.055 43.478 0.00 0.00 0.00 3.32
1697 1698 3.309954 GGATGCCGATAGTTTCTGTTGTC 59.690 47.826 0.00 0.00 0.00 3.18
1698 1699 2.333926 TGCCGATAGTTTCTGTTGTCG 58.666 47.619 0.00 0.00 0.00 4.35
1700 1701 2.268298 CCGATAGTTTCTGTTGTCGGG 58.732 52.381 3.84 0.00 43.47 5.14
1701 1702 2.353406 CCGATAGTTTCTGTTGTCGGGT 60.353 50.000 3.84 0.00 43.47 5.28
1702 1703 3.323243 CGATAGTTTCTGTTGTCGGGTT 58.677 45.455 0.00 0.00 0.00 4.11
1703 1704 4.487948 CGATAGTTTCTGTTGTCGGGTTA 58.512 43.478 0.00 0.00 0.00 2.85
1704 1705 4.561606 CGATAGTTTCTGTTGTCGGGTTAG 59.438 45.833 0.00 0.00 0.00 2.34
1705 1706 3.121738 AGTTTCTGTTGTCGGGTTAGG 57.878 47.619 0.00 0.00 0.00 2.69
1706 1707 2.436911 AGTTTCTGTTGTCGGGTTAGGT 59.563 45.455 0.00 0.00 0.00 3.08
1707 1708 2.536761 TTCTGTTGTCGGGTTAGGTG 57.463 50.000 0.00 0.00 0.00 4.00
1708 1709 0.682852 TCTGTTGTCGGGTTAGGTGG 59.317 55.000 0.00 0.00 0.00 4.61
1709 1710 0.321298 CTGTTGTCGGGTTAGGTGGG 60.321 60.000 0.00 0.00 0.00 4.61
1710 1711 1.055551 TGTTGTCGGGTTAGGTGGGT 61.056 55.000 0.00 0.00 0.00 4.51
1711 1712 0.321034 GTTGTCGGGTTAGGTGGGTC 60.321 60.000 0.00 0.00 0.00 4.46
1712 1713 0.472352 TTGTCGGGTTAGGTGGGTCT 60.472 55.000 0.00 0.00 0.00 3.85
1713 1714 1.189524 TGTCGGGTTAGGTGGGTCTG 61.190 60.000 0.00 0.00 0.00 3.51
1714 1715 1.611261 TCGGGTTAGGTGGGTCTGG 60.611 63.158 0.00 0.00 0.00 3.86
1715 1716 2.675371 GGGTTAGGTGGGTCTGGC 59.325 66.667 0.00 0.00 0.00 4.85
1716 1717 2.228480 GGGTTAGGTGGGTCTGGCA 61.228 63.158 0.00 0.00 0.00 4.92
1717 1718 1.765074 GGTTAGGTGGGTCTGGCAA 59.235 57.895 0.00 0.00 0.00 4.52
1718 1719 0.111639 GGTTAGGTGGGTCTGGCAAA 59.888 55.000 0.00 0.00 0.00 3.68
1719 1720 1.479757 GGTTAGGTGGGTCTGGCAAAA 60.480 52.381 0.00 0.00 0.00 2.44
1720 1721 1.611977 GTTAGGTGGGTCTGGCAAAAC 59.388 52.381 0.00 0.00 0.00 2.43
1721 1722 1.145571 TAGGTGGGTCTGGCAAAACT 58.854 50.000 0.00 0.00 0.00 2.66
1722 1723 1.145571 AGGTGGGTCTGGCAAAACTA 58.854 50.000 0.00 0.00 0.00 2.24
1723 1724 1.202891 AGGTGGGTCTGGCAAAACTAC 60.203 52.381 0.00 0.00 0.00 2.73
1724 1725 1.202891 GGTGGGTCTGGCAAAACTACT 60.203 52.381 0.00 0.00 0.00 2.57
1725 1726 2.583143 GTGGGTCTGGCAAAACTACTT 58.417 47.619 0.00 0.00 0.00 2.24
1726 1727 2.956333 GTGGGTCTGGCAAAACTACTTT 59.044 45.455 0.00 0.00 0.00 2.66
1727 1728 2.955660 TGGGTCTGGCAAAACTACTTTG 59.044 45.455 0.00 0.00 46.20 2.77
1728 1729 2.296190 GGGTCTGGCAAAACTACTTTGG 59.704 50.000 0.00 0.00 44.03 3.28
1739 1740 8.716646 GCAAAACTACTTTGGCCAAATATATT 57.283 30.769 30.46 19.01 44.03 1.28
1740 1741 9.161629 GCAAAACTACTTTGGCCAAATATATTT 57.838 29.630 30.46 22.94 44.03 1.40
1742 1743 8.716646 AAACTACTTTGGCCAAATATATTTGC 57.283 30.769 30.46 21.34 44.32 3.68
1743 1744 6.816136 ACTACTTTGGCCAAATATATTTGCC 58.184 36.000 30.46 27.43 44.32 4.52
1744 1745 5.690464 ACTTTGGCCAAATATATTTGCCA 57.310 34.783 30.17 30.17 44.39 4.92
1745 1746 5.673514 ACTTTGGCCAAATATATTTGCCAG 58.326 37.500 30.93 26.51 45.43 4.85
1746 1747 4.686191 TTGGCCAAATATATTTGCCAGG 57.314 40.909 30.93 21.44 45.43 4.45
1747 1748 3.921104 TGGCCAAATATATTTGCCAGGA 58.079 40.909 30.17 18.79 42.89 3.86
1748 1749 4.491675 TGGCCAAATATATTTGCCAGGAT 58.508 39.130 30.17 4.02 42.89 3.24
1749 1750 5.649265 TGGCCAAATATATTTGCCAGGATA 58.351 37.500 30.17 18.34 42.89 2.59
1750 1751 5.716228 TGGCCAAATATATTTGCCAGGATAG 59.284 40.000 30.17 18.58 42.89 2.08
1751 1752 5.394553 GGCCAAATATATTTGCCAGGATAGC 60.395 44.000 28.30 22.91 44.32 2.97
1752 1753 5.185635 GCCAAATATATTTGCCAGGATAGCA 59.814 40.000 26.29 0.00 44.32 3.49
1759 1760 2.820059 TGCCAGGATAGCAAGATACG 57.180 50.000 0.00 0.00 37.28 3.06
1760 1761 1.344438 TGCCAGGATAGCAAGATACGG 59.656 52.381 0.00 0.00 37.28 4.02
1761 1762 1.941668 GCCAGGATAGCAAGATACGGC 60.942 57.143 0.00 0.00 0.00 5.68
1762 1763 1.344438 CCAGGATAGCAAGATACGGCA 59.656 52.381 0.00 0.00 0.00 5.69
1763 1764 2.224281 CCAGGATAGCAAGATACGGCAA 60.224 50.000 0.00 0.00 0.00 4.52
1764 1765 2.802816 CAGGATAGCAAGATACGGCAAC 59.197 50.000 0.00 0.00 0.00 4.17
1765 1766 2.434336 AGGATAGCAAGATACGGCAACA 59.566 45.455 0.00 0.00 0.00 3.33
1766 1767 2.544267 GGATAGCAAGATACGGCAACAC 59.456 50.000 0.00 0.00 0.00 3.32
1767 1768 3.458189 GATAGCAAGATACGGCAACACT 58.542 45.455 0.00 0.00 0.00 3.55
1768 1769 2.185004 AGCAAGATACGGCAACACTT 57.815 45.000 0.00 0.00 0.00 3.16
1769 1770 2.504367 AGCAAGATACGGCAACACTTT 58.496 42.857 0.00 0.00 0.00 2.66
1770 1771 2.226437 AGCAAGATACGGCAACACTTTG 59.774 45.455 0.00 0.00 35.62 2.77
1771 1772 2.225491 GCAAGATACGGCAACACTTTGA 59.775 45.455 0.00 0.00 34.24 2.69
1772 1773 3.304391 GCAAGATACGGCAACACTTTGAA 60.304 43.478 0.00 0.00 34.24 2.69
1773 1774 4.466828 CAAGATACGGCAACACTTTGAAG 58.533 43.478 0.00 0.00 34.24 3.02
1774 1775 3.740115 AGATACGGCAACACTTTGAAGT 58.260 40.909 0.00 0.00 40.60 3.01
1775 1776 4.134563 AGATACGGCAACACTTTGAAGTT 58.865 39.130 0.00 0.00 37.08 2.66
1776 1777 2.559998 ACGGCAACACTTTGAAGTTG 57.440 45.000 0.00 0.00 45.91 3.16
1777 1778 1.816224 ACGGCAACACTTTGAAGTTGT 59.184 42.857 7.08 0.00 45.16 3.32
1778 1779 2.184448 CGGCAACACTTTGAAGTTGTG 58.816 47.619 7.08 0.00 45.16 3.33
1779 1780 2.415357 CGGCAACACTTTGAAGTTGTGT 60.415 45.455 7.08 0.00 45.16 3.72
1784 1785 4.701956 ACACTTTGAAGTTGTGTTCTGG 57.298 40.909 0.00 0.00 41.45 3.86
1785 1786 3.443681 ACACTTTGAAGTTGTGTTCTGGG 59.556 43.478 0.00 0.00 41.45 4.45
1786 1787 3.443681 CACTTTGAAGTTGTGTTCTGGGT 59.556 43.478 0.00 0.00 37.08 4.51
1787 1788 4.082245 CACTTTGAAGTTGTGTTCTGGGTT 60.082 41.667 0.00 0.00 37.08 4.11
1788 1789 4.157840 ACTTTGAAGTTGTGTTCTGGGTTC 59.842 41.667 0.00 0.00 35.21 3.62
1789 1790 3.358111 TGAAGTTGTGTTCTGGGTTCA 57.642 42.857 0.00 0.00 0.00 3.18
1790 1791 3.897239 TGAAGTTGTGTTCTGGGTTCAT 58.103 40.909 0.00 0.00 0.00 2.57
1791 1792 3.631686 TGAAGTTGTGTTCTGGGTTCATG 59.368 43.478 0.00 0.00 0.00 3.07
1792 1793 3.297134 AGTTGTGTTCTGGGTTCATGT 57.703 42.857 0.00 0.00 0.00 3.21
1793 1794 2.951642 AGTTGTGTTCTGGGTTCATGTG 59.048 45.455 0.00 0.00 0.00 3.21
1794 1795 2.687935 GTTGTGTTCTGGGTTCATGTGT 59.312 45.455 0.00 0.00 0.00 3.72
1795 1796 2.571212 TGTGTTCTGGGTTCATGTGTC 58.429 47.619 0.00 0.00 0.00 3.67
1796 1797 2.172505 TGTGTTCTGGGTTCATGTGTCT 59.827 45.455 0.00 0.00 0.00 3.41
1797 1798 2.808543 GTGTTCTGGGTTCATGTGTCTC 59.191 50.000 0.00 0.00 0.00 3.36
1798 1799 2.437651 TGTTCTGGGTTCATGTGTCTCA 59.562 45.455 0.00 0.00 0.00 3.27
1799 1800 3.118075 TGTTCTGGGTTCATGTGTCTCAA 60.118 43.478 0.00 0.00 0.00 3.02
1800 1801 3.855255 TCTGGGTTCATGTGTCTCAAA 57.145 42.857 0.00 0.00 0.00 2.69
1801 1802 4.163441 TCTGGGTTCATGTGTCTCAAAA 57.837 40.909 0.00 0.00 0.00 2.44
1802 1803 4.531854 TCTGGGTTCATGTGTCTCAAAAA 58.468 39.130 0.00 0.00 0.00 1.94
1803 1804 5.139727 TCTGGGTTCATGTGTCTCAAAAAT 58.860 37.500 0.00 0.00 0.00 1.82
1804 1805 5.598005 TCTGGGTTCATGTGTCTCAAAAATT 59.402 36.000 0.00 0.00 0.00 1.82
1805 1806 6.098124 TCTGGGTTCATGTGTCTCAAAAATTT 59.902 34.615 0.00 0.00 0.00 1.82
1806 1807 7.286546 TCTGGGTTCATGTGTCTCAAAAATTTA 59.713 33.333 0.00 0.00 0.00 1.40
1807 1808 7.786030 TGGGTTCATGTGTCTCAAAAATTTAA 58.214 30.769 0.00 0.00 0.00 1.52
1808 1809 7.708752 TGGGTTCATGTGTCTCAAAAATTTAAC 59.291 33.333 0.00 0.00 0.00 2.01
1809 1810 7.096230 GGGTTCATGTGTCTCAAAAATTTAACG 60.096 37.037 0.00 0.00 0.00 3.18
1810 1811 7.434013 GGTTCATGTGTCTCAAAAATTTAACGT 59.566 33.333 0.00 0.00 0.00 3.99
1811 1812 7.906611 TCATGTGTCTCAAAAATTTAACGTG 57.093 32.000 0.00 0.00 0.00 4.49
1812 1813 6.915300 TCATGTGTCTCAAAAATTTAACGTGG 59.085 34.615 0.00 0.00 0.00 4.94
1813 1814 6.438259 TGTGTCTCAAAAATTTAACGTGGA 57.562 33.333 0.00 0.00 0.00 4.02
1814 1815 6.853720 TGTGTCTCAAAAATTTAACGTGGAA 58.146 32.000 0.00 0.00 0.00 3.53
1815 1816 7.313646 TGTGTCTCAAAAATTTAACGTGGAAA 58.686 30.769 0.00 0.00 0.00 3.13
1816 1817 7.813148 TGTGTCTCAAAAATTTAACGTGGAAAA 59.187 29.630 0.00 0.00 0.00 2.29
1817 1818 8.105742 GTGTCTCAAAAATTTAACGTGGAAAAC 58.894 33.333 0.00 0.00 0.00 2.43
1818 1819 7.275999 TGTCTCAAAAATTTAACGTGGAAAACC 59.724 33.333 0.00 0.00 0.00 3.27
1819 1820 7.490079 GTCTCAAAAATTTAACGTGGAAAACCT 59.510 33.333 0.00 0.00 0.00 3.50
1820 1821 7.703197 TCTCAAAAATTTAACGTGGAAAACCTC 59.297 33.333 0.00 0.00 0.00 3.85
1821 1822 6.757478 TCAAAAATTTAACGTGGAAAACCTCC 59.243 34.615 0.00 0.00 45.64 4.30
1822 1823 6.474140 AAAATTTAACGTGGAAAACCTCCT 57.526 33.333 0.00 0.00 45.64 3.69
1823 1824 5.700722 AATTTAACGTGGAAAACCTCCTC 57.299 39.130 0.00 0.00 45.64 3.71
1826 1827 4.716003 GTGGAAAACCTCCTCGGG 57.284 61.111 0.00 0.00 45.64 5.14
1827 1828 2.063774 GTGGAAAACCTCCTCGGGA 58.936 57.895 0.00 0.00 45.64 5.14
1828 1829 0.399075 GTGGAAAACCTCCTCGGGAA 59.601 55.000 0.00 0.00 45.64 3.97
1829 1830 0.690762 TGGAAAACCTCCTCGGGAAG 59.309 55.000 0.00 0.00 45.64 3.46
1830 1831 0.677098 GGAAAACCTCCTCGGGAAGC 60.677 60.000 0.00 0.00 41.61 3.86
1831 1832 0.325272 GAAAACCTCCTCGGGAAGCT 59.675 55.000 0.00 0.00 36.97 3.74
1832 1833 1.553704 GAAAACCTCCTCGGGAAGCTA 59.446 52.381 0.00 0.00 36.97 3.32
1833 1834 1.880941 AAACCTCCTCGGGAAGCTAT 58.119 50.000 0.00 0.00 36.97 2.97
1834 1835 1.880941 AACCTCCTCGGGAAGCTATT 58.119 50.000 0.00 0.00 36.97 1.73
1835 1836 1.880941 ACCTCCTCGGGAAGCTATTT 58.119 50.000 0.00 0.00 36.97 1.40
1836 1837 1.486726 ACCTCCTCGGGAAGCTATTTG 59.513 52.381 0.00 0.00 36.97 2.32
1837 1838 1.762957 CCTCCTCGGGAAGCTATTTGA 59.237 52.381 0.00 0.00 0.00 2.69
1838 1839 2.170607 CCTCCTCGGGAAGCTATTTGAA 59.829 50.000 0.00 0.00 0.00 2.69
1839 1840 3.181450 CCTCCTCGGGAAGCTATTTGAAT 60.181 47.826 0.00 0.00 0.00 2.57
1840 1841 4.061596 CTCCTCGGGAAGCTATTTGAATC 58.938 47.826 0.00 0.00 0.00 2.52
1841 1842 3.711704 TCCTCGGGAAGCTATTTGAATCT 59.288 43.478 0.00 0.00 0.00 2.40
1842 1843 3.812053 CCTCGGGAAGCTATTTGAATCTG 59.188 47.826 0.00 0.00 0.00 2.90
1843 1844 4.446371 CTCGGGAAGCTATTTGAATCTGT 58.554 43.478 0.00 0.00 0.00 3.41
1844 1845 4.442706 TCGGGAAGCTATTTGAATCTGTC 58.557 43.478 0.00 0.00 0.00 3.51
1845 1846 4.162320 TCGGGAAGCTATTTGAATCTGTCT 59.838 41.667 0.00 0.00 0.00 3.41
1846 1847 4.509600 CGGGAAGCTATTTGAATCTGTCTC 59.490 45.833 0.00 0.00 0.00 3.36
1847 1848 5.679601 GGGAAGCTATTTGAATCTGTCTCT 58.320 41.667 0.00 0.00 0.00 3.10
1848 1849 5.526846 GGGAAGCTATTTGAATCTGTCTCTG 59.473 44.000 0.00 0.00 0.00 3.35
1849 1850 6.344500 GGAAGCTATTTGAATCTGTCTCTGA 58.656 40.000 0.00 0.00 0.00 3.27
1850 1851 6.257630 GGAAGCTATTTGAATCTGTCTCTGAC 59.742 42.308 0.00 0.00 0.00 3.51
1851 1852 5.347342 AGCTATTTGAATCTGTCTCTGACG 58.653 41.667 0.00 0.00 34.95 4.35
1852 1853 5.126222 AGCTATTTGAATCTGTCTCTGACGA 59.874 40.000 0.00 0.00 34.95 4.20
1853 1854 5.982516 GCTATTTGAATCTGTCTCTGACGAT 59.017 40.000 0.00 0.00 34.95 3.73
1854 1855 7.013750 AGCTATTTGAATCTGTCTCTGACGATA 59.986 37.037 0.00 0.00 34.95 2.92
1855 1856 7.325821 GCTATTTGAATCTGTCTCTGACGATAG 59.674 40.741 0.00 0.00 46.19 2.08
1856 1857 5.506686 TTGAATCTGTCTCTGACGATAGG 57.493 43.478 0.00 0.00 43.77 2.57
1857 1858 4.527944 TGAATCTGTCTCTGACGATAGGT 58.472 43.478 0.00 0.00 43.77 3.08
1858 1859 4.576873 TGAATCTGTCTCTGACGATAGGTC 59.423 45.833 0.00 0.00 46.27 3.85
1859 1860 2.920524 TCTGTCTCTGACGATAGGTCC 58.079 52.381 0.00 0.00 45.46 4.46
1860 1861 1.600013 CTGTCTCTGACGATAGGTCCG 59.400 57.143 0.00 0.00 45.46 4.79
1861 1862 1.208776 TGTCTCTGACGATAGGTCCGA 59.791 52.381 0.00 0.00 45.46 4.55
1863 1864 0.589223 CTCTGACGATAGGTCCGAGC 59.411 60.000 0.00 0.00 45.79 5.03
1864 1865 0.180642 TCTGACGATAGGTCCGAGCT 59.819 55.000 5.27 5.27 45.46 4.09
1865 1866 1.025812 CTGACGATAGGTCCGAGCTT 58.974 55.000 5.23 0.00 45.46 3.74
1866 1867 1.405821 CTGACGATAGGTCCGAGCTTT 59.594 52.381 5.23 0.00 45.46 3.51
1867 1868 2.617308 CTGACGATAGGTCCGAGCTTTA 59.383 50.000 5.23 0.00 45.46 1.85
1868 1869 3.220110 TGACGATAGGTCCGAGCTTTAT 58.780 45.455 5.23 0.00 45.46 1.40
1869 1870 4.392047 TGACGATAGGTCCGAGCTTTATA 58.608 43.478 5.23 0.00 45.46 0.98
1870 1871 4.214971 TGACGATAGGTCCGAGCTTTATAC 59.785 45.833 5.23 0.00 45.46 1.47
1871 1872 3.505293 ACGATAGGTCCGAGCTTTATACC 59.495 47.826 5.23 0.00 43.77 2.73
1872 1873 3.119566 CGATAGGTCCGAGCTTTATACCC 60.120 52.174 5.23 0.00 0.00 3.69
1873 1874 2.473576 AGGTCCGAGCTTTATACCCT 57.526 50.000 0.00 0.00 0.00 4.34
1874 1875 2.040178 AGGTCCGAGCTTTATACCCTG 58.960 52.381 0.00 0.00 0.00 4.45
1875 1876 1.540580 GGTCCGAGCTTTATACCCTGC 60.541 57.143 0.00 0.00 0.00 4.85
1876 1877 1.138266 GTCCGAGCTTTATACCCTGCA 59.862 52.381 0.00 0.00 0.00 4.41
1877 1878 1.412710 TCCGAGCTTTATACCCTGCAG 59.587 52.381 6.78 6.78 0.00 4.41
1878 1879 1.221414 CGAGCTTTATACCCTGCAGC 58.779 55.000 8.66 0.00 0.00 5.25
1879 1880 1.473257 CGAGCTTTATACCCTGCAGCA 60.473 52.381 8.66 0.00 32.58 4.41
1880 1881 1.943340 GAGCTTTATACCCTGCAGCAC 59.057 52.381 8.66 0.00 32.58 4.40
1881 1882 1.281867 AGCTTTATACCCTGCAGCACA 59.718 47.619 8.66 0.00 32.58 4.57
1882 1883 2.092212 AGCTTTATACCCTGCAGCACAT 60.092 45.455 8.66 2.78 32.58 3.21
1883 1884 2.033801 GCTTTATACCCTGCAGCACATG 59.966 50.000 8.66 0.00 0.00 3.21
1884 1885 3.544684 CTTTATACCCTGCAGCACATGA 58.455 45.455 8.66 0.00 0.00 3.07
1885 1886 2.916702 TATACCCTGCAGCACATGAG 57.083 50.000 8.66 0.00 0.00 2.90
1886 1887 0.465097 ATACCCTGCAGCACATGAGC 60.465 55.000 8.66 7.07 0.00 4.26
1887 1888 1.840224 TACCCTGCAGCACATGAGCA 61.840 55.000 17.61 11.41 36.85 4.26
1890 1891 4.804806 TGCAGCACATGAGCAGAA 57.195 50.000 17.61 0.37 36.85 3.02
1891 1892 2.250646 TGCAGCACATGAGCAGAAC 58.749 52.632 17.61 4.12 36.85 3.01
1892 1893 0.535553 TGCAGCACATGAGCAGAACA 60.536 50.000 17.61 6.60 36.85 3.18
1893 1894 0.594602 GCAGCACATGAGCAGAACAA 59.405 50.000 17.61 0.00 36.85 2.83
1894 1895 1.201647 GCAGCACATGAGCAGAACAAT 59.798 47.619 17.61 0.00 36.85 2.71
1895 1896 2.731341 GCAGCACATGAGCAGAACAATC 60.731 50.000 17.61 0.00 36.85 2.67
1896 1897 2.747989 CAGCACATGAGCAGAACAATCT 59.252 45.455 17.61 0.00 36.85 2.40
1897 1898 3.008330 AGCACATGAGCAGAACAATCTC 58.992 45.455 17.61 0.00 36.85 2.75
1898 1899 3.008330 GCACATGAGCAGAACAATCTCT 58.992 45.455 10.48 0.00 32.03 3.10
1899 1900 3.181509 GCACATGAGCAGAACAATCTCTG 60.182 47.826 10.48 0.00 44.82 3.35
1900 1901 4.251268 CACATGAGCAGAACAATCTCTGA 58.749 43.478 0.00 0.00 44.82 3.27
1901 1902 4.330347 CACATGAGCAGAACAATCTCTGAG 59.670 45.833 0.00 0.00 44.82 3.35
1902 1903 4.222366 ACATGAGCAGAACAATCTCTGAGA 59.778 41.667 10.23 10.23 44.82 3.27
1903 1904 4.879197 TGAGCAGAACAATCTCTGAGAA 57.121 40.909 12.00 0.00 44.82 2.87
1904 1905 4.818642 TGAGCAGAACAATCTCTGAGAAG 58.181 43.478 12.00 9.89 44.82 2.85
1905 1906 4.282957 TGAGCAGAACAATCTCTGAGAAGT 59.717 41.667 12.00 10.53 44.82 3.01
1906 1907 5.221601 TGAGCAGAACAATCTCTGAGAAGTT 60.222 40.000 21.38 21.38 44.82 2.66
1907 1908 4.996122 AGCAGAACAATCTCTGAGAAGTTG 59.004 41.667 24.39 20.31 44.82 3.16
1908 1909 4.993584 GCAGAACAATCTCTGAGAAGTTGA 59.006 41.667 24.39 0.00 44.82 3.18
1909 1910 5.120519 GCAGAACAATCTCTGAGAAGTTGAG 59.879 44.000 24.39 18.62 44.82 3.02
1910 1911 5.120519 CAGAACAATCTCTGAGAAGTTGAGC 59.879 44.000 24.39 15.92 44.82 4.26
1911 1912 4.613925 ACAATCTCTGAGAAGTTGAGCA 57.386 40.909 21.65 0.00 0.00 4.26
1912 1913 4.567971 ACAATCTCTGAGAAGTTGAGCAG 58.432 43.478 21.65 0.00 0.00 4.24
1913 1914 4.282957 ACAATCTCTGAGAAGTTGAGCAGA 59.717 41.667 21.65 0.00 36.13 4.26
1915 1916 3.235157 CTCTGAGAAGTTGAGCAGAGG 57.765 52.381 14.18 2.24 46.52 3.69
1916 1917 1.898472 TCTGAGAAGTTGAGCAGAGGG 59.102 52.381 0.00 0.00 32.85 4.30
1917 1918 1.898472 CTGAGAAGTTGAGCAGAGGGA 59.102 52.381 0.00 0.00 0.00 4.20
1918 1919 2.301296 CTGAGAAGTTGAGCAGAGGGAA 59.699 50.000 0.00 0.00 0.00 3.97
1919 1920 2.301296 TGAGAAGTTGAGCAGAGGGAAG 59.699 50.000 0.00 0.00 0.00 3.46
1920 1921 2.301583 GAGAAGTTGAGCAGAGGGAAGT 59.698 50.000 0.00 0.00 0.00 3.01
1921 1922 2.708325 AGAAGTTGAGCAGAGGGAAGTT 59.292 45.455 0.00 0.00 0.00 2.66
1922 1923 3.137360 AGAAGTTGAGCAGAGGGAAGTTT 59.863 43.478 0.00 0.00 0.00 2.66
1923 1924 3.133141 AGTTGAGCAGAGGGAAGTTTC 57.867 47.619 0.00 0.00 0.00 2.78
1924 1925 2.708325 AGTTGAGCAGAGGGAAGTTTCT 59.292 45.455 0.00 0.00 0.00 2.52
1925 1926 3.070748 GTTGAGCAGAGGGAAGTTTCTC 58.929 50.000 0.00 0.51 0.00 2.87
1926 1927 1.625818 TGAGCAGAGGGAAGTTTCTCC 59.374 52.381 4.26 0.00 34.41 3.71
1927 1928 1.905894 GAGCAGAGGGAAGTTTCTCCT 59.094 52.381 2.72 2.72 35.63 3.69
1928 1929 2.304470 GAGCAGAGGGAAGTTTCTCCTT 59.696 50.000 4.26 0.00 35.63 3.36
1929 1930 2.039613 AGCAGAGGGAAGTTTCTCCTTG 59.960 50.000 4.26 0.00 35.63 3.61
1930 1931 2.224646 GCAGAGGGAAGTTTCTCCTTGT 60.225 50.000 4.26 0.00 35.63 3.16
1931 1932 3.669536 CAGAGGGAAGTTTCTCCTTGTC 58.330 50.000 4.26 0.00 35.63 3.18
1932 1933 3.326297 CAGAGGGAAGTTTCTCCTTGTCT 59.674 47.826 4.26 0.00 35.63 3.41
1933 1934 3.977326 AGAGGGAAGTTTCTCCTTGTCTT 59.023 43.478 4.26 0.00 35.63 3.01
1934 1935 4.068599 GAGGGAAGTTTCTCCTTGTCTTG 58.931 47.826 4.21 0.00 35.63 3.02
1935 1936 3.149981 GGGAAGTTTCTCCTTGTCTTGG 58.850 50.000 0.00 0.00 35.63 3.61
1936 1937 3.181443 GGGAAGTTTCTCCTTGTCTTGGA 60.181 47.826 0.00 0.00 35.63 3.53
1937 1938 4.507512 GGGAAGTTTCTCCTTGTCTTGGAT 60.508 45.833 0.00 0.00 35.63 3.41
1938 1939 4.457257 GGAAGTTTCTCCTTGTCTTGGATG 59.543 45.833 0.00 0.00 32.56 3.51
1939 1940 4.982241 AGTTTCTCCTTGTCTTGGATGA 57.018 40.909 0.00 0.00 32.56 2.92
1940 1941 4.646572 AGTTTCTCCTTGTCTTGGATGAC 58.353 43.478 0.00 0.00 37.47 3.06
1941 1942 3.319137 TTCTCCTTGTCTTGGATGACG 57.681 47.619 0.00 0.00 39.64 4.35
1942 1943 2.248248 TCTCCTTGTCTTGGATGACGT 58.752 47.619 0.00 0.00 39.64 4.34
1943 1944 2.632996 TCTCCTTGTCTTGGATGACGTT 59.367 45.455 0.00 0.00 39.64 3.99
1944 1945 3.071023 TCTCCTTGTCTTGGATGACGTTT 59.929 43.478 0.00 0.00 39.64 3.60
1945 1946 3.138304 TCCTTGTCTTGGATGACGTTTG 58.862 45.455 0.00 0.00 39.64 2.93
1946 1947 2.226437 CCTTGTCTTGGATGACGTTTGG 59.774 50.000 0.00 0.00 39.64 3.28
1947 1948 2.920724 TGTCTTGGATGACGTTTGGA 57.079 45.000 0.00 0.00 39.64 3.53
1948 1949 3.201353 TGTCTTGGATGACGTTTGGAA 57.799 42.857 0.00 0.00 39.64 3.53
1949 1950 2.875933 TGTCTTGGATGACGTTTGGAAC 59.124 45.455 0.00 0.00 39.64 3.62
1962 1963 3.980646 TTTGGAACGAGGACAAACATG 57.019 42.857 0.00 0.00 0.00 3.21
1963 1964 2.920724 TGGAACGAGGACAAACATGA 57.079 45.000 0.00 0.00 0.00 3.07
1964 1965 3.417069 TGGAACGAGGACAAACATGAT 57.583 42.857 0.00 0.00 0.00 2.45
1965 1966 3.750371 TGGAACGAGGACAAACATGATT 58.250 40.909 0.00 0.00 0.00 2.57
1966 1967 3.501828 TGGAACGAGGACAAACATGATTG 59.498 43.478 13.63 13.63 36.37 2.67
1967 1968 3.119849 GGAACGAGGACAAACATGATTGG 60.120 47.826 18.61 4.39 34.56 3.16
1968 1969 2.436417 ACGAGGACAAACATGATTGGG 58.564 47.619 18.61 6.17 34.56 4.12
1969 1970 2.039746 ACGAGGACAAACATGATTGGGA 59.960 45.455 18.61 0.00 34.56 4.37
1970 1971 2.679837 CGAGGACAAACATGATTGGGAG 59.320 50.000 18.61 3.37 34.56 4.30
1971 1972 2.424956 GAGGACAAACATGATTGGGAGC 59.575 50.000 18.61 6.22 34.56 4.70
1972 1973 2.170166 GGACAAACATGATTGGGAGCA 58.830 47.619 18.61 0.00 34.56 4.26
1973 1974 2.165030 GGACAAACATGATTGGGAGCAG 59.835 50.000 18.61 0.00 34.56 4.24
1974 1975 2.821969 GACAAACATGATTGGGAGCAGT 59.178 45.455 18.61 0.00 34.56 4.40
1975 1976 3.233507 ACAAACATGATTGGGAGCAGTT 58.766 40.909 18.61 0.00 34.56 3.16
1976 1977 3.642848 ACAAACATGATTGGGAGCAGTTT 59.357 39.130 18.61 0.00 34.56 2.66
1977 1978 3.947910 AACATGATTGGGAGCAGTTTG 57.052 42.857 0.00 0.00 0.00 2.93
1978 1979 3.159213 ACATGATTGGGAGCAGTTTGA 57.841 42.857 0.00 0.00 0.00 2.69
1979 1980 3.499338 ACATGATTGGGAGCAGTTTGAA 58.501 40.909 0.00 0.00 0.00 2.69
1980 1981 3.256631 ACATGATTGGGAGCAGTTTGAAC 59.743 43.478 0.00 0.00 0.00 3.18
1981 1982 2.942804 TGATTGGGAGCAGTTTGAACA 58.057 42.857 0.00 0.00 0.00 3.18
1982 1983 3.295093 TGATTGGGAGCAGTTTGAACAA 58.705 40.909 0.00 0.00 0.00 2.83
1983 1984 3.068024 TGATTGGGAGCAGTTTGAACAAC 59.932 43.478 0.00 0.00 0.00 3.32
1984 1985 2.136298 TGGGAGCAGTTTGAACAACA 57.864 45.000 0.00 0.00 0.00 3.33
1985 1986 2.665165 TGGGAGCAGTTTGAACAACAT 58.335 42.857 0.00 0.00 0.00 2.71
1986 1987 3.030291 TGGGAGCAGTTTGAACAACATT 58.970 40.909 0.00 0.00 0.00 2.71
1987 1988 3.450457 TGGGAGCAGTTTGAACAACATTT 59.550 39.130 0.00 0.00 0.00 2.32
1988 1989 3.803778 GGGAGCAGTTTGAACAACATTTG 59.196 43.478 0.00 0.00 0.00 2.32
1989 1990 4.441356 GGGAGCAGTTTGAACAACATTTGA 60.441 41.667 0.00 0.00 0.00 2.69
1990 1991 5.108517 GGAGCAGTTTGAACAACATTTGAA 58.891 37.500 0.00 0.00 0.00 2.69
1991 1992 5.005682 GGAGCAGTTTGAACAACATTTGAAC 59.994 40.000 0.00 0.00 0.00 3.18
1992 1993 5.477510 AGCAGTTTGAACAACATTTGAACA 58.522 33.333 0.00 0.00 0.00 3.18
1993 1994 6.108015 AGCAGTTTGAACAACATTTGAACAT 58.892 32.000 0.00 0.00 0.00 2.71
1994 1995 6.594937 AGCAGTTTGAACAACATTTGAACATT 59.405 30.769 0.00 0.00 0.00 2.71
1995 1996 6.683708 GCAGTTTGAACAACATTTGAACATTG 59.316 34.615 0.00 0.00 0.00 2.82
1996 1997 6.683708 CAGTTTGAACAACATTTGAACATTGC 59.316 34.615 0.00 0.00 0.00 3.56
1997 1998 5.731599 TTGAACAACATTTGAACATTGCC 57.268 34.783 0.00 0.00 0.00 4.52
1998 1999 4.763073 TGAACAACATTTGAACATTGCCA 58.237 34.783 0.00 0.00 0.00 4.92
1999 2000 4.569966 TGAACAACATTTGAACATTGCCAC 59.430 37.500 0.00 0.00 0.00 5.01
2000 2001 4.134379 ACAACATTTGAACATTGCCACA 57.866 36.364 0.00 0.00 0.00 4.17
2001 2002 3.870419 ACAACATTTGAACATTGCCACAC 59.130 39.130 0.00 0.00 0.00 3.82
2002 2003 3.110447 ACATTTGAACATTGCCACACC 57.890 42.857 0.00 0.00 0.00 4.16
2003 2004 2.699846 ACATTTGAACATTGCCACACCT 59.300 40.909 0.00 0.00 0.00 4.00
2004 2005 2.886862 TTTGAACATTGCCACACCTG 57.113 45.000 0.00 0.00 0.00 4.00
2005 2006 1.039068 TTGAACATTGCCACACCTGG 58.961 50.000 0.00 0.00 41.13 4.45
2006 2007 0.184692 TGAACATTGCCACACCTGGA 59.815 50.000 0.00 0.00 40.55 3.86
2007 2008 1.327303 GAACATTGCCACACCTGGAA 58.673 50.000 0.00 0.00 40.55 3.53
2008 2009 1.270550 GAACATTGCCACACCTGGAAG 59.729 52.381 0.00 0.00 40.55 3.46
2009 2010 1.181098 ACATTGCCACACCTGGAAGC 61.181 55.000 0.00 0.00 40.55 3.86
2010 2011 1.153524 ATTGCCACACCTGGAAGCA 59.846 52.632 0.00 0.31 40.55 3.91
2011 2012 0.469705 ATTGCCACACCTGGAAGCAA 60.470 50.000 15.58 15.58 46.43 3.91
2012 2013 1.108727 TTGCCACACCTGGAAGCAAG 61.109 55.000 0.00 0.00 40.55 4.01
2013 2014 1.228245 GCCACACCTGGAAGCAAGA 60.228 57.895 0.00 0.00 40.55 3.02
2014 2015 0.610232 GCCACACCTGGAAGCAAGAT 60.610 55.000 0.00 0.00 40.55 2.40
2015 2016 1.915141 CCACACCTGGAAGCAAGATT 58.085 50.000 0.00 0.00 40.55 2.40
2016 2017 2.242043 CCACACCTGGAAGCAAGATTT 58.758 47.619 0.00 0.00 40.55 2.17
2017 2018 2.629617 CCACACCTGGAAGCAAGATTTT 59.370 45.455 0.00 0.00 40.55 1.82
2018 2019 3.826157 CCACACCTGGAAGCAAGATTTTA 59.174 43.478 0.00 0.00 40.55 1.52
2019 2020 4.321230 CCACACCTGGAAGCAAGATTTTAC 60.321 45.833 0.00 0.00 40.55 2.01
2020 2021 4.520492 CACACCTGGAAGCAAGATTTTACT 59.480 41.667 0.00 0.00 0.00 2.24
2021 2022 4.762251 ACACCTGGAAGCAAGATTTTACTC 59.238 41.667 0.00 0.00 0.00 2.59
2022 2023 4.761739 CACCTGGAAGCAAGATTTTACTCA 59.238 41.667 0.00 0.00 0.00 3.41
2023 2024 4.762251 ACCTGGAAGCAAGATTTTACTCAC 59.238 41.667 0.00 0.00 0.00 3.51
2024 2025 5.006386 CCTGGAAGCAAGATTTTACTCACT 58.994 41.667 0.00 0.00 0.00 3.41
2025 2026 6.173339 CCTGGAAGCAAGATTTTACTCACTA 58.827 40.000 0.00 0.00 0.00 2.74
2026 2027 6.092807 CCTGGAAGCAAGATTTTACTCACTAC 59.907 42.308 0.00 0.00 0.00 2.73
2027 2028 5.938125 TGGAAGCAAGATTTTACTCACTACC 59.062 40.000 0.00 0.00 0.00 3.18
2028 2029 5.354513 GGAAGCAAGATTTTACTCACTACCC 59.645 44.000 0.00 0.00 0.00 3.69
2029 2030 4.504858 AGCAAGATTTTACTCACTACCCG 58.495 43.478 0.00 0.00 0.00 5.28
2030 2031 4.020485 AGCAAGATTTTACTCACTACCCGT 60.020 41.667 0.00 0.00 0.00 5.28
2031 2032 4.092968 GCAAGATTTTACTCACTACCCGTG 59.907 45.833 0.00 0.00 45.18 4.94
2041 2042 3.053831 CACTACCCGTGATGGAAAAGT 57.946 47.619 0.00 0.00 46.81 2.66
2042 2043 3.408634 CACTACCCGTGATGGAAAAGTT 58.591 45.455 0.00 0.00 46.81 2.66
2043 2044 3.188460 CACTACCCGTGATGGAAAAGTTG 59.812 47.826 0.00 0.00 46.81 3.16
2044 2045 0.958822 ACCCGTGATGGAAAAGTTGC 59.041 50.000 0.00 0.00 42.00 4.17
2045 2046 0.958091 CCCGTGATGGAAAAGTTGCA 59.042 50.000 0.00 0.00 42.00 4.08
2046 2047 1.068333 CCCGTGATGGAAAAGTTGCAG 60.068 52.381 0.00 0.00 42.00 4.41
2047 2048 1.879380 CCGTGATGGAAAAGTTGCAGA 59.121 47.619 0.00 0.00 42.00 4.26
2048 2049 2.293122 CCGTGATGGAAAAGTTGCAGAA 59.707 45.455 0.00 0.00 42.00 3.02
2049 2050 3.558505 CGTGATGGAAAAGTTGCAGAAG 58.441 45.455 0.00 0.00 33.40 2.85
2050 2051 3.311966 GTGATGGAAAAGTTGCAGAAGC 58.688 45.455 0.00 0.00 42.57 3.86
2051 2052 2.030893 TGATGGAAAAGTTGCAGAAGCG 60.031 45.455 0.00 0.00 46.23 4.68
2052 2053 0.667993 TGGAAAAGTTGCAGAAGCGG 59.332 50.000 0.00 0.00 46.23 5.52
2053 2054 0.668535 GGAAAAGTTGCAGAAGCGGT 59.331 50.000 0.00 0.00 46.23 5.68
2054 2055 1.067060 GGAAAAGTTGCAGAAGCGGTT 59.933 47.619 0.00 0.00 46.23 4.44
2055 2056 2.292292 GGAAAAGTTGCAGAAGCGGTTA 59.708 45.455 0.00 0.00 46.23 2.85
2056 2057 3.243267 GGAAAAGTTGCAGAAGCGGTTAA 60.243 43.478 0.00 0.00 46.23 2.01
2057 2058 4.356289 GAAAAGTTGCAGAAGCGGTTAAA 58.644 39.130 0.00 0.00 46.23 1.52
2058 2059 4.584327 AAAGTTGCAGAAGCGGTTAAAT 57.416 36.364 0.00 0.00 46.23 1.40
2059 2060 3.831715 AGTTGCAGAAGCGGTTAAATC 57.168 42.857 0.00 0.00 46.23 2.17
2060 2061 3.412386 AGTTGCAGAAGCGGTTAAATCT 58.588 40.909 0.00 0.00 46.23 2.40
2061 2062 3.189287 AGTTGCAGAAGCGGTTAAATCTG 59.811 43.478 9.19 9.19 46.23 2.90
2064 2065 3.395858 CAGAAGCGGTTAAATCTGCAG 57.604 47.619 7.63 7.63 41.63 4.41
2065 2066 3.002791 CAGAAGCGGTTAAATCTGCAGA 58.997 45.455 20.79 20.79 41.63 4.26
2066 2067 3.436704 CAGAAGCGGTTAAATCTGCAGAA 59.563 43.478 22.50 0.40 41.63 3.02
2067 2068 4.072131 AGAAGCGGTTAAATCTGCAGAAA 58.928 39.130 22.50 7.97 41.63 2.52
2068 2069 4.702131 AGAAGCGGTTAAATCTGCAGAAAT 59.298 37.500 22.50 14.85 41.63 2.17
2069 2070 5.880332 AGAAGCGGTTAAATCTGCAGAAATA 59.120 36.000 22.50 13.77 41.63 1.40
2070 2071 6.543831 AGAAGCGGTTAAATCTGCAGAAATAT 59.456 34.615 22.50 9.65 41.63 1.28
2071 2072 6.699575 AGCGGTTAAATCTGCAGAAATATT 57.300 33.333 22.50 15.24 41.63 1.28
2072 2073 6.729187 AGCGGTTAAATCTGCAGAAATATTC 58.271 36.000 22.50 9.72 41.63 1.75
2073 2074 6.318648 AGCGGTTAAATCTGCAGAAATATTCA 59.681 34.615 22.50 2.85 41.63 2.57
2074 2075 6.972328 GCGGTTAAATCTGCAGAAATATTCAA 59.028 34.615 22.50 0.00 39.28 2.69
2075 2076 7.649306 GCGGTTAAATCTGCAGAAATATTCAAT 59.351 33.333 22.50 0.00 39.28 2.57
2076 2077 9.520204 CGGTTAAATCTGCAGAAATATTCAATT 57.480 29.630 22.50 3.87 0.00 2.32
2080 2081 7.781548 AATCTGCAGAAATATTCAATTTGCC 57.218 32.000 22.50 0.00 0.00 4.52
2081 2082 6.283544 TCTGCAGAAATATTCAATTTGCCA 57.716 33.333 15.67 0.00 0.00 4.92
2082 2083 6.101332 TCTGCAGAAATATTCAATTTGCCAC 58.899 36.000 15.67 0.00 0.00 5.01
2083 2084 6.040209 TGCAGAAATATTCAATTTGCCACT 57.960 33.333 0.00 0.00 0.00 4.00
2084 2085 6.101332 TGCAGAAATATTCAATTTGCCACTC 58.899 36.000 0.00 0.00 0.00 3.51
2085 2086 6.071221 TGCAGAAATATTCAATTTGCCACTCT 60.071 34.615 0.00 0.00 0.00 3.24
2086 2087 6.815142 GCAGAAATATTCAATTTGCCACTCTT 59.185 34.615 0.00 0.00 0.00 2.85
2087 2088 7.975616 GCAGAAATATTCAATTTGCCACTCTTA 59.024 33.333 0.00 0.00 0.00 2.10
2092 2093 8.985315 ATATTCAATTTGCCACTCTTATCAGA 57.015 30.769 0.00 0.00 0.00 3.27
2093 2094 7.893124 ATTCAATTTGCCACTCTTATCAGAT 57.107 32.000 0.00 0.00 0.00 2.90
2094 2095 6.688637 TCAATTTGCCACTCTTATCAGATG 57.311 37.500 0.00 0.00 0.00 2.90
2095 2096 6.417258 TCAATTTGCCACTCTTATCAGATGA 58.583 36.000 0.00 0.00 0.00 2.92
2096 2097 7.058525 TCAATTTGCCACTCTTATCAGATGAT 58.941 34.615 0.31 0.31 38.51 2.45
2097 2098 6.879276 ATTTGCCACTCTTATCAGATGATG 57.121 37.500 5.58 0.00 36.05 3.07
2098 2099 5.619132 TTGCCACTCTTATCAGATGATGA 57.381 39.130 5.58 0.00 43.70 2.92
2099 2100 4.953667 TGCCACTCTTATCAGATGATGAC 58.046 43.478 5.58 0.00 41.91 3.06
2100 2101 4.406649 TGCCACTCTTATCAGATGATGACA 59.593 41.667 5.58 0.00 41.91 3.58
2101 2102 4.989797 GCCACTCTTATCAGATGATGACAG 59.010 45.833 5.58 0.00 41.91 3.51
2102 2103 4.989797 CCACTCTTATCAGATGATGACAGC 59.010 45.833 5.58 0.00 41.91 4.40
2103 2104 5.221481 CCACTCTTATCAGATGATGACAGCT 60.221 44.000 5.58 0.00 43.91 4.24
2112 2113 4.597004 AGATGATGACAGCTGGAAATTGT 58.403 39.130 19.93 0.00 41.41 2.71
2113 2114 5.014858 AGATGATGACAGCTGGAAATTGTT 58.985 37.500 19.93 0.00 41.41 2.83
2114 2115 4.771590 TGATGACAGCTGGAAATTGTTC 57.228 40.909 19.93 4.13 0.00 3.18
2129 2130 7.214467 GAAATTGTTCCAACATAGTTCTGGA 57.786 36.000 0.00 0.00 38.95 3.86
2130 2131 7.781324 AAATTGTTCCAACATAGTTCTGGAT 57.219 32.000 0.00 0.00 38.99 3.41
2131 2132 6.764308 ATTGTTCCAACATAGTTCTGGATG 57.236 37.500 0.00 0.00 38.99 3.51
2132 2133 4.588899 TGTTCCAACATAGTTCTGGATGG 58.411 43.478 0.00 0.00 38.99 3.51
2133 2134 3.931907 TCCAACATAGTTCTGGATGGG 57.068 47.619 0.00 0.00 34.26 4.00
2134 2135 2.092429 TCCAACATAGTTCTGGATGGGC 60.092 50.000 0.00 0.00 34.26 5.36
2135 2136 2.301346 CAACATAGTTCTGGATGGGCC 58.699 52.381 0.00 0.00 37.10 5.80
2136 2137 0.469917 ACATAGTTCTGGATGGGCCG 59.530 55.000 0.00 0.00 40.66 6.13
2137 2138 0.758734 CATAGTTCTGGATGGGCCGA 59.241 55.000 0.00 0.00 40.66 5.54
2138 2139 1.051812 ATAGTTCTGGATGGGCCGAG 58.948 55.000 0.00 0.00 40.66 4.63
2139 2140 1.048724 TAGTTCTGGATGGGCCGAGG 61.049 60.000 0.00 0.00 40.66 4.63
2140 2141 2.040442 TTCTGGATGGGCCGAGGA 59.960 61.111 0.00 0.00 40.66 3.71
2141 2142 1.615124 TTCTGGATGGGCCGAGGAA 60.615 57.895 0.00 0.00 40.66 3.36
2142 2143 1.626356 TTCTGGATGGGCCGAGGAAG 61.626 60.000 0.00 0.00 40.66 3.46
2143 2144 3.764160 CTGGATGGGCCGAGGAAGC 62.764 68.421 0.00 0.00 40.66 3.86
2144 2145 3.483869 GGATGGGCCGAGGAAGCT 61.484 66.667 0.00 0.00 0.00 3.74
2145 2146 2.592308 GATGGGCCGAGGAAGCTT 59.408 61.111 0.00 0.00 0.00 3.74
2146 2147 1.077429 GATGGGCCGAGGAAGCTTT 60.077 57.895 0.00 0.00 0.00 3.51
2147 2148 1.379044 ATGGGCCGAGGAAGCTTTG 60.379 57.895 0.00 0.00 0.00 2.77
2148 2149 2.751837 GGGCCGAGGAAGCTTTGG 60.752 66.667 0.00 1.87 0.00 3.28
2149 2150 2.351276 GGCCGAGGAAGCTTTGGA 59.649 61.111 0.00 0.00 0.00 3.53
2150 2151 1.077429 GGCCGAGGAAGCTTTGGAT 60.077 57.895 0.00 0.00 0.00 3.41
2151 2152 1.098129 GGCCGAGGAAGCTTTGGATC 61.098 60.000 0.00 0.00 0.00 3.36
2152 2153 1.098129 GCCGAGGAAGCTTTGGATCC 61.098 60.000 4.20 4.20 0.00 3.36
2153 2154 0.543749 CCGAGGAAGCTTTGGATCCT 59.456 55.000 14.23 3.46 46.14 3.24
2154 2155 1.661341 CGAGGAAGCTTTGGATCCTG 58.339 55.000 14.23 4.50 43.55 3.86
2155 2156 1.208052 CGAGGAAGCTTTGGATCCTGA 59.792 52.381 14.23 0.00 43.55 3.86
2156 2157 2.741228 CGAGGAAGCTTTGGATCCTGAG 60.741 54.545 14.23 11.58 43.55 3.35
2157 2158 2.238395 GAGGAAGCTTTGGATCCTGAGT 59.762 50.000 14.23 0.00 43.55 3.41
2158 2159 2.646798 AGGAAGCTTTGGATCCTGAGTT 59.353 45.455 14.23 5.92 41.96 3.01
2159 2160 3.013219 GGAAGCTTTGGATCCTGAGTTC 58.987 50.000 14.23 14.37 0.00 3.01
2160 2161 3.560025 GGAAGCTTTGGATCCTGAGTTCA 60.560 47.826 14.23 0.00 0.00 3.18
2161 2162 4.268359 GAAGCTTTGGATCCTGAGTTCAT 58.732 43.478 14.23 0.00 0.00 2.57
2162 2163 4.313020 AGCTTTGGATCCTGAGTTCATT 57.687 40.909 14.23 0.00 0.00 2.57
2163 2164 4.015084 AGCTTTGGATCCTGAGTTCATTG 58.985 43.478 14.23 0.00 0.00 2.82
2164 2165 4.012374 GCTTTGGATCCTGAGTTCATTGA 58.988 43.478 14.23 0.00 0.00 2.57
2165 2166 4.460382 GCTTTGGATCCTGAGTTCATTGAA 59.540 41.667 14.23 0.00 0.00 2.69
2166 2167 5.392811 GCTTTGGATCCTGAGTTCATTGAAG 60.393 44.000 14.23 1.84 0.00 3.02
2167 2168 4.916041 TGGATCCTGAGTTCATTGAAGT 57.084 40.909 14.23 6.44 0.00 3.01
2168 2169 5.246981 TGGATCCTGAGTTCATTGAAGTT 57.753 39.130 14.23 0.00 0.00 2.66
2169 2170 5.005740 TGGATCCTGAGTTCATTGAAGTTG 58.994 41.667 14.23 5.08 0.00 3.16
2170 2171 4.397417 GGATCCTGAGTTCATTGAAGTTGG 59.603 45.833 3.84 12.55 0.00 3.77
2171 2172 4.705110 TCCTGAGTTCATTGAAGTTGGA 57.295 40.909 18.18 18.18 31.11 3.53
2172 2173 5.047566 TCCTGAGTTCATTGAAGTTGGAA 57.952 39.130 19.09 9.37 30.87 3.53
2173 2174 5.445069 TCCTGAGTTCATTGAAGTTGGAAA 58.555 37.500 19.09 6.21 30.87 3.13
2174 2175 5.890985 TCCTGAGTTCATTGAAGTTGGAAAA 59.109 36.000 19.09 5.73 30.87 2.29
2175 2176 6.039717 TCCTGAGTTCATTGAAGTTGGAAAAG 59.960 38.462 19.09 8.20 30.87 2.27
2176 2177 6.039717 CCTGAGTTCATTGAAGTTGGAAAAGA 59.960 38.462 16.08 0.00 0.00 2.52
2177 2178 7.031226 TGAGTTCATTGAAGTTGGAAAAGAG 57.969 36.000 8.12 0.00 0.00 2.85
2178 2179 6.828273 TGAGTTCATTGAAGTTGGAAAAGAGA 59.172 34.615 8.12 0.00 0.00 3.10
2179 2180 7.503566 TGAGTTCATTGAAGTTGGAAAAGAGAT 59.496 33.333 8.12 0.00 0.00 2.75
2180 2181 8.242729 AGTTCATTGAAGTTGGAAAAGAGATT 57.757 30.769 0.00 0.00 0.00 2.40
2181 2182 8.139989 AGTTCATTGAAGTTGGAAAAGAGATTG 58.860 33.333 0.00 0.00 0.00 2.67
2182 2183 7.587037 TCATTGAAGTTGGAAAAGAGATTGT 57.413 32.000 0.00 0.00 0.00 2.71
2183 2184 7.428020 TCATTGAAGTTGGAAAAGAGATTGTG 58.572 34.615 0.00 0.00 0.00 3.33
2184 2185 7.285172 TCATTGAAGTTGGAAAAGAGATTGTGA 59.715 33.333 0.00 0.00 0.00 3.58
2185 2186 7.403312 TTGAAGTTGGAAAAGAGATTGTGAA 57.597 32.000 0.00 0.00 0.00 3.18
2186 2187 7.031226 TGAAGTTGGAAAAGAGATTGTGAAG 57.969 36.000 0.00 0.00 0.00 3.02
2187 2188 6.828273 TGAAGTTGGAAAAGAGATTGTGAAGA 59.172 34.615 0.00 0.00 0.00 2.87
2188 2189 7.339212 TGAAGTTGGAAAAGAGATTGTGAAGAA 59.661 33.333 0.00 0.00 0.00 2.52
2189 2190 7.645058 AGTTGGAAAAGAGATTGTGAAGAAA 57.355 32.000 0.00 0.00 0.00 2.52
2190 2191 8.242729 AGTTGGAAAAGAGATTGTGAAGAAAT 57.757 30.769 0.00 0.00 0.00 2.17
2191 2192 8.139989 AGTTGGAAAAGAGATTGTGAAGAAATG 58.860 33.333 0.00 0.00 0.00 2.32
2192 2193 7.587037 TGGAAAAGAGATTGTGAAGAAATGT 57.413 32.000 0.00 0.00 0.00 2.71
2193 2194 7.428020 TGGAAAAGAGATTGTGAAGAAATGTG 58.572 34.615 0.00 0.00 0.00 3.21
2194 2195 6.364435 GGAAAAGAGATTGTGAAGAAATGTGC 59.636 38.462 0.00 0.00 0.00 4.57
2195 2196 6.645790 AAAGAGATTGTGAAGAAATGTGCT 57.354 33.333 0.00 0.00 0.00 4.40
2196 2197 5.624344 AGAGATTGTGAAGAAATGTGCTG 57.376 39.130 0.00 0.00 0.00 4.41
2197 2198 4.458295 AGAGATTGTGAAGAAATGTGCTGG 59.542 41.667 0.00 0.00 0.00 4.85
2198 2199 4.401022 AGATTGTGAAGAAATGTGCTGGA 58.599 39.130 0.00 0.00 0.00 3.86
2199 2200 4.828939 AGATTGTGAAGAAATGTGCTGGAA 59.171 37.500 0.00 0.00 0.00 3.53
2200 2201 5.479375 AGATTGTGAAGAAATGTGCTGGAAT 59.521 36.000 0.00 0.00 0.00 3.01
2201 2202 4.508461 TGTGAAGAAATGTGCTGGAATG 57.492 40.909 0.00 0.00 0.00 2.67
2202 2203 3.248266 GTGAAGAAATGTGCTGGAATGC 58.752 45.455 0.00 0.00 0.00 3.56
2203 2204 2.231964 TGAAGAAATGTGCTGGAATGCC 59.768 45.455 0.00 0.00 0.00 4.40
2204 2205 1.927487 AGAAATGTGCTGGAATGCCA 58.073 45.000 0.00 0.00 43.47 4.92
2205 2206 2.250031 AGAAATGTGCTGGAATGCCAA 58.750 42.857 0.00 0.00 45.41 4.52
2206 2207 2.835764 AGAAATGTGCTGGAATGCCAAT 59.164 40.909 0.00 0.00 45.41 3.16
2207 2208 4.025360 AGAAATGTGCTGGAATGCCAATA 58.975 39.130 0.00 0.00 45.41 1.90
2208 2209 4.098960 AGAAATGTGCTGGAATGCCAATAG 59.901 41.667 0.00 0.00 45.41 1.73
2209 2210 1.105457 TGTGCTGGAATGCCAATAGC 58.895 50.000 0.00 0.00 45.41 2.97
2223 2224 5.335827 GCCAATAGCAATTAAGTCTCTCG 57.664 43.478 0.00 0.00 42.97 4.04
2224 2225 4.319118 GCCAATAGCAATTAAGTCTCTCGC 60.319 45.833 0.00 0.00 42.97 5.03
2225 2226 4.811024 CCAATAGCAATTAAGTCTCTCGCA 59.189 41.667 0.00 0.00 0.00 5.10
2226 2227 5.050499 CCAATAGCAATTAAGTCTCTCGCAG 60.050 44.000 0.00 0.00 0.00 5.18
2227 2228 2.898705 AGCAATTAAGTCTCTCGCAGG 58.101 47.619 0.00 0.00 0.00 4.85
2228 2229 2.234908 AGCAATTAAGTCTCTCGCAGGT 59.765 45.455 0.00 0.00 0.00 4.00
2229 2230 3.447586 AGCAATTAAGTCTCTCGCAGGTA 59.552 43.478 0.00 0.00 0.00 3.08
2230 2231 4.081642 AGCAATTAAGTCTCTCGCAGGTAA 60.082 41.667 0.00 0.00 0.00 2.85
2231 2232 4.033014 GCAATTAAGTCTCTCGCAGGTAAC 59.967 45.833 0.00 0.00 0.00 2.50
2232 2233 3.863142 TTAAGTCTCTCGCAGGTAACC 57.137 47.619 0.00 0.00 37.17 2.85
2233 2234 1.926108 AAGTCTCTCGCAGGTAACCT 58.074 50.000 0.00 0.00 37.17 3.50
2234 2235 1.926108 AGTCTCTCGCAGGTAACCTT 58.074 50.000 0.00 0.00 37.17 3.50
2235 2236 1.819903 AGTCTCTCGCAGGTAACCTTC 59.180 52.381 0.00 0.00 37.17 3.46
2236 2237 1.544691 GTCTCTCGCAGGTAACCTTCA 59.455 52.381 0.00 0.00 37.17 3.02
2237 2238 1.544691 TCTCTCGCAGGTAACCTTCAC 59.455 52.381 0.00 0.00 37.17 3.18
2238 2239 0.242825 TCTCGCAGGTAACCTTCACG 59.757 55.000 0.00 0.00 37.17 4.35
2239 2240 0.736325 CTCGCAGGTAACCTTCACGG 60.736 60.000 0.00 0.00 39.35 4.94
2240 2241 1.740296 CGCAGGTAACCTTCACGGG 60.740 63.158 0.00 0.00 36.97 5.28
2241 2242 1.675219 GCAGGTAACCTTCACGGGA 59.325 57.895 0.00 0.00 36.97 5.14
2242 2243 0.035739 GCAGGTAACCTTCACGGGAA 59.964 55.000 0.00 0.00 36.97 3.97
2249 2250 2.345991 CTTCACGGGAAGCGGGAA 59.654 61.111 15.71 0.00 43.67 3.97
2250 2251 1.302192 CTTCACGGGAAGCGGGAAA 60.302 57.895 15.71 0.00 43.67 3.13
2251 2252 0.676782 CTTCACGGGAAGCGGGAAAT 60.677 55.000 15.71 0.00 43.67 2.17
2252 2253 0.958382 TTCACGGGAAGCGGGAAATG 60.958 55.000 0.00 0.00 0.00 2.32
2253 2254 1.376683 CACGGGAAGCGGGAAATGA 60.377 57.895 0.00 0.00 0.00 2.57
2254 2255 0.958382 CACGGGAAGCGGGAAATGAA 60.958 55.000 0.00 0.00 0.00 2.57
2255 2256 0.250989 ACGGGAAGCGGGAAATGAAA 60.251 50.000 0.00 0.00 0.00 2.69
2256 2257 1.102978 CGGGAAGCGGGAAATGAAAT 58.897 50.000 0.00 0.00 0.00 2.17
2257 2258 2.294074 CGGGAAGCGGGAAATGAAATA 58.706 47.619 0.00 0.00 0.00 1.40
2258 2259 2.884639 CGGGAAGCGGGAAATGAAATAT 59.115 45.455 0.00 0.00 0.00 1.28
2259 2260 3.317993 CGGGAAGCGGGAAATGAAATATT 59.682 43.478 0.00 0.00 0.00 1.28
2260 2261 4.620982 GGGAAGCGGGAAATGAAATATTG 58.379 43.478 0.00 0.00 0.00 1.90
2261 2262 4.501400 GGGAAGCGGGAAATGAAATATTGG 60.501 45.833 0.00 0.00 0.00 3.16
2262 2263 3.733443 AGCGGGAAATGAAATATTGGC 57.267 42.857 0.00 0.00 0.00 4.52
2263 2264 3.030291 AGCGGGAAATGAAATATTGGCA 58.970 40.909 0.00 0.00 0.00 4.92
2264 2265 3.068590 AGCGGGAAATGAAATATTGGCAG 59.931 43.478 0.00 0.00 0.00 4.85
2265 2266 3.181476 GCGGGAAATGAAATATTGGCAGT 60.181 43.478 0.00 0.00 0.00 4.40
2266 2267 4.610945 CGGGAAATGAAATATTGGCAGTC 58.389 43.478 0.00 0.00 0.00 3.51
2267 2268 4.499696 CGGGAAATGAAATATTGGCAGTCC 60.500 45.833 11.76 11.76 0.00 3.85
2268 2269 4.651045 GGGAAATGAAATATTGGCAGTCCT 59.349 41.667 15.98 0.00 0.00 3.85
2269 2270 5.129320 GGGAAATGAAATATTGGCAGTCCTT 59.871 40.000 15.98 0.00 0.00 3.36
2270 2271 6.044682 GGAAATGAAATATTGGCAGTCCTTG 58.955 40.000 12.39 0.00 0.00 3.61
2271 2272 6.127366 GGAAATGAAATATTGGCAGTCCTTGA 60.127 38.462 12.39 0.00 0.00 3.02
2272 2273 6.461110 AATGAAATATTGGCAGTCCTTGAG 57.539 37.500 0.00 0.00 0.00 3.02
2273 2274 4.272489 TGAAATATTGGCAGTCCTTGAGG 58.728 43.478 0.00 0.00 0.00 3.86
2274 2275 3.303351 AATATTGGCAGTCCTTGAGGG 57.697 47.619 0.00 0.00 35.41 4.30
2275 2276 1.965414 TATTGGCAGTCCTTGAGGGA 58.035 50.000 0.00 0.00 42.77 4.20
2289 2290 7.265599 TCCTTGAGGGATTGTAATTTACTGA 57.734 36.000 7.99 0.00 39.58 3.41
2290 2291 7.110155 TCCTTGAGGGATTGTAATTTACTGAC 58.890 38.462 7.99 0.10 39.58 3.51
2291 2292 7.037586 TCCTTGAGGGATTGTAATTTACTGACT 60.038 37.037 7.99 0.30 39.58 3.41
2292 2293 7.066284 CCTTGAGGGATTGTAATTTACTGACTG 59.934 40.741 7.99 0.00 37.23 3.51
2293 2294 7.252612 TGAGGGATTGTAATTTACTGACTGA 57.747 36.000 7.99 0.00 0.00 3.41
2294 2295 7.103641 TGAGGGATTGTAATTTACTGACTGAC 58.896 38.462 7.99 0.00 0.00 3.51
2295 2296 7.016153 AGGGATTGTAATTTACTGACTGACA 57.984 36.000 7.99 0.00 0.00 3.58
2296 2297 7.458397 AGGGATTGTAATTTACTGACTGACAA 58.542 34.615 7.99 0.00 0.00 3.18
2297 2298 7.607991 AGGGATTGTAATTTACTGACTGACAAG 59.392 37.037 7.99 0.00 0.00 3.16
2298 2299 7.148239 GGGATTGTAATTTACTGACTGACAAGG 60.148 40.741 7.99 0.00 0.00 3.61
2299 2300 7.606456 GGATTGTAATTTACTGACTGACAAGGA 59.394 37.037 7.99 0.00 0.00 3.36
2300 2301 9.167311 GATTGTAATTTACTGACTGACAAGGAT 57.833 33.333 7.99 0.00 0.00 3.24
2307 2308 8.997621 TTTACTGACTGACAAGGATATACAAC 57.002 34.615 0.00 0.00 0.00 3.32
2308 2309 6.605471 ACTGACTGACAAGGATATACAACA 57.395 37.500 0.00 0.00 0.00 3.33
2309 2310 6.398918 ACTGACTGACAAGGATATACAACAC 58.601 40.000 0.00 0.00 0.00 3.32
2310 2311 6.014584 ACTGACTGACAAGGATATACAACACA 60.015 38.462 0.00 0.00 0.00 3.72
2311 2312 6.398095 TGACTGACAAGGATATACAACACAG 58.602 40.000 0.00 0.00 0.00 3.66
2312 2313 6.210584 TGACTGACAAGGATATACAACACAGA 59.789 38.462 0.00 0.00 0.00 3.41
2313 2314 6.634805 ACTGACAAGGATATACAACACAGAG 58.365 40.000 0.00 0.00 0.00 3.35
2314 2315 6.211584 ACTGACAAGGATATACAACACAGAGT 59.788 38.462 0.00 0.00 0.00 3.24
2315 2316 7.004555 TGACAAGGATATACAACACAGAGTT 57.995 36.000 0.00 0.00 42.42 3.01
2316 2317 7.450074 TGACAAGGATATACAACACAGAGTTT 58.550 34.615 0.00 0.00 38.74 2.66
2317 2318 7.936847 TGACAAGGATATACAACACAGAGTTTT 59.063 33.333 0.00 0.00 38.74 2.43
2318 2319 8.099364 ACAAGGATATACAACACAGAGTTTTG 57.901 34.615 0.00 0.00 38.74 2.44
2319 2320 7.174946 ACAAGGATATACAACACAGAGTTTTGG 59.825 37.037 1.74 0.00 38.74 3.28
2320 2321 6.180472 AGGATATACAACACAGAGTTTTGGG 58.820 40.000 1.74 0.00 38.74 4.12
2321 2322 5.357032 GGATATACAACACAGAGTTTTGGGG 59.643 44.000 1.74 0.00 38.74 4.96
2322 2323 2.525105 ACAACACAGAGTTTTGGGGT 57.475 45.000 1.74 0.00 38.74 4.95
2323 2324 2.375146 ACAACACAGAGTTTTGGGGTC 58.625 47.619 1.74 0.00 38.74 4.46
2324 2325 1.681264 CAACACAGAGTTTTGGGGTCC 59.319 52.381 0.00 0.00 38.74 4.46
2325 2326 1.222567 ACACAGAGTTTTGGGGTCCT 58.777 50.000 0.00 0.00 0.00 3.85
2326 2327 1.569072 ACACAGAGTTTTGGGGTCCTT 59.431 47.619 0.00 0.00 0.00 3.36
2327 2328 1.956477 CACAGAGTTTTGGGGTCCTTG 59.044 52.381 0.00 0.00 0.00 3.61
2328 2329 1.850345 ACAGAGTTTTGGGGTCCTTGA 59.150 47.619 0.00 0.00 0.00 3.02
2329 2330 2.447047 ACAGAGTTTTGGGGTCCTTGAT 59.553 45.455 0.00 0.00 0.00 2.57
2330 2331 2.821969 CAGAGTTTTGGGGTCCTTGATG 59.178 50.000 0.00 0.00 0.00 3.07
2331 2332 2.447047 AGAGTTTTGGGGTCCTTGATGT 59.553 45.455 0.00 0.00 0.00 3.06
2332 2333 3.117131 AGAGTTTTGGGGTCCTTGATGTT 60.117 43.478 0.00 0.00 0.00 2.71
2333 2334 2.965147 AGTTTTGGGGTCCTTGATGTTG 59.035 45.455 0.00 0.00 0.00 3.33
2334 2335 2.962421 GTTTTGGGGTCCTTGATGTTGA 59.038 45.455 0.00 0.00 0.00 3.18
2335 2336 2.584835 TTGGGGTCCTTGATGTTGAG 57.415 50.000 0.00 0.00 0.00 3.02
2336 2337 0.038166 TGGGGTCCTTGATGTTGAGC 59.962 55.000 0.00 0.00 0.00 4.26
2337 2338 0.329596 GGGGTCCTTGATGTTGAGCT 59.670 55.000 0.00 0.00 0.00 4.09
2338 2339 1.559682 GGGGTCCTTGATGTTGAGCTA 59.440 52.381 0.00 0.00 0.00 3.32
2339 2340 2.173569 GGGGTCCTTGATGTTGAGCTAT 59.826 50.000 0.00 0.00 0.00 2.97
2340 2341 3.372025 GGGGTCCTTGATGTTGAGCTATT 60.372 47.826 0.00 0.00 0.00 1.73
2341 2342 4.273318 GGGTCCTTGATGTTGAGCTATTT 58.727 43.478 0.00 0.00 0.00 1.40
2342 2343 4.706962 GGGTCCTTGATGTTGAGCTATTTT 59.293 41.667 0.00 0.00 0.00 1.82
2343 2344 5.163612 GGGTCCTTGATGTTGAGCTATTTTC 60.164 44.000 0.00 0.00 0.00 2.29
2344 2345 5.415701 GGTCCTTGATGTTGAGCTATTTTCA 59.584 40.000 0.00 0.00 0.00 2.69
2345 2346 6.096001 GGTCCTTGATGTTGAGCTATTTTCAT 59.904 38.462 0.00 0.00 0.00 2.57
2346 2347 7.363268 GGTCCTTGATGTTGAGCTATTTTCATT 60.363 37.037 0.00 0.00 0.00 2.57
2347 2348 8.031277 GTCCTTGATGTTGAGCTATTTTCATTT 58.969 33.333 0.00 0.00 0.00 2.32
2348 2349 8.030692 TCCTTGATGTTGAGCTATTTTCATTTG 58.969 33.333 0.00 0.00 0.00 2.32
2349 2350 7.816031 CCTTGATGTTGAGCTATTTTCATTTGT 59.184 33.333 0.00 0.00 0.00 2.83
2350 2351 8.746922 TTGATGTTGAGCTATTTTCATTTGTC 57.253 30.769 0.00 0.00 0.00 3.18
2351 2352 7.884257 TGATGTTGAGCTATTTTCATTTGTCA 58.116 30.769 0.00 0.00 0.00 3.58
2352 2353 8.024865 TGATGTTGAGCTATTTTCATTTGTCAG 58.975 33.333 0.00 0.00 0.00 3.51
2353 2354 7.509141 TGTTGAGCTATTTTCATTTGTCAGA 57.491 32.000 0.00 0.00 0.00 3.27
2354 2355 8.114331 TGTTGAGCTATTTTCATTTGTCAGAT 57.886 30.769 0.00 0.00 0.00 2.90
2355 2356 8.024865 TGTTGAGCTATTTTCATTTGTCAGATG 58.975 33.333 0.00 0.00 0.00 2.90
2356 2357 7.926674 TGAGCTATTTTCATTTGTCAGATGA 57.073 32.000 1.97 1.97 0.00 2.92
2357 2358 8.515695 TGAGCTATTTTCATTTGTCAGATGAT 57.484 30.769 6.87 0.00 33.82 2.45
2358 2359 8.618677 TGAGCTATTTTCATTTGTCAGATGATC 58.381 33.333 6.87 1.48 33.82 2.92
2359 2360 8.749026 AGCTATTTTCATTTGTCAGATGATCT 57.251 30.769 6.87 0.00 33.82 2.75
2360 2361 9.186837 AGCTATTTTCATTTGTCAGATGATCTT 57.813 29.630 6.87 0.00 33.82 2.40
2364 2365 9.798994 ATTTTCATTTGTCAGATGATCTTAAGC 57.201 29.630 6.87 0.00 33.82 3.09
2365 2366 7.926674 TTCATTTGTCAGATGATCTTAAGCA 57.073 32.000 6.87 0.00 33.82 3.91
2366 2367 7.549615 TCATTTGTCAGATGATCTTAAGCAG 57.450 36.000 1.97 0.00 0.00 4.24
2367 2368 7.108194 TCATTTGTCAGATGATCTTAAGCAGT 58.892 34.615 1.97 0.00 0.00 4.40
2368 2369 6.732531 TTTGTCAGATGATCTTAAGCAGTG 57.267 37.500 0.00 0.00 0.00 3.66
2369 2370 4.186926 TGTCAGATGATCTTAAGCAGTGC 58.813 43.478 7.13 7.13 0.00 4.40
2370 2371 4.081254 TGTCAGATGATCTTAAGCAGTGCT 60.081 41.667 13.14 13.14 42.56 4.40
2381 2382 3.350766 GCAGTGCTTTGTGCTTTGT 57.649 47.368 8.18 0.00 43.37 2.83
2382 2383 1.643880 GCAGTGCTTTGTGCTTTGTT 58.356 45.000 8.18 0.00 43.37 2.83
2383 2384 1.589779 GCAGTGCTTTGTGCTTTGTTC 59.410 47.619 8.18 0.00 43.37 3.18
2384 2385 2.736400 GCAGTGCTTTGTGCTTTGTTCT 60.736 45.455 8.18 0.00 43.37 3.01
2385 2386 3.489059 GCAGTGCTTTGTGCTTTGTTCTA 60.489 43.478 8.18 0.00 43.37 2.10
2386 2387 4.794003 GCAGTGCTTTGTGCTTTGTTCTAT 60.794 41.667 8.18 0.00 43.37 1.98
2387 2388 5.562696 GCAGTGCTTTGTGCTTTGTTCTATA 60.563 40.000 8.18 0.00 43.37 1.31
2388 2389 6.615088 CAGTGCTTTGTGCTTTGTTCTATAT 58.385 36.000 0.00 0.00 43.37 0.86
2389 2390 7.086376 CAGTGCTTTGTGCTTTGTTCTATATT 58.914 34.615 0.00 0.00 43.37 1.28
2390 2391 7.596248 CAGTGCTTTGTGCTTTGTTCTATATTT 59.404 33.333 0.00 0.00 43.37 1.40
2391 2392 7.809806 AGTGCTTTGTGCTTTGTTCTATATTTC 59.190 33.333 0.00 0.00 43.37 2.17
2392 2393 7.062255 GTGCTTTGTGCTTTGTTCTATATTTCC 59.938 37.037 0.00 0.00 43.37 3.13
2393 2394 7.090173 GCTTTGTGCTTTGTTCTATATTTCCA 58.910 34.615 0.00 0.00 38.95 3.53
2394 2395 7.598493 GCTTTGTGCTTTGTTCTATATTTCCAA 59.402 33.333 0.00 0.00 38.95 3.53
2395 2396 9.474920 CTTTGTGCTTTGTTCTATATTTCCAAA 57.525 29.630 0.00 0.00 0.00 3.28
2396 2397 9.823647 TTTGTGCTTTGTTCTATATTTCCAAAA 57.176 25.926 0.00 0.00 0.00 2.44
2397 2398 9.474920 TTGTGCTTTGTTCTATATTTCCAAAAG 57.525 29.630 0.00 0.00 0.00 2.27
2398 2399 8.087750 TGTGCTTTGTTCTATATTTCCAAAAGG 58.912 33.333 0.00 0.00 0.00 3.11
2399 2400 7.063426 GTGCTTTGTTCTATATTTCCAAAAGGC 59.937 37.037 0.00 0.00 0.00 4.35
2400 2401 7.039082 TGCTTTGTTCTATATTTCCAAAAGGCT 60.039 33.333 0.00 0.00 0.00 4.58
2401 2402 8.466798 GCTTTGTTCTATATTTCCAAAAGGCTA 58.533 33.333 0.00 0.00 0.00 3.93
2405 2406 9.474313 TGTTCTATATTTCCAAAAGGCTATTGT 57.526 29.630 0.00 0.00 0.00 2.71
2429 2430 8.999431 TGTATAGACAAAGTCAACTTGATTTCC 58.001 33.333 0.40 0.00 36.12 3.13
2430 2431 5.774498 AGACAAAGTCAACTTGATTTCCC 57.226 39.130 0.40 0.00 36.12 3.97
2431 2432 5.200483 AGACAAAGTCAACTTGATTTCCCA 58.800 37.500 0.40 0.00 36.12 4.37
2432 2433 5.656416 AGACAAAGTCAACTTGATTTCCCAA 59.344 36.000 0.40 0.00 36.12 4.12
2433 2434 6.324770 AGACAAAGTCAACTTGATTTCCCAAT 59.675 34.615 0.40 0.00 36.12 3.16
2434 2435 6.282930 ACAAAGTCAACTTGATTTCCCAATG 58.717 36.000 0.40 0.00 36.12 2.82
2435 2436 5.473066 AAGTCAACTTGATTTCCCAATGG 57.527 39.130 0.00 0.00 34.38 3.16
2436 2437 4.739793 AGTCAACTTGATTTCCCAATGGA 58.260 39.130 0.00 0.00 39.54 3.41
2437 2438 5.336102 AGTCAACTTGATTTCCCAATGGAT 58.664 37.500 0.00 0.00 41.40 3.41
2438 2439 6.493166 AGTCAACTTGATTTCCCAATGGATA 58.507 36.000 0.00 0.00 41.40 2.59
2439 2440 6.953520 AGTCAACTTGATTTCCCAATGGATAA 59.046 34.615 0.00 0.00 41.40 1.75
2440 2441 7.035612 GTCAACTTGATTTCCCAATGGATAAC 58.964 38.462 0.00 0.00 41.40 1.89
2441 2442 6.723515 TCAACTTGATTTCCCAATGGATAACA 59.276 34.615 0.00 0.00 41.40 2.41
2442 2443 6.530019 ACTTGATTTCCCAATGGATAACAC 57.470 37.500 0.00 0.00 41.40 3.32
2443 2444 6.015918 ACTTGATTTCCCAATGGATAACACA 58.984 36.000 0.00 0.00 41.40 3.72
2444 2445 6.669154 ACTTGATTTCCCAATGGATAACACAT 59.331 34.615 0.00 0.00 41.40 3.21
2445 2446 6.468333 TGATTTCCCAATGGATAACACATG 57.532 37.500 0.00 0.00 41.40 3.21
2446 2447 5.363292 TGATTTCCCAATGGATAACACATGG 59.637 40.000 0.00 0.00 41.40 3.66
2447 2448 2.665165 TCCCAATGGATAACACATGGC 58.335 47.619 0.00 0.00 37.83 4.40
2448 2449 2.244510 TCCCAATGGATAACACATGGCT 59.755 45.455 0.00 0.00 37.83 4.75
2449 2450 3.033184 CCCAATGGATAACACATGGCTT 58.967 45.455 0.00 0.00 37.83 4.35
2450 2451 3.068590 CCCAATGGATAACACATGGCTTC 59.931 47.826 0.00 0.00 37.83 3.86
2451 2452 3.700539 CCAATGGATAACACATGGCTTCA 59.299 43.478 0.00 0.00 33.98 3.02
2452 2453 4.342951 CCAATGGATAACACATGGCTTCAT 59.657 41.667 0.00 0.00 33.98 2.57
2453 2454 5.163385 CCAATGGATAACACATGGCTTCATT 60.163 40.000 0.00 0.00 33.98 2.57
2454 2455 6.040729 CCAATGGATAACACATGGCTTCATTA 59.959 38.462 0.00 0.00 33.98 1.90
2455 2456 7.417683 CCAATGGATAACACATGGCTTCATTAA 60.418 37.037 0.00 0.00 33.98 1.40
2456 2457 7.844493 ATGGATAACACATGGCTTCATTAAT 57.156 32.000 0.00 0.00 0.00 1.40
2457 2458 7.658525 TGGATAACACATGGCTTCATTAATT 57.341 32.000 0.00 0.00 0.00 1.40
2458 2459 7.715657 TGGATAACACATGGCTTCATTAATTC 58.284 34.615 0.00 0.00 0.00 2.17
2459 2460 6.857964 GGATAACACATGGCTTCATTAATTCG 59.142 38.462 0.00 0.00 0.00 3.34
2460 2461 5.895636 AACACATGGCTTCATTAATTCGA 57.104 34.783 0.00 0.00 0.00 3.71
2461 2462 5.235305 ACACATGGCTTCATTAATTCGAC 57.765 39.130 0.00 0.00 0.00 4.20
2462 2463 4.201812 ACACATGGCTTCATTAATTCGACG 60.202 41.667 0.00 0.00 0.00 5.12
2463 2464 4.033932 CACATGGCTTCATTAATTCGACGA 59.966 41.667 0.00 0.00 0.00 4.20
2464 2465 4.634004 ACATGGCTTCATTAATTCGACGAA 59.366 37.500 13.48 13.48 0.00 3.85
2465 2466 5.296780 ACATGGCTTCATTAATTCGACGAAT 59.703 36.000 17.19 17.19 33.25 3.34
2466 2467 5.155509 TGGCTTCATTAATTCGACGAATG 57.844 39.130 22.93 12.59 32.14 2.67
2467 2468 3.968724 GGCTTCATTAATTCGACGAATGC 59.031 43.478 22.93 18.28 32.14 3.56
2468 2469 4.495679 GGCTTCATTAATTCGACGAATGCA 60.496 41.667 22.93 13.18 32.14 3.96
2469 2470 4.667948 GCTTCATTAATTCGACGAATGCAG 59.332 41.667 22.93 12.86 32.14 4.41
2470 2471 4.794248 TCATTAATTCGACGAATGCAGG 57.206 40.909 22.93 14.13 32.14 4.85
2471 2472 4.188462 TCATTAATTCGACGAATGCAGGT 58.812 39.130 22.93 10.04 32.14 4.00
2472 2473 4.270084 TCATTAATTCGACGAATGCAGGTC 59.730 41.667 22.93 0.00 32.14 3.85
2476 2477 4.571250 GACGAATGCAGGTCGACA 57.429 55.556 24.59 0.00 41.02 4.35
2477 2478 2.822306 GACGAATGCAGGTCGACAA 58.178 52.632 24.59 0.00 41.02 3.18
2478 2479 0.438830 GACGAATGCAGGTCGACAAC 59.561 55.000 24.59 6.32 41.02 3.32
2479 2480 0.033504 ACGAATGCAGGTCGACAACT 59.966 50.000 24.59 2.85 41.02 3.16
2480 2481 0.439985 CGAATGCAGGTCGACAACTG 59.560 55.000 18.91 16.73 41.02 3.16
2481 2482 0.798776 GAATGCAGGTCGACAACTGG 59.201 55.000 18.91 2.42 35.30 4.00
2482 2483 0.396435 AATGCAGGTCGACAACTGGA 59.604 50.000 18.91 17.22 39.38 3.86
2483 2484 0.396435 ATGCAGGTCGACAACTGGAA 59.604 50.000 18.91 0.00 38.54 3.53
2484 2485 0.249868 TGCAGGTCGACAACTGGAAG 60.250 55.000 18.91 0.00 42.29 3.46
2485 2486 0.033504 GCAGGTCGACAACTGGAAGA 59.966 55.000 18.91 0.00 37.43 2.87
2486 2487 1.540363 GCAGGTCGACAACTGGAAGAA 60.540 52.381 18.91 0.00 37.43 2.52
2487 2488 2.833794 CAGGTCGACAACTGGAAGAAA 58.166 47.619 18.91 0.00 37.43 2.52
2488 2489 3.403038 CAGGTCGACAACTGGAAGAAAT 58.597 45.455 18.91 0.00 37.43 2.17
2489 2490 3.815401 CAGGTCGACAACTGGAAGAAATT 59.185 43.478 18.91 0.00 37.43 1.82
2490 2491 3.815401 AGGTCGACAACTGGAAGAAATTG 59.185 43.478 18.91 0.00 37.43 2.32
2491 2492 3.058224 GGTCGACAACTGGAAGAAATTGG 60.058 47.826 18.91 0.00 37.43 3.16
2492 2493 3.813166 GTCGACAACTGGAAGAAATTGGA 59.187 43.478 11.55 0.00 37.43 3.53
2493 2494 4.274950 GTCGACAACTGGAAGAAATTGGAA 59.725 41.667 11.55 0.00 37.43 3.53
2494 2495 4.884744 TCGACAACTGGAAGAAATTGGAAA 59.115 37.500 0.00 0.00 37.43 3.13
2495 2496 4.976116 CGACAACTGGAAGAAATTGGAAAC 59.024 41.667 0.00 0.00 37.43 2.78
2496 2497 4.932146 ACAACTGGAAGAAATTGGAAACG 58.068 39.130 0.00 0.00 37.43 3.60
2497 2498 4.642885 ACAACTGGAAGAAATTGGAAACGA 59.357 37.500 0.00 0.00 37.43 3.85
2498 2499 4.830826 ACTGGAAGAAATTGGAAACGAC 57.169 40.909 0.00 0.00 37.43 4.34
2499 2500 4.461198 ACTGGAAGAAATTGGAAACGACT 58.539 39.130 0.00 0.00 37.43 4.18
2500 2501 5.617252 ACTGGAAGAAATTGGAAACGACTA 58.383 37.500 0.00 0.00 37.43 2.59
2501 2502 5.469084 ACTGGAAGAAATTGGAAACGACTAC 59.531 40.000 0.00 0.00 37.43 2.73
2502 2503 5.617252 TGGAAGAAATTGGAAACGACTACT 58.383 37.500 0.00 0.00 0.00 2.57
2503 2504 6.059484 TGGAAGAAATTGGAAACGACTACTT 58.941 36.000 0.00 0.00 0.00 2.24
2504 2505 6.544564 TGGAAGAAATTGGAAACGACTACTTT 59.455 34.615 0.00 0.00 0.00 2.66
2505 2506 6.856426 GGAAGAAATTGGAAACGACTACTTTG 59.144 38.462 0.00 0.00 0.00 2.77
2506 2507 7.255001 GGAAGAAATTGGAAACGACTACTTTGA 60.255 37.037 0.00 0.00 0.00 2.69
2507 2508 7.745620 AGAAATTGGAAACGACTACTTTGAT 57.254 32.000 0.00 0.00 0.00 2.57
2508 2509 8.166422 AGAAATTGGAAACGACTACTTTGATT 57.834 30.769 0.00 0.00 0.00 2.57
2509 2510 8.290325 AGAAATTGGAAACGACTACTTTGATTC 58.710 33.333 0.00 0.00 0.00 2.52
2510 2511 7.745620 AATTGGAAACGACTACTTTGATTCT 57.254 32.000 0.00 0.00 0.00 2.40
2511 2512 6.780706 TTGGAAACGACTACTTTGATTCTC 57.219 37.500 0.00 0.00 0.00 2.87
2512 2513 6.097915 TGGAAACGACTACTTTGATTCTCT 57.902 37.500 0.00 0.00 0.00 3.10
2513 2514 6.522054 TGGAAACGACTACTTTGATTCTCTT 58.478 36.000 0.00 0.00 0.00 2.85
2514 2515 6.645415 TGGAAACGACTACTTTGATTCTCTTC 59.355 38.462 0.00 0.00 0.00 2.87
2515 2516 6.869388 GGAAACGACTACTTTGATTCTCTTCT 59.131 38.462 0.00 0.00 0.00 2.85
2516 2517 7.062488 GGAAACGACTACTTTGATTCTCTTCTC 59.938 40.741 0.00 0.00 0.00 2.87
2517 2518 6.576662 ACGACTACTTTGATTCTCTTCTCA 57.423 37.500 0.00 0.00 0.00 3.27
2518 2519 6.982852 ACGACTACTTTGATTCTCTTCTCAA 58.017 36.000 0.00 0.00 0.00 3.02
2519 2520 7.434492 ACGACTACTTTGATTCTCTTCTCAAA 58.566 34.615 0.00 0.00 38.64 2.69
2520 2521 7.926555 ACGACTACTTTGATTCTCTTCTCAAAA 59.073 33.333 0.00 0.00 39.97 2.44
2521 2522 8.930760 CGACTACTTTGATTCTCTTCTCAAAAT 58.069 33.333 0.00 0.00 39.97 1.82
2535 2536 9.460906 CTCTTCTCAAAATTTCTTTTCTTCAGG 57.539 33.333 0.00 0.00 32.21 3.86
2536 2537 9.189156 TCTTCTCAAAATTTCTTTTCTTCAGGA 57.811 29.630 0.00 0.00 32.21 3.86
2537 2538 9.978044 CTTCTCAAAATTTCTTTTCTTCAGGAT 57.022 29.630 0.00 0.00 32.21 3.24
2538 2539 9.971922 TTCTCAAAATTTCTTTTCTTCAGGATC 57.028 29.630 0.00 0.00 32.21 3.36
2539 2540 9.359653 TCTCAAAATTTCTTTTCTTCAGGATCT 57.640 29.630 0.00 0.00 32.21 2.75
2548 2549 9.928618 TTCTTTTCTTCAGGATCTAGATCTAGA 57.071 33.333 29.94 29.94 45.24 2.43
2561 2562 6.846988 TCTAGATCTAGATGTGGATGTGTCT 58.153 40.000 25.54 0.03 37.28 3.41
2562 2563 7.978925 TCTAGATCTAGATGTGGATGTGTCTA 58.021 38.462 25.54 1.30 37.28 2.59
2563 2564 8.440771 TCTAGATCTAGATGTGGATGTGTCTAA 58.559 37.037 25.54 0.61 37.28 2.10
2564 2565 9.241919 CTAGATCTAGATGTGGATGTGTCTAAT 57.758 37.037 23.14 0.00 35.21 1.73
2565 2566 7.894708 AGATCTAGATGTGGATGTGTCTAATG 58.105 38.462 10.74 0.00 0.00 1.90
2566 2567 7.727634 AGATCTAGATGTGGATGTGTCTAATGA 59.272 37.037 10.74 0.00 0.00 2.57
2567 2568 7.660030 TCTAGATGTGGATGTGTCTAATGAA 57.340 36.000 0.00 0.00 0.00 2.57
2568 2569 8.078060 TCTAGATGTGGATGTGTCTAATGAAA 57.922 34.615 0.00 0.00 0.00 2.69
2569 2570 8.539544 TCTAGATGTGGATGTGTCTAATGAAAA 58.460 33.333 0.00 0.00 0.00 2.29
2570 2571 9.166173 CTAGATGTGGATGTGTCTAATGAAAAA 57.834 33.333 0.00 0.00 0.00 1.94
2588 2589 4.778534 AAAAAGAGTGACATGCAGGATG 57.221 40.909 4.84 0.00 38.15 3.51
2599 2600 2.665000 CAGGATGCACGACCTGGT 59.335 61.111 21.46 0.00 46.76 4.00
2600 2601 1.003355 CAGGATGCACGACCTGGTT 60.003 57.895 21.46 0.00 46.76 3.67
2601 2602 1.021390 CAGGATGCACGACCTGGTTC 61.021 60.000 21.46 0.00 46.76 3.62
2602 2603 1.003839 GGATGCACGACCTGGTTCA 60.004 57.895 0.00 0.00 0.00 3.18
2603 2604 0.392998 GGATGCACGACCTGGTTCAT 60.393 55.000 0.00 2.78 0.00 2.57
2604 2605 0.729116 GATGCACGACCTGGTTCATG 59.271 55.000 0.00 1.03 0.00 3.07
2605 2606 0.324614 ATGCACGACCTGGTTCATGA 59.675 50.000 0.00 0.00 0.00 3.07
2606 2607 0.324614 TGCACGACCTGGTTCATGAT 59.675 50.000 0.00 0.00 0.00 2.45
2607 2608 1.009829 GCACGACCTGGTTCATGATC 58.990 55.000 0.00 0.00 0.00 2.92
2608 2609 1.406069 GCACGACCTGGTTCATGATCT 60.406 52.381 0.00 0.00 0.00 2.75
2609 2610 2.544685 CACGACCTGGTTCATGATCTC 58.455 52.381 0.00 0.00 0.00 2.75
2610 2611 2.094026 CACGACCTGGTTCATGATCTCA 60.094 50.000 0.00 0.00 0.00 3.27
2611 2612 2.093973 ACGACCTGGTTCATGATCTCAC 60.094 50.000 0.00 0.00 0.00 3.51
2612 2613 2.167281 CGACCTGGTTCATGATCTCACT 59.833 50.000 0.00 0.00 0.00 3.41
2613 2614 3.736433 CGACCTGGTTCATGATCTCACTC 60.736 52.174 0.00 0.00 0.00 3.51
2614 2615 2.167281 ACCTGGTTCATGATCTCACTCG 59.833 50.000 0.00 0.00 0.00 4.18
2615 2616 2.482664 CCTGGTTCATGATCTCACTCGG 60.483 54.545 0.00 0.00 0.00 4.63
2616 2617 1.134699 TGGTTCATGATCTCACTCGGC 60.135 52.381 0.00 0.00 0.00 5.54
2617 2618 1.134699 GGTTCATGATCTCACTCGGCA 60.135 52.381 0.00 0.00 0.00 5.69
2618 2619 2.621338 GTTCATGATCTCACTCGGCAA 58.379 47.619 0.00 0.00 0.00 4.52
2619 2620 3.002791 GTTCATGATCTCACTCGGCAAA 58.997 45.455 0.00 0.00 0.00 3.68
2620 2621 3.548745 TCATGATCTCACTCGGCAAAT 57.451 42.857 0.00 0.00 0.00 2.32
2621 2622 3.877559 TCATGATCTCACTCGGCAAATT 58.122 40.909 0.00 0.00 0.00 1.82
2622 2623 4.264253 TCATGATCTCACTCGGCAAATTT 58.736 39.130 0.00 0.00 0.00 1.82
2623 2624 4.701651 TCATGATCTCACTCGGCAAATTTT 59.298 37.500 0.00 0.00 0.00 1.82
2624 2625 5.879777 TCATGATCTCACTCGGCAAATTTTA 59.120 36.000 0.00 0.00 0.00 1.52
2625 2626 5.545658 TGATCTCACTCGGCAAATTTTAC 57.454 39.130 0.00 0.00 0.00 2.01
2626 2627 5.000591 TGATCTCACTCGGCAAATTTTACA 58.999 37.500 0.00 0.00 0.00 2.41
2627 2628 5.122239 TGATCTCACTCGGCAAATTTTACAG 59.878 40.000 0.00 0.00 0.00 2.74
2628 2629 3.751175 TCTCACTCGGCAAATTTTACAGG 59.249 43.478 0.00 0.00 0.00 4.00
2629 2630 3.745799 TCACTCGGCAAATTTTACAGGA 58.254 40.909 0.00 0.00 0.00 3.86
2630 2631 4.331968 TCACTCGGCAAATTTTACAGGAT 58.668 39.130 0.00 0.00 0.00 3.24
2631 2632 4.155826 TCACTCGGCAAATTTTACAGGATG 59.844 41.667 0.00 0.00 46.00 3.51
2632 2633 4.155826 CACTCGGCAAATTTTACAGGATGA 59.844 41.667 0.00 0.00 39.69 2.92
2633 2634 4.396166 ACTCGGCAAATTTTACAGGATGAG 59.604 41.667 0.00 0.00 39.69 2.90
2634 2635 4.584874 TCGGCAAATTTTACAGGATGAGA 58.415 39.130 0.00 0.00 39.69 3.27
2635 2636 5.192927 TCGGCAAATTTTACAGGATGAGAT 58.807 37.500 0.00 0.00 39.69 2.75
2636 2637 6.353323 TCGGCAAATTTTACAGGATGAGATA 58.647 36.000 0.00 0.00 39.69 1.98
2637 2638 6.483307 TCGGCAAATTTTACAGGATGAGATAG 59.517 38.462 0.00 0.00 39.69 2.08
2638 2639 6.260936 CGGCAAATTTTACAGGATGAGATAGT 59.739 38.462 0.00 0.00 39.69 2.12
2639 2640 7.201732 CGGCAAATTTTACAGGATGAGATAGTT 60.202 37.037 0.00 0.00 39.69 2.24
2640 2641 8.131731 GGCAAATTTTACAGGATGAGATAGTTC 58.868 37.037 0.00 0.00 39.69 3.01
2641 2642 8.897752 GCAAATTTTACAGGATGAGATAGTTCT 58.102 33.333 0.00 0.00 39.69 3.01
2646 2647 9.871238 TTTTACAGGATGAGATAGTTCTTACAC 57.129 33.333 0.00 0.00 39.69 2.90
2647 2648 6.472686 ACAGGATGAGATAGTTCTTACACC 57.527 41.667 0.00 0.00 39.69 4.16
2648 2649 5.958380 ACAGGATGAGATAGTTCTTACACCA 59.042 40.000 0.00 0.00 39.69 4.17
2649 2650 6.440647 ACAGGATGAGATAGTTCTTACACCAA 59.559 38.462 0.00 0.00 39.69 3.67
2650 2651 7.038302 ACAGGATGAGATAGTTCTTACACCAAA 60.038 37.037 0.00 0.00 39.69 3.28
2651 2652 7.493971 CAGGATGAGATAGTTCTTACACCAAAG 59.506 40.741 0.00 0.00 39.69 2.77
2652 2653 7.400339 AGGATGAGATAGTTCTTACACCAAAGA 59.600 37.037 0.00 0.00 33.69 2.52
2653 2654 7.708752 GGATGAGATAGTTCTTACACCAAAGAG 59.291 40.741 0.00 0.00 36.85 2.85
2654 2655 6.936279 TGAGATAGTTCTTACACCAAAGAGG 58.064 40.000 0.00 0.00 36.85 3.69
2655 2656 6.724441 TGAGATAGTTCTTACACCAAAGAGGA 59.276 38.462 0.00 0.00 36.85 3.71
2656 2657 7.093727 TGAGATAGTTCTTACACCAAAGAGGAG 60.094 40.741 0.00 0.00 36.85 3.69
2657 2658 4.009370 AGTTCTTACACCAAAGAGGAGC 57.991 45.455 0.00 0.00 41.22 4.70
2658 2659 3.391296 AGTTCTTACACCAAAGAGGAGCA 59.609 43.478 0.00 0.00 41.22 4.26
2659 2660 3.402628 TCTTACACCAAAGAGGAGCAC 57.597 47.619 0.00 0.00 41.22 4.40
2660 2661 2.972713 TCTTACACCAAAGAGGAGCACT 59.027 45.455 0.00 0.00 41.22 4.40
2661 2662 4.157246 TCTTACACCAAAGAGGAGCACTA 58.843 43.478 0.00 0.00 41.22 2.74
2662 2663 4.220821 TCTTACACCAAAGAGGAGCACTAG 59.779 45.833 0.00 0.00 41.22 2.57
2663 2664 2.330216 ACACCAAAGAGGAGCACTAGT 58.670 47.619 0.00 0.00 41.22 2.57
2664 2665 2.037772 ACACCAAAGAGGAGCACTAGTG 59.962 50.000 18.93 18.93 41.22 2.74
2665 2666 2.300152 CACCAAAGAGGAGCACTAGTGA 59.700 50.000 27.08 0.00 41.22 3.41
2666 2667 3.055530 CACCAAAGAGGAGCACTAGTGAT 60.056 47.826 27.08 21.42 41.22 3.06
2667 2668 3.196685 ACCAAAGAGGAGCACTAGTGATC 59.803 47.826 28.86 28.86 44.58 2.92
2668 2669 3.196469 CCAAAGAGGAGCACTAGTGATCA 59.804 47.826 34.81 0.00 46.89 2.92
2669 2670 4.141756 CCAAAGAGGAGCACTAGTGATCAT 60.142 45.833 34.81 31.07 46.89 2.45
2670 2671 5.069648 CCAAAGAGGAGCACTAGTGATCATA 59.930 44.000 34.81 0.00 46.89 2.15
2671 2672 6.407412 CCAAAGAGGAGCACTAGTGATCATAA 60.407 42.308 34.81 0.00 46.89 1.90
2672 2673 6.992664 AAGAGGAGCACTAGTGATCATAAT 57.007 37.500 34.81 21.23 46.89 1.28
2673 2674 6.588719 AGAGGAGCACTAGTGATCATAATC 57.411 41.667 34.81 26.06 46.89 1.75
2674 2675 5.182950 AGAGGAGCACTAGTGATCATAATCG 59.817 44.000 34.81 4.46 46.89 3.34
2675 2676 4.219507 AGGAGCACTAGTGATCATAATCGG 59.780 45.833 34.81 3.95 46.89 4.18
2676 2677 4.218635 GGAGCACTAGTGATCATAATCGGA 59.781 45.833 34.81 0.00 46.89 4.55
2677 2678 5.127693 AGCACTAGTGATCATAATCGGAC 57.872 43.478 27.08 3.71 34.39 4.79
2678 2679 4.584743 AGCACTAGTGATCATAATCGGACA 59.415 41.667 27.08 0.00 34.39 4.02
2679 2680 5.244851 AGCACTAGTGATCATAATCGGACAT 59.755 40.000 27.08 0.00 34.39 3.06
2680 2681 5.347093 GCACTAGTGATCATAATCGGACATG 59.653 44.000 27.08 0.00 34.39 3.21
2681 2682 5.347093 CACTAGTGATCATAATCGGACATGC 59.653 44.000 18.45 0.00 34.39 4.06
2682 2683 4.341366 AGTGATCATAATCGGACATGCA 57.659 40.909 0.00 0.00 34.39 3.96
2683 2684 4.313282 AGTGATCATAATCGGACATGCAG 58.687 43.478 0.00 0.00 34.39 4.41
2684 2685 4.039609 AGTGATCATAATCGGACATGCAGA 59.960 41.667 0.00 0.00 34.39 4.26
2685 2686 4.934001 GTGATCATAATCGGACATGCAGAT 59.066 41.667 0.00 0.00 34.39 2.90
2686 2687 6.071165 AGTGATCATAATCGGACATGCAGATA 60.071 38.462 0.00 0.00 34.39 1.98
2687 2688 6.760298 GTGATCATAATCGGACATGCAGATAT 59.240 38.462 0.00 0.00 34.39 1.63
2688 2689 7.279536 GTGATCATAATCGGACATGCAGATATT 59.720 37.037 0.00 0.00 34.39 1.28
2689 2690 7.825761 TGATCATAATCGGACATGCAGATATTT 59.174 33.333 0.00 0.00 34.39 1.40
2690 2691 9.317936 GATCATAATCGGACATGCAGATATTTA 57.682 33.333 0.00 0.00 30.90 1.40
2691 2692 9.842775 ATCATAATCGGACATGCAGATATTTAT 57.157 29.630 0.00 0.00 30.90 1.40
2692 2693 9.317936 TCATAATCGGACATGCAGATATTTATC 57.682 33.333 0.00 0.00 30.90 1.75
2693 2694 9.322773 CATAATCGGACATGCAGATATTTATCT 57.677 33.333 0.00 0.00 43.51 1.98
2694 2695 9.896645 ATAATCGGACATGCAGATATTTATCTT 57.103 29.630 0.00 0.00 40.91 2.40
2695 2696 8.627208 AATCGGACATGCAGATATTTATCTTT 57.373 30.769 0.00 0.00 40.91 2.52
2696 2697 9.725019 AATCGGACATGCAGATATTTATCTTTA 57.275 29.630 0.00 0.00 40.91 1.85
2697 2698 8.763049 TCGGACATGCAGATATTTATCTTTAG 57.237 34.615 0.00 0.00 40.91 1.85
2698 2699 7.819415 TCGGACATGCAGATATTTATCTTTAGG 59.181 37.037 0.00 0.00 40.91 2.69
2699 2700 7.604164 CGGACATGCAGATATTTATCTTTAGGT 59.396 37.037 0.00 0.00 40.91 3.08
2700 2701 9.289782 GGACATGCAGATATTTATCTTTAGGTT 57.710 33.333 0.00 0.00 40.91 3.50
2702 2703 9.851686 ACATGCAGATATTTATCTTTAGGTTCA 57.148 29.630 0.00 0.00 40.91 3.18
2705 2706 8.786898 TGCAGATATTTATCTTTAGGTTCATGC 58.213 33.333 0.00 0.00 40.91 4.06
2706 2707 8.786898 GCAGATATTTATCTTTAGGTTCATGCA 58.213 33.333 0.00 0.00 40.91 3.96
2710 2711 9.851686 ATATTTATCTTTAGGTTCATGCACTGA 57.148 29.630 0.00 0.00 0.00 3.41
2711 2712 7.615582 TTTATCTTTAGGTTCATGCACTGAG 57.384 36.000 0.00 0.00 34.68 3.35
2712 2713 4.890158 TCTTTAGGTTCATGCACTGAGA 57.110 40.909 0.00 0.00 34.68 3.27
2713 2714 5.227569 TCTTTAGGTTCATGCACTGAGAA 57.772 39.130 0.00 0.00 34.68 2.87
2714 2715 5.240891 TCTTTAGGTTCATGCACTGAGAAG 58.759 41.667 0.00 0.00 34.68 2.85
2715 2716 4.890158 TTAGGTTCATGCACTGAGAAGA 57.110 40.909 0.00 0.00 34.68 2.87
2716 2717 3.996921 AGGTTCATGCACTGAGAAGAT 57.003 42.857 0.00 0.00 34.68 2.40
2717 2718 4.298103 AGGTTCATGCACTGAGAAGATT 57.702 40.909 0.00 0.00 34.68 2.40
2718 2719 4.008330 AGGTTCATGCACTGAGAAGATTG 58.992 43.478 0.00 0.00 34.68 2.67
2719 2720 4.005650 GGTTCATGCACTGAGAAGATTGA 58.994 43.478 0.00 0.00 34.68 2.57
2720 2721 4.456911 GGTTCATGCACTGAGAAGATTGAA 59.543 41.667 0.00 0.00 34.68 2.69
2721 2722 5.048504 GGTTCATGCACTGAGAAGATTGAAA 60.049 40.000 0.00 0.00 34.68 2.69
2722 2723 5.874895 TCATGCACTGAGAAGATTGAAAG 57.125 39.130 0.00 0.00 0.00 2.62
2723 2724 4.698780 TCATGCACTGAGAAGATTGAAAGG 59.301 41.667 0.00 0.00 0.00 3.11
2724 2725 4.356405 TGCACTGAGAAGATTGAAAGGA 57.644 40.909 0.00 0.00 0.00 3.36
2725 2726 4.717877 TGCACTGAGAAGATTGAAAGGAA 58.282 39.130 0.00 0.00 0.00 3.36
2726 2727 4.758674 TGCACTGAGAAGATTGAAAGGAAG 59.241 41.667 0.00 0.00 0.00 3.46
2727 2728 4.759183 GCACTGAGAAGATTGAAAGGAAGT 59.241 41.667 0.00 0.00 0.00 3.01
2728 2729 5.240403 GCACTGAGAAGATTGAAAGGAAGTT 59.760 40.000 0.00 0.00 0.00 2.66
2729 2730 6.666417 CACTGAGAAGATTGAAAGGAAGTTG 58.334 40.000 0.00 0.00 0.00 3.16
2730 2731 6.261826 CACTGAGAAGATTGAAAGGAAGTTGT 59.738 38.462 0.00 0.00 0.00 3.32
2731 2732 6.830838 ACTGAGAAGATTGAAAGGAAGTTGTT 59.169 34.615 0.00 0.00 0.00 2.83
2732 2733 7.340487 ACTGAGAAGATTGAAAGGAAGTTGTTT 59.660 33.333 0.00 0.00 0.00 2.83
2733 2734 8.746052 TGAGAAGATTGAAAGGAAGTTGTTTA 57.254 30.769 0.00 0.00 0.00 2.01
2734 2735 9.184523 TGAGAAGATTGAAAGGAAGTTGTTTAA 57.815 29.630 0.00 0.00 0.00 1.52
2735 2736 9.452065 GAGAAGATTGAAAGGAAGTTGTTTAAC 57.548 33.333 0.00 0.00 37.06 2.01
2736 2737 8.966868 AGAAGATTGAAAGGAAGTTGTTTAACA 58.033 29.630 0.00 0.00 39.30 2.41
2737 2738 9.581099 GAAGATTGAAAGGAAGTTGTTTAACAA 57.419 29.630 6.41 6.41 39.30 2.83
2738 2739 9.586435 AAGATTGAAAGGAAGTTGTTTAACAAG 57.414 29.630 11.07 0.00 39.00 3.16
2739 2740 7.706607 AGATTGAAAGGAAGTTGTTTAACAAGC 59.293 33.333 11.07 6.55 39.00 4.01
2740 2741 6.524101 TGAAAGGAAGTTGTTTAACAAGCT 57.476 33.333 11.07 8.60 39.00 3.74
2741 2742 6.560711 TGAAAGGAAGTTGTTTAACAAGCTC 58.439 36.000 11.07 10.05 39.00 4.09
2742 2743 5.515797 AAGGAAGTTGTTTAACAAGCTCC 57.484 39.130 21.40 21.40 39.00 4.70
2743 2744 3.564225 AGGAAGTTGTTTAACAAGCTCCG 59.436 43.478 22.10 0.00 41.47 4.63
2744 2745 3.314357 GGAAGTTGTTTAACAAGCTCCGT 59.686 43.478 11.07 0.00 39.00 4.69
2745 2746 3.963383 AGTTGTTTAACAAGCTCCGTG 57.037 42.857 11.07 0.00 39.00 4.94
2746 2747 2.032924 AGTTGTTTAACAAGCTCCGTGC 59.967 45.455 11.07 0.00 39.00 5.34
2747 2748 0.948678 TGTTTAACAAGCTCCGTGCC 59.051 50.000 0.00 0.00 44.23 5.01
2748 2749 0.240145 GTTTAACAAGCTCCGTGCCC 59.760 55.000 0.00 0.00 44.23 5.36
2749 2750 0.109723 TTTAACAAGCTCCGTGCCCT 59.890 50.000 0.00 0.00 44.23 5.19
2750 2751 0.321298 TTAACAAGCTCCGTGCCCTC 60.321 55.000 0.00 0.00 44.23 4.30
2751 2752 1.192146 TAACAAGCTCCGTGCCCTCT 61.192 55.000 0.00 0.00 44.23 3.69
2752 2753 2.056906 AACAAGCTCCGTGCCCTCTT 62.057 55.000 0.00 0.00 44.23 2.85
2753 2754 1.302832 CAAGCTCCGTGCCCTCTTT 60.303 57.895 0.00 0.00 44.23 2.52
2754 2755 1.302832 AAGCTCCGTGCCCTCTTTG 60.303 57.895 0.00 0.00 44.23 2.77
2755 2756 2.032681 GCTCCGTGCCCTCTTTGT 59.967 61.111 0.00 0.00 35.15 2.83
2756 2757 1.600916 GCTCCGTGCCCTCTTTGTT 60.601 57.895 0.00 0.00 35.15 2.83
2757 2758 0.321298 GCTCCGTGCCCTCTTTGTTA 60.321 55.000 0.00 0.00 35.15 2.41
2758 2759 1.726853 CTCCGTGCCCTCTTTGTTAG 58.273 55.000 0.00 0.00 0.00 2.34
2759 2760 1.002087 CTCCGTGCCCTCTTTGTTAGT 59.998 52.381 0.00 0.00 0.00 2.24
2760 2761 2.232941 CTCCGTGCCCTCTTTGTTAGTA 59.767 50.000 0.00 0.00 0.00 1.82
2761 2762 2.633967 TCCGTGCCCTCTTTGTTAGTAA 59.366 45.455 0.00 0.00 0.00 2.24
2762 2763 3.071312 TCCGTGCCCTCTTTGTTAGTAAA 59.929 43.478 0.00 0.00 0.00 2.01
2763 2764 3.435671 CCGTGCCCTCTTTGTTAGTAAAG 59.564 47.826 0.00 0.00 38.67 1.85
2764 2765 4.062991 CGTGCCCTCTTTGTTAGTAAAGT 58.937 43.478 0.00 0.00 38.49 2.66
2765 2766 4.514066 CGTGCCCTCTTTGTTAGTAAAGTT 59.486 41.667 0.00 0.00 38.49 2.66
2766 2767 5.697633 CGTGCCCTCTTTGTTAGTAAAGTTA 59.302 40.000 0.00 0.00 38.49 2.24
2767 2768 6.347160 CGTGCCCTCTTTGTTAGTAAAGTTAC 60.347 42.308 0.00 0.00 38.49 2.50
2768 2769 5.999600 TGCCCTCTTTGTTAGTAAAGTTACC 59.000 40.000 0.00 0.00 38.49 2.85
2769 2770 6.183361 TGCCCTCTTTGTTAGTAAAGTTACCT 60.183 38.462 0.00 0.00 38.49 3.08
2770 2771 6.713903 GCCCTCTTTGTTAGTAAAGTTACCTT 59.286 38.462 0.00 0.00 38.49 3.50
2771 2772 7.230108 GCCCTCTTTGTTAGTAAAGTTACCTTT 59.770 37.037 0.00 0.00 43.30 3.11
2772 2773 8.565416 CCCTCTTTGTTAGTAAAGTTACCTTTG 58.435 37.037 0.00 0.00 41.03 2.77
2773 2774 8.074370 CCTCTTTGTTAGTAAAGTTACCTTTGC 58.926 37.037 0.00 0.00 41.03 3.68
2774 2775 8.508883 TCTTTGTTAGTAAAGTTACCTTTGCA 57.491 30.769 3.84 0.00 43.37 4.08
2775 2776 9.127277 TCTTTGTTAGTAAAGTTACCTTTGCAT 57.873 29.630 3.84 0.00 43.37 3.96
2776 2777 9.394477 CTTTGTTAGTAAAGTTACCTTTGCATC 57.606 33.333 3.84 0.00 43.37 3.91
2777 2778 7.443259 TGTTAGTAAAGTTACCTTTGCATCC 57.557 36.000 3.84 0.00 43.37 3.51
2778 2779 6.148150 TGTTAGTAAAGTTACCTTTGCATCCG 59.852 38.462 3.84 0.00 43.37 4.18
2779 2780 4.901868 AGTAAAGTTACCTTTGCATCCGA 58.098 39.130 3.84 0.00 43.37 4.55
2780 2781 5.497474 AGTAAAGTTACCTTTGCATCCGAT 58.503 37.500 3.84 0.00 43.37 4.18
2781 2782 6.646267 AGTAAAGTTACCTTTGCATCCGATA 58.354 36.000 3.84 0.00 43.37 2.92
2782 2783 7.107542 AGTAAAGTTACCTTTGCATCCGATAA 58.892 34.615 3.84 0.00 43.37 1.75
2783 2784 6.436843 AAAGTTACCTTTGCATCCGATAAG 57.563 37.500 0.00 0.00 39.44 1.73
2784 2785 3.877508 AGTTACCTTTGCATCCGATAAGC 59.122 43.478 0.00 0.00 0.00 3.09
2785 2786 1.680338 ACCTTTGCATCCGATAAGCC 58.320 50.000 0.00 0.00 0.00 4.35
2786 2787 0.588252 CCTTTGCATCCGATAAGCCG 59.412 55.000 0.00 0.00 0.00 5.52
2787 2788 1.581934 CTTTGCATCCGATAAGCCGA 58.418 50.000 0.00 0.00 0.00 5.54
2788 2789 2.146342 CTTTGCATCCGATAAGCCGAT 58.854 47.619 0.00 0.00 0.00 4.18
2789 2790 2.254546 TTGCATCCGATAAGCCGATT 57.745 45.000 0.00 0.00 0.00 3.34
2790 2791 3.394674 TTGCATCCGATAAGCCGATTA 57.605 42.857 0.00 0.00 0.00 1.75
2791 2792 3.394674 TGCATCCGATAAGCCGATTAA 57.605 42.857 0.00 0.00 0.00 1.40
2792 2793 3.325870 TGCATCCGATAAGCCGATTAAG 58.674 45.455 0.00 0.00 0.00 1.85
2793 2794 2.673368 GCATCCGATAAGCCGATTAAGG 59.327 50.000 0.00 0.00 0.00 2.69
2794 2795 3.616560 GCATCCGATAAGCCGATTAAGGA 60.617 47.826 6.48 6.48 38.10 3.36
2795 2796 3.936372 TCCGATAAGCCGATTAAGGAG 57.064 47.619 1.28 0.00 32.53 3.69
2796 2797 2.561419 TCCGATAAGCCGATTAAGGAGG 59.439 50.000 1.28 0.00 32.53 4.30
2797 2798 2.353803 CCGATAAGCCGATTAAGGAGGG 60.354 54.545 0.00 0.00 30.78 4.30
2798 2799 2.299297 CGATAAGCCGATTAAGGAGGGT 59.701 50.000 0.00 0.00 37.35 4.34
2799 2800 3.244112 CGATAAGCCGATTAAGGAGGGTT 60.244 47.826 13.23 13.23 46.08 4.11
2802 2803 4.790718 AAGCCGATTAAGGAGGGTTATT 57.209 40.909 8.67 0.00 43.04 1.40
2803 2804 4.086706 AGCCGATTAAGGAGGGTTATTG 57.913 45.455 0.00 0.00 30.74 1.90
2804 2805 3.458487 AGCCGATTAAGGAGGGTTATTGT 59.542 43.478 0.00 0.00 30.74 2.71
2805 2806 3.564225 GCCGATTAAGGAGGGTTATTGTG 59.436 47.826 0.00 0.00 0.00 3.33
2806 2807 4.777463 CCGATTAAGGAGGGTTATTGTGT 58.223 43.478 0.00 0.00 0.00 3.72
2807 2808 4.574828 CCGATTAAGGAGGGTTATTGTGTG 59.425 45.833 0.00 0.00 0.00 3.82
2808 2809 4.035208 CGATTAAGGAGGGTTATTGTGTGC 59.965 45.833 0.00 0.00 0.00 4.57
2809 2810 1.821216 AAGGAGGGTTATTGTGTGCG 58.179 50.000 0.00 0.00 0.00 5.34
2810 2811 0.676782 AGGAGGGTTATTGTGTGCGC 60.677 55.000 0.00 0.00 0.00 6.09
2811 2812 0.958382 GGAGGGTTATTGTGTGCGCA 60.958 55.000 5.66 5.66 0.00 6.09
2812 2813 0.447801 GAGGGTTATTGTGTGCGCAG 59.552 55.000 12.22 0.00 0.00 5.18
2813 2814 0.250727 AGGGTTATTGTGTGCGCAGT 60.251 50.000 12.22 0.00 0.00 4.40
2814 2815 0.109781 GGGTTATTGTGTGCGCAGTG 60.110 55.000 12.22 0.00 0.00 3.66
2815 2816 0.591170 GGTTATTGTGTGCGCAGTGT 59.409 50.000 12.22 0.00 0.00 3.55
2816 2817 1.001815 GGTTATTGTGTGCGCAGTGTT 60.002 47.619 12.22 0.00 0.00 3.32
2817 2818 2.043411 GTTATTGTGTGCGCAGTGTTG 58.957 47.619 12.22 0.00 0.00 3.33
2818 2819 1.304254 TATTGTGTGCGCAGTGTTGT 58.696 45.000 12.22 0.00 0.00 3.32
2819 2820 0.455410 ATTGTGTGCGCAGTGTTGTT 59.545 45.000 12.22 0.00 0.00 2.83
2820 2821 0.179176 TTGTGTGCGCAGTGTTGTTC 60.179 50.000 12.22 0.00 0.00 3.18
2821 2822 1.024046 TGTGTGCGCAGTGTTGTTCT 61.024 50.000 12.22 0.00 0.00 3.01
2822 2823 0.589729 GTGTGCGCAGTGTTGTTCTG 60.590 55.000 12.22 0.00 36.18 3.02
2823 2824 1.009675 GTGCGCAGTGTTGTTCTGG 60.010 57.895 12.22 0.00 33.98 3.86
2824 2825 1.153269 TGCGCAGTGTTGTTCTGGA 60.153 52.632 5.66 0.00 33.98 3.86
2825 2826 1.159713 TGCGCAGTGTTGTTCTGGAG 61.160 55.000 5.66 0.00 33.98 3.86
2826 2827 1.571460 CGCAGTGTTGTTCTGGAGC 59.429 57.895 0.00 0.00 33.98 4.70
2827 2828 1.159713 CGCAGTGTTGTTCTGGAGCA 61.160 55.000 0.00 0.00 33.98 4.26
2828 2829 1.024271 GCAGTGTTGTTCTGGAGCAA 58.976 50.000 0.00 0.00 33.98 3.91
2829 2830 1.405105 GCAGTGTTGTTCTGGAGCAAA 59.595 47.619 1.71 0.00 33.43 3.68
2830 2831 2.035066 GCAGTGTTGTTCTGGAGCAAAT 59.965 45.455 1.71 0.00 33.43 2.32
2831 2832 3.253188 GCAGTGTTGTTCTGGAGCAAATA 59.747 43.478 1.71 0.00 33.43 1.40
2832 2833 4.261572 GCAGTGTTGTTCTGGAGCAAATAA 60.262 41.667 1.71 0.00 33.43 1.40
2833 2834 5.565439 GCAGTGTTGTTCTGGAGCAAATAAT 60.565 40.000 1.71 0.00 33.43 1.28
2834 2835 5.860182 CAGTGTTGTTCTGGAGCAAATAATG 59.140 40.000 1.71 1.60 33.43 1.90
2835 2836 5.047802 AGTGTTGTTCTGGAGCAAATAATGG 60.048 40.000 1.71 0.00 33.43 3.16
2836 2837 5.048083 GTGTTGTTCTGGAGCAAATAATGGA 60.048 40.000 1.71 0.00 33.43 3.41
2837 2838 5.716228 TGTTGTTCTGGAGCAAATAATGGAT 59.284 36.000 1.71 0.00 33.43 3.41
2838 2839 6.889177 TGTTGTTCTGGAGCAAATAATGGATA 59.111 34.615 1.71 0.00 33.43 2.59
2839 2840 6.942532 TGTTCTGGAGCAAATAATGGATAC 57.057 37.500 0.00 0.00 0.00 2.24
2840 2841 6.662755 TGTTCTGGAGCAAATAATGGATACT 58.337 36.000 0.00 0.00 37.61 2.12
2841 2842 7.118723 TGTTCTGGAGCAAATAATGGATACTT 58.881 34.615 0.00 0.00 37.61 2.24
2842 2843 7.283127 TGTTCTGGAGCAAATAATGGATACTTC 59.717 37.037 0.00 0.00 37.61 3.01
2843 2844 7.141758 TCTGGAGCAAATAATGGATACTTCT 57.858 36.000 0.00 0.00 37.61 2.85
2844 2845 6.994496 TCTGGAGCAAATAATGGATACTTCTG 59.006 38.462 0.00 0.00 37.61 3.02
2845 2846 6.899089 TGGAGCAAATAATGGATACTTCTGA 58.101 36.000 0.00 0.00 37.61 3.27
2846 2847 6.767902 TGGAGCAAATAATGGATACTTCTGAC 59.232 38.462 0.00 0.00 37.61 3.51
2847 2848 6.767902 GGAGCAAATAATGGATACTTCTGACA 59.232 38.462 0.00 0.00 37.61 3.58
2848 2849 7.254932 GGAGCAAATAATGGATACTTCTGACAC 60.255 40.741 0.00 0.00 37.61 3.67
2849 2850 7.341805 AGCAAATAATGGATACTTCTGACACT 58.658 34.615 0.00 0.00 37.61 3.55
2850 2851 7.497249 AGCAAATAATGGATACTTCTGACACTC 59.503 37.037 0.00 0.00 37.61 3.51
2851 2852 7.497249 GCAAATAATGGATACTTCTGACACTCT 59.503 37.037 0.00 0.00 37.61 3.24
2856 2857 7.904558 ATGGATACTTCTGACACTCTATTCA 57.095 36.000 0.00 0.00 37.61 2.57
2857 2858 7.904558 TGGATACTTCTGACACTCTATTCAT 57.095 36.000 0.00 0.00 37.61 2.57
2858 2859 8.996651 TGGATACTTCTGACACTCTATTCATA 57.003 34.615 0.00 0.00 37.61 2.15
2859 2860 9.593565 TGGATACTTCTGACACTCTATTCATAT 57.406 33.333 0.00 0.00 37.61 1.78
2864 2865 9.814899 ACTTCTGACACTCTATTCATATTGAAG 57.185 33.333 0.00 0.00 40.05 3.02
2865 2866 9.814899 CTTCTGACACTCTATTCATATTGAAGT 57.185 33.333 0.00 0.00 40.05 3.01
2869 2870 9.942850 TGACACTCTATTCATATTGAAGTTTGA 57.057 29.630 0.00 0.00 40.05 2.69
2900 2901 8.627208 TTGGATATCTTAGAATCTCCAATTGC 57.373 34.615 15.07 0.00 37.74 3.56
2901 2902 7.748677 TGGATATCTTAGAATCTCCAATTGCA 58.251 34.615 0.00 0.00 30.15 4.08
2902 2903 7.881751 TGGATATCTTAGAATCTCCAATTGCAG 59.118 37.037 0.00 0.00 30.15 4.41
2903 2904 8.099537 GGATATCTTAGAATCTCCAATTGCAGA 58.900 37.037 0.52 0.52 0.00 4.26
2904 2905 9.499479 GATATCTTAGAATCTCCAATTGCAGAA 57.501 33.333 2.53 0.00 0.00 3.02
2907 2908 8.899427 TCTTAGAATCTCCAATTGCAGAATAG 57.101 34.615 2.53 0.00 0.00 1.73
2908 2909 8.708378 TCTTAGAATCTCCAATTGCAGAATAGA 58.292 33.333 2.53 0.10 0.00 1.98
2909 2910 9.334947 CTTAGAATCTCCAATTGCAGAATAGAA 57.665 33.333 2.53 0.00 0.00 2.10
2910 2911 7.804843 AGAATCTCCAATTGCAGAATAGAAG 57.195 36.000 2.53 0.00 0.00 2.85
2911 2912 7.571919 AGAATCTCCAATTGCAGAATAGAAGA 58.428 34.615 2.53 0.00 0.00 2.87
2912 2913 8.051535 AGAATCTCCAATTGCAGAATAGAAGAA 58.948 33.333 2.53 0.00 0.00 2.52
2913 2914 6.992063 TCTCCAATTGCAGAATAGAAGAAC 57.008 37.500 0.00 0.00 0.00 3.01
2914 2915 6.715280 TCTCCAATTGCAGAATAGAAGAACT 58.285 36.000 0.00 0.00 0.00 3.01
2915 2916 7.170965 TCTCCAATTGCAGAATAGAAGAACTT 58.829 34.615 0.00 0.00 0.00 2.66
2916 2917 7.335422 TCTCCAATTGCAGAATAGAAGAACTTC 59.665 37.037 0.00 6.46 39.78 3.01
2917 2918 6.375455 TCCAATTGCAGAATAGAAGAACTTCC 59.625 38.462 10.41 0.00 40.33 3.46
2918 2919 6.151648 CCAATTGCAGAATAGAAGAACTTCCA 59.848 38.462 10.41 0.00 40.33 3.53
2919 2920 6.998968 ATTGCAGAATAGAAGAACTTCCAG 57.001 37.500 10.41 0.00 40.33 3.86
2920 2921 5.745312 TGCAGAATAGAAGAACTTCCAGA 57.255 39.130 10.41 0.00 40.33 3.86
2921 2922 6.114187 TGCAGAATAGAAGAACTTCCAGAA 57.886 37.500 10.41 0.00 40.33 3.02
2922 2923 6.169094 TGCAGAATAGAAGAACTTCCAGAAG 58.831 40.000 10.41 5.85 43.79 2.85
2923 2924 5.584251 GCAGAATAGAAGAACTTCCAGAAGG 59.416 44.000 11.87 0.36 42.53 3.46
2924 2925 6.706295 CAGAATAGAAGAACTTCCAGAAGGT 58.294 40.000 11.87 4.92 41.86 3.50
2925 2926 7.579723 GCAGAATAGAAGAACTTCCAGAAGGTA 60.580 40.741 11.87 0.00 38.71 3.08
2926 2927 8.482128 CAGAATAGAAGAACTTCCAGAAGGTAT 58.518 37.037 11.87 0.00 38.71 2.73
2927 2928 8.700973 AGAATAGAAGAACTTCCAGAAGGTATC 58.299 37.037 11.87 7.33 38.71 2.24
2928 2929 7.979786 ATAGAAGAACTTCCAGAAGGTATCA 57.020 36.000 11.87 0.75 38.71 2.15
2929 2930 6.043854 AGAAGAACTTCCAGAAGGTATCAC 57.956 41.667 11.87 1.70 38.71 3.06
2930 2931 4.457834 AGAACTTCCAGAAGGTATCACG 57.542 45.455 11.87 0.00 38.71 4.35
2931 2932