Multiple sequence alignment - TraesCS7A01G548700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS7A01G548700 chr7A 100.000 2745 0 0 1 2745 722987080 722989824 0.000000e+00 5070
1 TraesCS7A01G548700 chr7A 95.605 2662 69 16 1 2643 723073806 723076438 0.000000e+00 4224
2 TraesCS7A01G548700 chr7A 98.523 2369 31 4 278 2643 722897844 722900211 0.000000e+00 4178
3 TraesCS7A01G548700 chr7A 97.174 1203 28 5 256 1455 723030178 723031377 0.000000e+00 2028
4 TraesCS7A01G548700 chr7A 96.667 1050 29 5 256 1302 722935881 722936927 0.000000e+00 1740
5 TraesCS7A01G548700 chr7A 84.539 1507 160 40 1160 2641 722793086 722794544 0.000000e+00 1424
6 TraesCS7A01G548700 chr7A 84.529 1506 161 39 1160 2641 722877621 722879078 0.000000e+00 1424
7 TraesCS7A01G548700 chr7A 99.357 778 5 0 1866 2643 722938566 722939343 0.000000e+00 1410
8 TraesCS7A01G548700 chr7A 98.843 778 9 0 1866 2643 723031376 723032153 0.000000e+00 1387
9 TraesCS7A01G548700 chr7A 92.975 242 10 1 1 242 723029885 723030119 2.020000e-91 346
10 TraesCS7A01G548700 chr7A 88.294 299 19 6 2347 2643 722879395 722879679 7.280000e-91 344
11 TraesCS7A01G548700 chr7A 91.556 225 12 1 1 225 722935543 722935760 1.240000e-78 303
12 TraesCS7A01G548700 chr7A 98.758 161 2 0 1295 1455 722938407 722938567 1.240000e-73 287
13 TraesCS7A01G548700 chr7A 94.798 173 9 0 1 173 714270084 714270256 1.250000e-68 270
14 TraesCS7A01G548700 chr7A 93.143 175 12 0 999 1173 722792895 722793069 9.750000e-65 257
15 TraesCS7A01G548700 chr7A 99.065 107 1 0 2639 2745 722900316 722900422 2.790000e-45 193
16 TraesCS7A01G548700 chr7A 99.065 107 1 0 2639 2745 722939448 722939554 2.790000e-45 193
17 TraesCS7A01G548700 chr7A 99.065 107 1 0 2639 2745 723032258 723032364 2.790000e-45 193
18 TraesCS7A01G548700 chr7A 96.262 107 4 0 2639 2745 723076541 723076647 2.810000e-40 176
19 TraesCS7A01G548700 chr7A 92.523 107 8 0 2639 2745 722879784 722879890 1.320000e-33 154
20 TraesCS7A01G548700 chr7B 87.702 1732 154 26 934 2643 728012766 728014460 0.000000e+00 1964
21 TraesCS7A01G548700 chr7B 83.100 1497 178 42 1160 2641 728005896 728007332 0.000000e+00 1293
22 TraesCS7A01G548700 chr7B 86.993 592 68 9 263 848 728012044 728012632 0.000000e+00 658
23 TraesCS7A01G548700 chr7B 83.150 546 81 9 267 806 728029319 728029859 3.180000e-134 488
24 TraesCS7A01G548700 chr7B 83.633 501 68 6 304 791 728052995 728053494 2.490000e-125 459
25 TraesCS7A01G548700 chr7B 91.080 213 13 1 961 1173 728005673 728005879 1.610000e-72 283
26 TraesCS7A01G548700 chr7D 84.790 1407 141 37 1160 2552 627298537 627299884 0.000000e+00 1345
27 TraesCS7A01G548700 chr7D 93.532 402 21 4 1665 2065 627305466 627305863 6.550000e-166 593
28 TraesCS7A01G548700 chr7D 94.706 340 11 1 934 1273 627305107 627305439 3.130000e-144 521
29 TraesCS7A01G548700 chr7D 88.782 312 34 1 540 850 627304664 627304975 5.550000e-102 381
30 TraesCS7A01G548700 chr7D 95.429 175 8 0 999 1173 627298346 627298520 2.080000e-71 279
31 TraesCS7A01G548700 chr5D 94.798 173 9 0 1 173 416449199 416449027 1.250000e-68 270
32 TraesCS7A01G548700 chr4A 94.798 173 9 0 1 173 248111890 248112062 1.250000e-68 270
33 TraesCS7A01G548700 chr4A 94.798 173 9 0 1 173 443240086 443240258 1.250000e-68 270
34 TraesCS7A01G548700 chr2D 94.798 173 9 0 1 173 70372355 70372527 1.250000e-68 270
35 TraesCS7A01G548700 chr6D 93.820 178 11 0 1 178 141408113 141407936 4.510000e-68 268


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS7A01G548700 chr7A 722987080 722989824 2744 False 5070.000000 5070 100.000000 1 2745 1 chr7A.!!$F2 2744
1 TraesCS7A01G548700 chr7A 723073806 723076647 2841 False 2200.000000 4224 95.933500 1 2745 2 chr7A.!!$F8 2744
2 TraesCS7A01G548700 chr7A 722897844 722900422 2578 False 2185.500000 4178 98.794000 278 2745 2 chr7A.!!$F5 2467
3 TraesCS7A01G548700 chr7A 723029885 723032364 2479 False 988.500000 2028 97.014250 1 2745 4 chr7A.!!$F7 2744
4 TraesCS7A01G548700 chr7A 722792895 722794544 1649 False 840.500000 1424 88.841000 999 2641 2 chr7A.!!$F3 1642
5 TraesCS7A01G548700 chr7A 722935543 722939554 4011 False 786.600000 1740 97.080600 1 2745 5 chr7A.!!$F6 2744
6 TraesCS7A01G548700 chr7A 722877621 722879890 2269 False 640.666667 1424 88.448667 1160 2745 3 chr7A.!!$F4 1585
7 TraesCS7A01G548700 chr7B 728012044 728014460 2416 False 1311.000000 1964 87.347500 263 2643 2 chr7B.!!$F4 2380
8 TraesCS7A01G548700 chr7B 728005673 728007332 1659 False 788.000000 1293 87.090000 961 2641 2 chr7B.!!$F3 1680
9 TraesCS7A01G548700 chr7B 728029319 728029859 540 False 488.000000 488 83.150000 267 806 1 chr7B.!!$F1 539
10 TraesCS7A01G548700 chr7D 627298346 627299884 1538 False 812.000000 1345 90.109500 999 2552 2 chr7D.!!$F1 1553
11 TraesCS7A01G548700 chr7D 627304664 627305863 1199 False 498.333333 593 92.340000 540 2065 3 chr7D.!!$F2 1525

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
258 259 0.250901 CAATCTTATCGGGCTGGGGG 60.251 60.000 0.0 0.0 0.00 5.40 F
812 909 4.932146 ACGCAAATGTTTCTTAGCAAAGT 58.068 34.783 0.0 0.0 34.13 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1243 1422 4.029186 CGTGTGGCTGCGCATGTT 62.029 61.111 12.24 0.0 0.0 2.71 R
1877 3562 5.286082 GGCTAATGTCAAATAAAACAGCACG 59.714 40.000 0.00 0.0 0.0 5.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
70 71 4.627801 TAGCGCGGGTGCAAACCA 62.628 61.111 8.83 0.0 42.97 3.67
82 83 4.243270 GGTGCAAACCACACTACTACTAG 58.757 47.826 0.00 0.0 46.50 2.57
252 253 4.636206 ACAGAGTTTTCAATCTTATCGGGC 59.364 41.667 0.00 0.0 0.00 6.13
253 254 4.878397 CAGAGTTTTCAATCTTATCGGGCT 59.122 41.667 0.00 0.0 0.00 5.19
256 257 2.638480 TTCAATCTTATCGGGCTGGG 57.362 50.000 0.00 0.0 0.00 4.45
257 258 0.764890 TCAATCTTATCGGGCTGGGG 59.235 55.000 0.00 0.0 0.00 4.96
258 259 0.250901 CAATCTTATCGGGCTGGGGG 60.251 60.000 0.00 0.0 0.00 5.40
812 909 4.932146 ACGCAAATGTTTCTTAGCAAAGT 58.068 34.783 0.00 0.0 34.13 2.66
1495 3161 0.457166 CGTCCTGTTCGGCGTTGATA 60.457 55.000 6.85 0.0 0.00 2.15
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 5.600696 TGACTATATCAGCATCGCTTTTCA 58.399 37.500 0.00 0.0 36.40 2.69
260 261 2.417558 GATGCCTATCCAGTGCCCCC 62.418 65.000 0.00 0.0 0.00 5.40
812 909 0.034337 GCCGGTGTGGAGACTGTAAA 59.966 55.000 1.90 0.0 42.00 2.01
1243 1422 4.029186 CGTGTGGCTGCGCATGTT 62.029 61.111 12.24 0.0 0.00 2.71
1877 3562 5.286082 GGCTAATGTCAAATAAAACAGCACG 59.714 40.000 0.00 0.0 0.00 5.34
2607 4934 7.127917 GACAGTTGTTTTTGTGTCCAATTTT 57.872 32.000 0.00 0.0 34.45 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.