Multiple sequence alignment - TraesCS7A01G548800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G548800 chr7A 100.000 2649 0 0 1 2649 723029968 723032616 0.000000e+00 4855.0
1 TraesCS7A01G548800 chr7A 98.786 1400 17 0 1250 2649 722938407 722939806 0.000000e+00 2492.0
2 TraesCS7A01G548800 chr7A 98.557 1178 17 0 233 1410 722897846 722899023 0.000000e+00 2082.0
3 TraesCS7A01G548800 chr7A 98.786 1153 14 0 1409 2561 722899434 722900586 0.000000e+00 2052.0
4 TraesCS7A01G548800 chr7A 97.174 1203 28 5 211 1410 722987335 722988534 0.000000e+00 2028.0
5 TraesCS7A01G548800 chr7A 99.178 1095 9 0 163 1257 722935833 722936927 0.000000e+00 1973.0
6 TraesCS7A01G548800 chr7A 94.684 1204 42 7 211 1410 723074056 723075241 0.000000e+00 1849.0
7 TraesCS7A01G548800 chr7A 95.218 1171 35 10 1409 2561 723075644 723076811 0.000000e+00 1832.0
8 TraesCS7A01G548800 chr7A 98.843 778 9 0 1409 2186 722988945 722989722 0.000000e+00 1387.0
9 TraesCS7A01G548800 chr7A 90.030 672 54 6 1890 2561 722879395 722880053 0.000000e+00 857.0
10 TraesCS7A01G548800 chr7A 80.863 695 116 15 1877 2561 722794709 722795396 5.020000e-147 531.0
11 TraesCS7A01G548800 chr7A 98.524 271 4 0 2291 2561 722989718 722989988 1.840000e-131 479.0
12 TraesCS7A01G548800 chr7A 87.838 296 21 9 1115 1410 722793086 722793366 1.520000e-87 333.0
13 TraesCS7A01G548800 chr7A 87.838 296 21 9 1115 1410 722877621 722877901 1.520000e-87 333.0
14 TraesCS7A01G548800 chr7A 93.333 180 11 1 954 1132 722792895 722793074 5.620000e-67 265.0
15 TraesCS7A01G548800 chr7A 96.053 152 6 0 1 152 722987170 722987321 5.660000e-62 248.0
16 TraesCS7A01G548800 chr7A 96.053 152 6 0 1 152 723073896 723074047 5.660000e-62 248.0
17 TraesCS7A01G548800 chr7A 97.778 135 3 0 1 135 722935626 722935760 1.590000e-57 233.0
18 TraesCS7A01G548800 chr7A 96.591 88 2 1 2562 2649 79784535 79784621 7.640000e-31 145.0
19 TraesCS7A01G548800 chr7A 92.537 67 4 1 223 289 723081262 723081327 7.810000e-16 95.3
20 TraesCS7A01G548800 chr7B 85.653 1164 131 22 1417 2561 728013687 728014833 0.000000e+00 1192.0
21 TraesCS7A01G548800 chr7B 92.529 522 25 1 889 1410 728012766 728013273 0.000000e+00 736.0
22 TraesCS7A01G548800 chr7B 87.713 586 65 7 222 803 728012050 728012632 0.000000e+00 676.0
23 TraesCS7A01G548800 chr7B 82.664 548 86 8 218 761 728029317 728029859 6.630000e-131 477.0
24 TraesCS7A01G548800 chr7B 82.246 552 81 10 210 746 728052945 728053494 6.680000e-126 460.0
25 TraesCS7A01G548800 chr7B 87.119 295 23 1 1115 1409 728005896 728006175 1.180000e-83 320.0
26 TraesCS7A01G548800 chr7B 91.284 218 12 2 916 1132 728005673 728005884 9.280000e-75 291.0
27 TraesCS7A01G548800 chr7D 78.706 958 139 37 1411 2355 627299210 627300115 1.770000e-161 579.0
28 TraesCS7A01G548800 chr7D 95.882 340 7 1 889 1228 627305107 627305439 6.450000e-151 544.0
29 TraesCS7A01G548800 chr7D 88.462 312 35 1 495 805 627304664 627304975 2.490000e-100 375.0
30 TraesCS7A01G548800 chr7D 87.162 296 23 6 1115 1410 627298537 627298817 3.290000e-84 322.0
31 TraesCS7A01G548800 chr7D 94.000 200 11 1 1409 1608 627305665 627305863 4.290000e-78 302.0
32 TraesCS7A01G548800 chr7D 95.556 180 7 1 954 1132 627298346 627298525 1.200000e-73 287.0
33 TraesCS7A01G548800 chr7D 94.595 185 10 0 2377 2561 627305967 627306151 1.200000e-73 287.0
34 TraesCS7A01G548800 chr7D 93.548 93 4 2 1 91 575500571 575500663 1.280000e-28 137.0
35 TraesCS7A01G548800 chr4A 97.727 88 2 0 2562 2649 600517958 600518045 4.570000e-33 152.0
36 TraesCS7A01G548800 chr6A 96.591 88 3 0 2562 2649 17832912 17832999 2.120000e-31 147.0
37 TraesCS7A01G548800 chr6A 96.471 85 3 0 4 88 69052551 69052635 9.890000e-30 141.0
38 TraesCS7A01G548800 chr3A 96.629 89 2 1 2561 2649 54227656 54227569 2.120000e-31 147.0
39 TraesCS7A01G548800 chr3D 95.604 91 3 1 2559 2649 14023731 14023642 7.640000e-31 145.0
40 TraesCS7A01G548800 chr2A 96.591 88 2 1 2562 2649 78255295 78255209 7.640000e-31 145.0
41 TraesCS7A01G548800 chr2A 96.591 88 2 1 2562 2649 686690697 686690611 7.640000e-31 145.0
42 TraesCS7A01G548800 chr4D 94.624 93 3 2 2558 2649 440412964 440413055 2.750000e-30 143.0
43 TraesCS7A01G548800 chr5D 97.561 82 2 0 7 88 35808555 35808474 9.890000e-30 141.0
44 TraesCS7A01G548800 chr5D 97.500 80 2 0 7 86 216772460 216772381 1.280000e-28 137.0
45 TraesCS7A01G548800 chr2D 97.561 82 2 0 7 88 622224080 622223999 9.890000e-30 141.0
46 TraesCS7A01G548800 chrUn 95.349 86 4 0 1 86 116768438 116768523 1.280000e-28 137.0
47 TraesCS7A01G548800 chr1D 95.349 86 4 0 1 86 474940373 474940458 1.280000e-28 137.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G548800 chr7A 723029968 723032616 2648 False 4855.000000 4855 100.000000 1 2649 1 chr7A.!!$F2 2648
1 TraesCS7A01G548800 chr7A 722897846 722900586 2740 False 2067.000000 2082 98.671500 233 2561 2 chr7A.!!$F6 2328
2 TraesCS7A01G548800 chr7A 722935626 722939806 4180 False 1566.000000 2492 98.580667 1 2649 3 chr7A.!!$F7 2648
3 TraesCS7A01G548800 chr7A 723073896 723076811 2915 False 1309.666667 1849 95.318333 1 2561 3 chr7A.!!$F9 2560
4 TraesCS7A01G548800 chr7A 722987170 722989988 2818 False 1035.500000 2028 97.648500 1 2561 4 chr7A.!!$F8 2560
5 TraesCS7A01G548800 chr7A 722877621 722880053 2432 False 595.000000 857 88.934000 1115 2561 2 chr7A.!!$F5 1446
6 TraesCS7A01G548800 chr7A 722792895 722795396 2501 False 376.333333 531 87.344667 954 2561 3 chr7A.!!$F4 1607
7 TraesCS7A01G548800 chr7B 728012050 728014833 2783 False 868.000000 1192 88.631667 222 2561 3 chr7B.!!$F4 2339
8 TraesCS7A01G548800 chr7B 728029317 728029859 542 False 477.000000 477 82.664000 218 761 1 chr7B.!!$F1 543
9 TraesCS7A01G548800 chr7B 728052945 728053494 549 False 460.000000 460 82.246000 210 746 1 chr7B.!!$F2 536
10 TraesCS7A01G548800 chr7B 728005673 728006175 502 False 305.500000 320 89.201500 916 1409 2 chr7B.!!$F3 493
11 TraesCS7A01G548800 chr7D 627298346 627300115 1769 False 396.000000 579 87.141333 954 2355 3 chr7D.!!$F2 1401
12 TraesCS7A01G548800 chr7D 627304664 627306151 1487 False 377.000000 544 93.234750 495 2561 4 chr7D.!!$F3 2066

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1325 2954 1.138247 GCTGCAAGATGCCTTTCCG 59.862 57.895 0.0 0.0 44.23 4.3 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2150 5317 7.127917 GACAGTTGTTTTTGTGTCCAATTTT 57.872 32.0 0.0 0.0 34.45 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1325 2954 1.138247 GCTGCAAGATGCCTTTCCG 59.862 57.895 0.00 0.00 44.23 4.30
1786 3874 0.744281 CTGGCCGAAACCAAAAGTGT 59.256 50.000 0.00 0.00 39.86 3.55
1950 4044 3.471495 AATTAAAGCGCTCTGTTTCGG 57.529 42.857 12.06 0.00 0.00 4.30
2029 5195 1.268625 GGCCAAGAAACGTTTCCGAAT 59.731 47.619 31.87 14.94 37.92 3.34
2272 5440 1.267806 AGTGTTTTGAATCCAGCGCAG 59.732 47.619 11.47 0.00 0.00 5.18
2635 5805 1.002134 ACGGCCAGGATGAACCAAG 60.002 57.895 2.24 0.00 39.69 3.61
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
611 661 2.126307 CTCTCACGACCAGCACGG 60.126 66.667 0.00 0.00 42.50 4.94
1838 3926 0.532640 AGCATGCGACACACTTGACA 60.533 50.000 13.01 0.00 0.00 3.58
1841 3929 1.530720 TGTAAGCATGCGACACACTTG 59.469 47.619 20.44 0.00 0.00 3.16
1950 4044 7.066525 AGGAAACTCTCATAGCGTATATAGAGC 59.933 40.741 0.00 2.73 32.90 4.09
1994 4562 0.251742 TGGCCCCATTGTTCTTCTGG 60.252 55.000 0.00 0.00 0.00 3.86
2062 5229 6.197655 TGAATAACGCTGTATTCGACATACAC 59.802 38.462 13.14 10.49 41.49 2.90
2150 5317 7.127917 GACAGTTGTTTTTGTGTCCAATTTT 57.872 32.000 0.00 0.00 34.45 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.