Multiple sequence alignment - TraesCS7A01G567900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G567900 chr7A 100.000 2711 0 0 1 2711 736175934 736173224 0 5007
1 TraesCS7A01G567900 chr7A 99.447 2711 15 0 1 2711 736152541 736149831 0 4924
2 TraesCS7A01G567900 chr7A 98.893 2711 28 2 1 2711 736164241 736161533 0 4839
3 TraesCS7A01G567900 chr7A 94.105 2714 141 7 1 2711 736142567 736139870 0 4108
4 TraesCS7A01G567900 chr7A 98.282 1222 19 1 608 1829 736198551 736197332 0 2139
5 TraesCS7A01G567900 chr7A 95.300 1000 44 3 1 998 736144704 736143706 0 1583
6 TraesCS7A01G567900 chr7A 95.787 902 32 5 1814 2711 736184790 736183891 0 1450


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G567900 chr7A 736173224 736175934 2710 True 5007.0 5007 100.0000 1 2711 1 chr7A.!!$R3 2710
1 TraesCS7A01G567900 chr7A 736149831 736152541 2710 True 4924.0 4924 99.4470 1 2711 1 chr7A.!!$R1 2710
2 TraesCS7A01G567900 chr7A 736161533 736164241 2708 True 4839.0 4839 98.8930 1 2711 1 chr7A.!!$R2 2710
3 TraesCS7A01G567900 chr7A 736139870 736144704 4834 True 2845.5 4108 94.7025 1 2711 2 chr7A.!!$R6 2710
4 TraesCS7A01G567900 chr7A 736197332 736198551 1219 True 2139.0 2139 98.2820 608 1829 1 chr7A.!!$R5 1221
5 TraesCS7A01G567900 chr7A 736183891 736184790 899 True 1450.0 1450 95.7870 1814 2711 1 chr7A.!!$R4 897

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
754 2894 6.919662 CCATGGTTATTGTTTATAGCTTGCTG 59.08 38.462 2.57 0.0 0.0 4.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2643 4787 9.513906 TGAATCCAAACAAGATAACAGATACAA 57.486 29.63 0.0 0.0 0.0 2.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
754 2894 6.919662 CCATGGTTATTGTTTATAGCTTGCTG 59.080 38.462 2.57 0.0 0.00 4.41
1458 3598 3.937706 GACTTCATGTCCCATCTCACAAG 59.062 47.826 0.00 0.0 39.69 3.16
1554 3694 7.891183 ATGGGAGTTCGATATCTTAATTTCG 57.109 36.000 0.34 0.0 37.59 3.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
262 264 2.166829 TGTTCGGGCATACATTTTGCT 58.833 42.857 0.0 0.00 40.03 3.91
754 2894 7.591795 CACAAGTAGTGGAGTTCGTATGATATC 59.408 40.741 0.0 0.00 44.69 1.63
949 3089 0.608035 TGCGAGTGGGTGGAAAATCC 60.608 55.000 0.0 0.00 36.96 3.01
1458 3598 5.468746 TGTGTAGGAAGTAACATGCTTGAAC 59.531 40.000 6.6 4.42 0.00 3.18
2643 4787 9.513906 TGAATCCAAACAAGATAACAGATACAA 57.486 29.630 0.0 0.00 0.00 2.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.